Search Results

Search found 42625 results on 1705 pages for 'function points'.

Page 607/1705 | < Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • chrome extension: get specific part of the current tab page in DOM object and display it in either popup.html or new html page?

    - by sandeep
    IS there any way so that i can convert any DOM object into HTML page within the script ? suppose I have dom object like this: content script.js chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "fromPopup") { console.log("got Request from Popup"); var myDivObj = document.getElementById("definition"); //sendResponse({data: "from Content Script to Popup"}); if ( myDivObj ) { sendResponse({data:myDivObj}); } else{ sendResponse({data:"Empty or No Tag"}); } console.log("sent Response1"); } else { sendResponse({}); // snub them. console.log("sent Response2"); } }); here is my popup.html <body> <Div>Searching..</Div> <Div id="output">Response??</Div> <script> console.log("Pop UP Clicked"); chrome.tabs.getSelected(null, function(tab) { chrome.tabs.sendRequest(tab.id, {method: "fromPopup", tabid: tab.id}, function(response) { console.log("got Response from Content Script"); document.getElementById("output").innerHTML=response.data; }); }); </script> </body> I know we can send onaly JSON type of data to the popup.html page.. am i right ? If yes is ther any way that I can creat HTML page with DOM Object( myDivObj ) which I collected.. Any alternative solution..? In short i want get only specific part of the current tab page in DOM object and display it in either popup.html or separate html page..

    Read the article

  • Segmentation fault on certain inputs and not others

    - by Brandon Schwandt
    Heres a function I wrote that has some debugging elements in it already. When i enter either a "y" or a "Y" as the input I get a segmentation fault during runtime. When I enter any other value the code runs. The seg fault kicks out after it scans and gives me the response but before the "scan worked" line is output. DOn't know why it would act like this only on these values. If anyone needs the function call I have that as well. query_user(char *response [10]) { printf("response after query call before clear=%s\n",response); strcpy(response,""); printf("response after clearing before scan=%s\n",response); printf("Enter another person into the line? y or n\n"); scanf("%s", response); printf("response after scan=%s\n",response); printf("scan worked"); } main() { char response [10]; strcpy(response,"y"); printf("response=%s\n",response); printf("When finished with program type \"done\" to exit\n"); while (strcmp(response,"done") != 0) { printf("response after while loop and before query call=%s\n",response); query_user(&response); } } output on error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n y response after scan=y Segmentation Fault (core dumped) output on non-error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n n response after scan=n scan worked Cycle number 0 (program continues to run outside this function)

    Read the article

  • _beginthreadx and socket

    - by user638197
    hi, i have a question about the _beginthreadx function In the third and fourth parameter: if i have this line to create the thread hThread=(HANDLE)_beginthreadex(0,0, &RunThread, &m_socket,CREATE_SUSPENDED,&threadID ); m_socket is the socket that i want inside the thread (fourth parameter) and i have the RunThread function (third parameter) in this way static unsigned __stdcall RunThread (void* ptr) { return 0; } It is sufficient to create the thread independently if m_socket has something or not? Thanks in advance Thank you for the response Ciaran Keating helped me understand better the thread I'll explain a little more the situation I´m creating the tread in this function inside a class public: void getClientsConnection() { numberOfClients = 1; SOCKET temporalSocket = NULL; firstClient = NULL; secondClient = NULL; while (numberOfClients < 2) { temporalSocket = SOCKET_ERROR; while (temporalSocket == SOCKET_ERROR) { temporalSocket = accept(m_socket, NULL, NULL); //----------------------------------------------- HANDLE hThread; unsigned threadID; hThread=(HANDLE)_beginthreadex(0,0, &RunThread, &m_socket,CREATE_SUSPENDED,&threadID ); WaitForSingleObject( hThread, INFINITE ); if(!hThread) printf("ERROR AL CREAR EL HILO: %ld\n", WSAGetLastError()); //----------------------------------------------- } if(firstClient == NULL) { firstClient = temporalSocket; muebleC1 = temporalSocket; actionC1 = temporalSocket; ++numberOfClients; printf("CLIENTE 1 CONECTADO\n"); } else { secondClient = temporalSocket; muebleC2 = temporalSocket; actionC2 = temporalSocket; ++numberOfClients; printf("CLIENTE 2 CONECTADO\n"); } } } What i'm trying to do is to have the socket inside the thread while wait for a client connection Is this feasible as i have the code of the thread? I can change the state of the thread that is not a problem Thanks again

    Read the article

  • Symfony2 entity field type alternatives to "property" or "__toString()"?

    - by Polmonino
    Using Symfony2 entity field type one should specify property option: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => 'first', )); But sometimes this is not sufficient: think about two customers with the same name, so display the email (unique) would be mandatory. Another possibility is to implement __toString() into the model: class Customer { public $first, $last, $email; public function __toString() { return sprintf('%s %s (%s)', $this->first, $this->last, $this->email); } } The disadvances of the latter is that you are forced to display the entity the same way in all your forms. Is there any other way to make this more flexible? I mean something like a callback function: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => function($data) { return sprintf('%s %s (%s)', $data->first, $data->last, $data->email); }, ));

    Read the article

  • Error 2025: The supplied DisplayObject must be a child of the caller

    - by Mocca
    Hi, sorry, new to actionscript 3. I have a display() function for an object rotator(image based like a QT object movie). It first saves the current image in a helper variable and then allocates a new image, from the library, beneath the old one. To get a nice crossfade effect, the old image's alpha is looped down via enter_frame and then removed. Which is where there seems to be an issue with the display list, maybe recognizing oldImg's value as being already added? (it's not a first pass error) Btw, do i have to remove the old image or can i leave it, for when it's being called up via the mouse position again? (the image number can get fairly large) Does anyone have further insight? Thanks! function display(num:Number):void //num: image number { ... oldImg = newImg; ClassReference = getDefinitionByName("Class"+num) as Class; imgBD = new ClassReference(0,0); newImg = new Bitmap(imgBD); images.addChild(newImg); newImg.x=0; newImg.y=0; } function onEnter(evt:Event):void { if (oldImg) { if (oldImg.alpha > 0) oldImg.alpha -= 0.15; **else images.removeChild(oldImg);** } ... }

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Two Objects created with the same Address in Flex

    - by James
    Hi, I have an issue in flex which is causing a bit of a headache! I am adding objects to an ArrayCollection but in doing so, another ArrayCollection is also picking up these changes even though there is no binding occurring. I can see from the debug that the two ACs have the same address but for the life of me can't figure out why. I have two Array Collections: model.index.rows //The main array collection model.index.holdRows //The array collection that imitates the above This phantom data binding occurs only for the first iteration in the loop and for all others it will just write it the once. The reason this is proving troublesome is that it creates duplicate entries in my datagrid. public override function handleMessage(message:IMessage):void { super.handleMessage(message); if (message is IndexResponse) { var response:IndexResponse = message as IndexResponse; model.index.rows.removeAll(); model.index.indexIsEmpty = response.nullIndex; if (model.index.indexIsEmpty !== true) { //Update the index model from the response. Note: each property of the row object will be shown in the UI as a column in the grid response.index.forEach(function(entry:EntryData, i:int, a:Array):void { var row:Object = { fileID: entry.fileID, dadName: entry.dadName }; entry.tags.forEach(function(tag:Tag, i:int, a:Array):void { row[tag.name] = tag.value; }); model.index.rows.addItem(row); }); if(model.index.indexForNetworkView == true){ model.index.holdRows.source = model.index.holdRows.source.concat(model.index.rows.source); model.index.indexCounter++; model.index.indexForNetworkView = false; controller.indexController.showNetwork(model.index.indexCounter); } model.index.rows.refresh(); controller.networkController.show(); } } Has anyone else who has encountered something simillar propose a solution?

    Read the article

  • Actionscript Enterframe Movement

    - by David
    I am trying to make accelerated movement, but I am running into a problem that, for the life of me, I cannot understand. My class definition: public class Player extends MovieClip { private var stageRef:Stage; private var key:KeyObject; private var acceleration:int = .5; private var curSpeed:int = 0; public function Player(stageRef:Stage) { this.stageRef = stageRef; addEventListener(Event.ENTER_FRAME, enterFrame); key = new KeyObject(stageRef); } public function enterFrame(e:Event) : void { if(key.isDown(key.RIGHT)) { x += 5; } } } This works to move my position in the x direction at a constant rate. However, if I change enterFrame to public function enterFrame(e:Event) : void { if(key.isDown(key.RIGHT)) { x += acceleration; } } No movement occurs. Is there something going on in the event I do not understand? Why is it that I can have x increased by a constant value but not a constant value as defined in a variable in the class? Is it a scope issue?

    Read the article

  • Help me build a CouchDB mapreduce

    - by mit
    There are CouchDB documents that are list elements: { "type" : "el", "id" : "1", "content" : "first" } { "type" : "el", "id" : "2", "content" : "second" } { "type" : "el", "id" : "3", "content" : "third" } There is one document that defines the list: { "type" : "list", "elements" : ["2","1"] , "id" : "abc123" } As you can see the third element was deleted, it is no longer part of the list. So it must not be part of the result. Now I want a view that returns the content elements including the right order. The result could be: { "content" : ["second", "first"] } In this case the order of the elements is already as it should be. Another possible result: { "content" : [{"content" : "first", "order" : 2},{"content" : "second", "order" : 1}] } I started writing the map function: map = function (doc) { if (doc.type === 'el') { emit(doc.id, {"content" : doc.content}); //emit the id and the content exit; } if (doc.type === 'list') { for ( var i=0, l=doc.elements.length; i<l; ++i ){ emit(doc.elements[i], { "order" : i }); //emit the id and the order } } } This is as far as I can get. Can you correct my mistakes and write a reduce function? Remember that the third document must not be part of the result.

    Read the article

  • Handling Apache Thrift list/map Return Types in C++

    - by initzero
    First off, I'll say I'm not the most competent C++ programmer, but I'm learning, and enjoying the power of Thrift. I've implemented a Thrift Service with some basic functions that return void, i32, and list. I'm using a Python client controlled by a Django web app to make RPC calls and it works pretty well. The generated code is pretty straight forward, except for list returns: namespace cpp Remote enum N_PROTO { N_TCP, N_UDP, N_ANY } service Rcon { i32 ping() i32 KillFlows() i32 RestartDispatch() i32 PrintActiveFlows() i32 PrintActiveListeners(1:i32 proto) list<string> ListAllFlows() } The generated signatures from Rcon.h: int32_t ping(); int32_t KillFlows(); int32_t RestartDispatch(); int32_t PrintActiveFlows(); int32_t PrintActiveListeners(const int32_t proto); int64_t ListenerBytesReceived(const int32_t id); void ListAllFlows(std::vector<std::string> & _return); As you see, the ListAllFlows() function generated takes a reference to a vector of strings. I guess I expect it to return a vector of strings as laid out in the .thrift description. I'm wondering if I am meant to provide the function a vector of strings to modify and then Thrift will handle returning it to my client despite the function returning void. I can find absolutely no resources or example usages of Thrift list< types in C++. Any guidance would be appreciated.

    Read the article

  • JavaScript onClick() Display

    - by junaidkaps
    I have an array consisting of several objects containing Strings. I am successfully able to display the array by using: <td><p onclick="theMiddle(this)">The Middle</td> As you see from the td tag this is part of a table. Issue is that the browser opens up a new page to display my text. I have been trying to display the array above my table in a p tag. //JavaScript var arrayTheMiddle = new Array (showName.theMiddle, beginingTime.theMiddle, network.abc, duration.thirty, rating.general, description.theMiddle, showImage.theMiddle); function theMiddle(obj){ for(i=0; i < arrayTheMiddle.length; i++) { document.write(arrayTheMiddle[i] + "<br>"); } } //HTML File <p>Would like the array/function displayed here while the user clicks within the table below (entire table has not been listed)</p> <td><p onclick="theMiddle(this)">The Middle</td> Unfortunately I am constantly failing at utilizing get element by id to call my function which consists of an array. I have searched for all sorts of stuff, yet frankly I'm lost. Not even sure if my approach is correct at this point. I'm sure this is one of those simple things that are blowing over my head!

    Read the article

  • change value after ajax request!

    - by Lina
    if i have 3 html pages as follows: home.html: <form method="get"> <input class="someForm" type="radio" value="1" name="someForm" /> Name <input class="someForm" type="radio" value="2" name="someForm" /> Email <div id="container"></div> <input type="submit" /> </form> <script type="text/javascript" src="jquery.js"></script> <script> var ajaxResponse = new Object(); $(document).ready(function () { $('.someForm').click(function () { var rbVal = $(this).val(); var myContent; if (ajaxResponse[rbVal]) { //in cache myContent = ajaxResponse[rbVal]; $("#container").html(myContent); } else { // not in cache var urlForAjaxCall = "file" + rbVal + ".html"; $.get(urlForAjaxCall, function (myContent) { ajaxResponse[rbVal] = myContent; $("#container").html(myContent); }); } }); }); </script> file1.html: Name: <input type="text" name="1" value="myName" /> file2.html: Email: <input type="text" name="2" value="[email protected]" /> what i want to do is that when i write something in one of the textboxes and then click whichever radio button in home.html, the value attribute should be changed to the new value, any idea on how to do that? tia

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • Uploading multiple files asynchronously by blueimp jquery-fileupload

    - by Ryo
    I'm using jQuery File Upload library (http://github.com/blueimp/jQuery-File-Upload), and I've been stuck figuring out how to use the library satisfying the following conditions. The page has multiple file input fields surrounded by a form tag. Users can attach multiple files to each input field All files are sent to a server when the button is clicked, not when files are attached to the input fields. Upload is done asynchronously Say the page has 3 input fields with their name attributes being "file1[]", "file2[]" and "file3[]", the request payload should be like {file1: [ array of files on file1[] ], file2: [ array of files on file2[] ], ...} Here's jsFiddle, it's behaving weird so far in that it sends post request twice and the first one is cancelled. http://jsfiddle.net/BAQtG/24/ The core part of js code looks like this. $(document).ready(function(){ var filesList = [] var elem = $("form") file_upload = elem.fileupload({ formData:{extra:1}, autoUpload: false, fileInput: $("input:file"), }).on("fileuploadadd", function(e, data){ filesList.push(data.files[0]) }); $("button").click(function(){ file_upload.fileupload('send', {files:filesList} ) }) }) Anybody have idea how to get this to work? Updates Now thanks to @CBroe 's comment, the issue that request is sent twice is fixed. However the keys of request parameter is not correctly set. Here's updated jsFiddle. http://jsfiddle.net/BAQtG/27/

    Read the article

  • jquery with php loading file

    - by Marcus Solv
    I'm trying to use jquery with a simple php code: $('#some').click(function() { <?php require_once('some1.php?name="some' + index + '"'); ?> }); It shows no error, so I don't know what is wrong. In some1 I have: <?php //Start session session_start(); //Include database connection details require_once('../sql/config.php'); //Connect to mysql server $link = mysql_connect(DB_HOST, DB_USER, DB_PASSWORD); if(!$link) { die('Failed to connect to server: ' . mysql_error()); } //Select database $db = mysql_select_db(DB_DATABASE); if(!$db) { die("Unable to select database"); } //Function to sanitize values received from the form. Prevents SQL injection function clean($str) { $str = @trim($str); if(get_magic_quotes_gpc()) { $str = stripslashes($str); } return mysql_real_escape_string($str); } //Sanitize the POST values $name = clean($_GET['name']); ?> It's not complete because I want to make a sql command (insert). I want when I click in #some to execute that file (create a entry in the table that isn't define yet).

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

< Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >