Search Results

Search found 42625 results on 1705 pages for 'function points'.

Page 608/1705 | < Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Codeigniter Inputting session data from model for a simple authentication system

    - by user1616244
    Trying to put together a simple login authentication. Been at this for quite sometime, and I can't find where I'm going wrong. Pretty new to Codeigniter and OOP PHP. I know there are authentication libraries out there, but I'm not interested in using those. Model: function login($username, $password){ if ($this->db->table_exists($username)){ $this->db->where('username', $username); $this->db->where('password', $password); $query = $this->db->get($username); if($query->num_rows >= 1) { return true; $data = array( 'username' => $this->input->post('username'), 'login' => true ); $this->session->set_userdata($data); } } } Controller function __construct(){ parent::__construct(); $this->logincheck(); } public function logincheck(){ if ($this->session->userdata('login')){ redirect('/members'); } } If I just echo from the controller: $this-session-all_userdata(); I get an empty array. So the problem seems to be that the $data array in the model isn't being stored in the session.

    Read the article

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • JSON Array Created in PHP/MySQL incorrectly decoded using JQuery

    - by Zak
    I am attempting to make an AJAX call to a very small PHP script that should return me an array that could be echo'd and decoded using JQuery. Here is what I have: My PHP page called to by AJAX: $web_q=mysql_query("select * from sec_u_g where uid='$id' "); $rs = array(); while($rs[] = mysql_fetch_assoc($web_q)) { } print_r(json_encode($rs)); This outputs: [{"id":"3","uid":"39","gid":"16"},{"id":"4","uid":"39","gid":"4"},{"id":"5","uid":"39","gid":"5"},{"id":"6","uid":"39","gid":"6"},{"id":"7","uid":"39","gid":"7"},{"id":"8","uid":"39","gid":"8"},{"id":"9","uid":"39","gid":"9"},false] I don't understand the "false" at the end for one .. But then I send to to JQuery and use: $.each(json.result, function(i, object) { $.each(object, function(property, value) { alert(property + "=" + value); }); }); This just fails. I try to alert "result" by itself which is set by: $.post("get_ug.php",{id:txt},function(result){ }); My output alerts are as follows: 1) The key is '0' and the value is '[' 2) The key is '1' and the value is 'f' 3) The key is '2' and the value is 'a' 4) The key is '3' and the value is 'l' 5) The key is '4' and the value is 's' 6) The key is '5' and the value is 'e' 7) The key is '6' and the value is ']' 8) The key is '7' and the value is ' ' (<-- Yes the line break is there in the alert) I am exhausted from trying different ideas and scripts. Other than setting a delimiter myself and concatenating my own array and decoding it with a custom script, does anyone have any ideas?? Thank you!!

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • Pass object from JSON into MVC Controller - its always null ?

    - by SteveCl
    Hi I have seen a few questions on here related to the a similar issue, I have read them, followed them, but still i have the same problem. I am basically creating an object in javascript and trying to call a method on the controller that will return a string of html. Not JSON. I've been playing around with dataType and contentType but still no joy. So apologies if the code snippets are a bit messy. Build the object in JS. function GetCardModel() { var card = {}; card.CardTitle = $("#CardTitle").val(); card.TopicTitle = $("#TopicTitle").val(); card.TopicBody = $("#TopicBody").data("tEditor").value(); card.CardClose = $("#CardClose").val(); card.CardFromName = $("#CardFromName").val(); return card; } Take a look at the object - all looks good and as it should in JSON. var model = GetCardModel(); alert(JSON.stringify(GetCardModel())); Make the call... $.ajax({ type: "POST", url: "/Postcard/Create/Preview/", dataType: "json", //contentType: "application/json", date: GetCardModel(), processData: true, success: function (data) { alert("im back"); alert(data); }, error: function (xhr, ajaxOptions, error) { alert(xhr.status); alert("Error: " + xhr.responseText); //alert(error); } }); Always when I step into the controller, the object is ALWAYS there, but with null values for all the properties.

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

  • Two Objects created with the same Address in Flex

    - by James
    Hi, I have an issue in flex which is causing a bit of a headache! I am adding objects to an ArrayCollection but in doing so, another ArrayCollection is also picking up these changes even though there is no binding occurring. I can see from the debug that the two ACs have the same address but for the life of me can't figure out why. I have two Array Collections: model.index.rows //The main array collection model.index.holdRows //The array collection that imitates the above This phantom data binding occurs only for the first iteration in the loop and for all others it will just write it the once. The reason this is proving troublesome is that it creates duplicate entries in my datagrid. public override function handleMessage(message:IMessage):void { super.handleMessage(message); if (message is IndexResponse) { var response:IndexResponse = message as IndexResponse; model.index.rows.removeAll(); model.index.indexIsEmpty = response.nullIndex; if (model.index.indexIsEmpty !== true) { //Update the index model from the response. Note: each property of the row object will be shown in the UI as a column in the grid response.index.forEach(function(entry:EntryData, i:int, a:Array):void { var row:Object = { fileID: entry.fileID, dadName: entry.dadName }; entry.tags.forEach(function(tag:Tag, i:int, a:Array):void { row[tag.name] = tag.value; }); model.index.rows.addItem(row); }); if(model.index.indexForNetworkView == true){ model.index.holdRows.source = model.index.holdRows.source.concat(model.index.rows.source); model.index.indexCounter++; model.index.indexForNetworkView = false; controller.indexController.showNetwork(model.index.indexCounter); } model.index.rows.refresh(); controller.networkController.show(); } } Has anyone else who has encountered something simillar propose a solution?

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

  • Determining selected state of jQuery Buttons

    - by lloydphillips
    I've got two radio buttons in a .net page which are being transformed to jQuery buttons a la http://jqueryui.com/demos/button/#radio When the page is loaded I have button 2 as checked. When clicking the buttons I'm firing the postback event. Problem is you can click on that button that is selected by default on the initial load i.e. Button 2, the postback is fired but the event handler isn't called in the .net code behind because the radio button is already classed as selected (and in normal circumstances wouldn't allow the postback to fire). To get around this I've added the e.PreventDefault() method BUT this is causing issues when Button 1 is clicked because before the click handler is called the button is set to selected. Therefore, in every case in the following code e.PreventDefault() is called: $(document).ready(function(){ $("[id*='rbPayable']").click(function(e){ if ($("[id*='rbPayable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) $("[id*='rbReceivable']").click(function(e){ if ($("[id*='rbReceivable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) }); What is the best way for me to load the page and effectively be able to do the following: 'If rbReceivable is checked then don't do anything otherwise do a postback.'

    Read the article

  • Visual Studio 2008 linker wants all symbols to be resolved, not only used ones

    - by user343011
    We recently upgraded to Visual Studio 2008 from 2005, and I think those error started after that. In our solution, we have a multitude of projects. Many of those are utility projects, or projects containing core functionality used by other projects. The output of those is lib files that are linked to when building the projects generating the final binaries using the "Project dependencies..." option. One of the other projects---Let us call it ResultLib---generates a DLL, and it needs one single function from the core project. This function uses only static function from its own source file, but the project in its entirety uses a lot of low-level Windows functions and also imports a DLL---Let us call it Driver.dll. Our problem is that when building ExtLib, the linker complains about a multitude of unresolved externals, for example all functions exported from Driver.dll, since its lib file is not specified when linking. If we try to fix this by adding all lib files used by other projects that use all of the core project, our resulting ResultLib DLL ends up importing Driver.dll and also exporting all functions defined in it. How do we tell Visual Studio to only try to resolve symbols that are actually used?

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • Slow Response in checkbox using JQuery

    - by Dean
    Hi to all. I'm trying to optimize a website. The flow is i tried to query a certain table and all of its data entry in a page(w/ toolbars), work fine. When i tried to edit the page the problem is when i click the checkbox button i have to wait 2-5sec just by clicking it. I limit the viewing of entry to 5 only but the response on checkbox doesn't change. The tables have 100 entries in them. function checkAccess(celDiv,id) { var celValue = $(celDiv).html(); if (celValue==1) $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' checked disabled>") else $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' disabled>") $(celDiv).click ( function() { $('input',this).each( function(){ tr_idx = $('#detFlex1 tbody tr').index($(this).parent().parent().parent()); td_idx = $('#detFlex1 tbody tr:eq('+tr_idx+') td').index($(this).parent().parent()); td_last = 13; for(var td=td_idx+1; td<=td_last;td++) { if ($(this).attr('checked') == true) { df[0].rows[tr_idx].cell[td_idx] = 1;//index[1] = Full Access if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 1; } df[0].rows[tr_idx].cell[2] = 1; if (td_idx > 3) { df[0].rows[tr_idx].cell[2] = 1; } } else { df[0].rows[tr_idx].cell[td_idx] = 0;//index[0] = With Access if (td_idx==2) { df[0].rows[tr_idx].cell[td] = 0; } else if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 0; } if (td_idx > 3) { df[0].rows[tr_idx].cell[3] = 0; } } } $('#detFlex1').flexAddData(df[0]); $('.toolbar a[title=Edit Item]').trigger('click'); }); } ); } I've thought that the problem is this above code. Could anyone help me simplify this code.?

    Read the article

< Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >