Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 620/2320 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

  • program received signal SIGABRT (xcode)

    - by manish1990
    #import <UIKit/UIKit.h> @interface tableview : UIViewController<UITableViewDataSource> { NSArray *listOfItems; } @property(nonatomic,retain) NSArray *listOfItems; @end #import "tableview.h" @implementation tableview @synthesize listOfItems; - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier ]autorelease]; } //NSString *cellValue = [listOfItems objectAtIndex:indexPath.row]; cell.textLabel.text = [listOfItems objectAtIndex:indexPath.row]; return cell; } - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { return 3; } - (id)initWithNibName:(NSString *)nibNameOrNil bundle:(NSBundle *)nibBundleOrNil { self = [super initWithNibName:nibNameOrNil bundle:nibBundleOrNil]; if (self) { // Custom initialization } return self; } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc that aren't in use. } #pragma mark - View lifecycle - (void)viewDidLoad { listOfItems = [[NSArray alloc] initWithObjects:@"first",@"second",@"third", nil]; //listOfItems = [[NSMutableArray alloc]init]; // [listOfItems addObject:@"first"]; //[listOfItems addObject:@"second"]; [super viewDidLoad]; // Do any additional setup after loading the view from its nib. } -(void)dealloc { [listOfItems release]; [super dealloc]; } @end GNU gdb 6.3.50-20050815 (Apple version gdb-1708) (Mon Aug 15 16:03:10 UTC 2011) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "x86_64-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 438. 2012-04-27 13:33:23.276 tableview test[438:207] -[UIView tableView:numberOfRowsInSection:]: unrecognized selector sent to instance 0x6855500 2012-04-27 13:33:23.362 tableview test[438:207] * Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '-[UIView tableView:numberOfRowsInSection:]: unrecognized selector sent to instance 0x6855500' * First throw call stack: (0x13bb052 0x154cd0a 0x13bcced 0x1321f00 0x1321ce2 0x1ecf2b 0x1ef722 0x9f7c7 0x9f2c1 0xa228c 0xa6783 0x51322 0x13bce72 0x1d6592d 0x1d6f827 0x1cf5fa7 0x1cf7ea6 0x1d8330c 0x23530 0x138f9ce 0x1326670 0x12f24f6 0x12f1db4 0x12f1ccb 0x12a4879 0x12a493e 0x12a9b 0x2282 0x21f5) terminate called throwing an exceptionCurrent language: auto; currently objective-c (gdb)

    Read the article

  • Can I do this in only one query ?

    - by Paté
    Merry christmas everyone, I Know my way around SQL but I'm having a hard time figuring this one out. First here are my tables (examples) User id name friend from //userid to //userid If user 1 is friend with user 10 then you a row with 1,10. User 1 cannot be friend with user 10 if user 10 is not friend with user 1 so you have 1,10 10,1 It may look weird but I need those two rows per relations. Now I'm trying to make a query to select the users that have the most mutual friend with a given user. For example User 1 is friend with user 10,9 and 7 and user 8 is friend with 10,9 and 7 too ,I want to suggest user 1 to invite him (like facebook). I want to get like the 10 first people with the most mutual friend. The output would be like User,NumOfMutualFriends I dont know if that can be done in a single query ? Thanks in advance for any help.

    Read the article

  • Should I be using libraries if I'm trying to learn how to program?

    - by CodeJustin.com
    I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

    Read the article

  • C# Same DataSource + Multiple DataGridViews = Data Binding Issues?

    - by C. Griffin
    Here's what I'm doing: I have (2) DataGridView controls DGV #1 is bound to the DataSet, DGV #2 is bound to a DataView of the SAME DataSet Now, what I'm needing to accomplish here is this: When a user checks a boolean column on the original DGV, the second DGV should now display the newly checked row also. The context is that the first DGV is a master list, and the second one is a "favorite" view of the first. When I check the rows, the favorite column does NOT update. Do I need to use a DataAdapter to actually update the database, or can I operate directly on the DataSet (DataTable) -- or even with the Rows in the original DataGridView?

    Read the article

  • A stupid question about wordpress and php

    - by bubdada
    It may seem stupid question, but i've a serious problem... if you could check out orcik.net the thumbnail images does not appear. I figured out the reason but I don't know how to solve.. http://orcik.net/projects/thumb/orcikthumb.php?src=http://orcik.net/wp-content/uploads/2010/05/mac-safari-search-cache.png If you go to the above link you will get page not found error. However, if you go to the link below you'll get the thumbnail version of the image... http://orcik.net/projects/thumb/orcikthumb.php?src=/wp-content/uploads/2010/05/mac-safari-search-cache.png I'm using this piece of code on wordpress and the line appears like <a href="<?php the_permalink() ?>" rel="bookmark"> <img src="<?php bloginfo('template_directory'); ?>/includes/orcikthumb.php?src=<?php get_thumbnail($post->ID, 'full'); ?>&amp;h=<?php echo get_theme_mod($height); ?>&amp;w=<?php echo get_theme_mod($width); ?>&amp;zc=1" alt="<?php the_title(); ?>" /> </a> Thus, I believe I can't change the directory of image. But I could not figure out why I am getting page not found error. Is that might be CHMOD'es??? or something else?? Thanks

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • Find the period of over speed ?

    - by Vimvq1987
    Just something interesting come in my mind. Assume that we have a table (in SQL Server) like this: Location Velocity Time What is the best way to determine over speed periods (speed barrier is defined) ? My first idea was loading the table into an array, and then iterate over array to find these periods: (Pseudo C# code) bool isOverSpeed = false; for (int i =0;i<arr.Length;i++) { if (!isOverSpeed) if (arr[i].Velocity > speedBarrier) { #insert the first record into another array. isOverSpeed = true; } if(isOverSpeed) if (arr[i].Velocity < speedBarrier) { #insert the record into that array isOverSpeed = false; } } It works, but somewhat "not very effectively". Is there a "smarter" way, such as a T-SQL query or another algorithm to do this?

    Read the article

  • Background loading javascript into iframe without using jQuery/Ajax?

    - by user210099
    I'm working on an offline only help system which requires loading a large amount of search-related data into an iframe before the search functionality can be used. Due to the folder structure of the project, I am unable to use Ajax-related background load methods, since the files I need are loaded a few directories "up and over." I have written some code which delays the loading of the help data until the rest of the webpage is loaded. The help data consists of a bunch of javascript files which have information about the terms, ect that exist in the help books which are installed on the system. The webpage works fine, until I start to load this help data into a hidden iframe. While the javascript files are loading, I can not use any of the webpage. Links that require a small files be downloaded for hover over effects don't show up, javascript (switching tabs on the page) has no effect. I'm wondering if this is just a limitation of the way javascript works, or if there's something else going on here. Once all the files are loaded for the help system, the webpage works as expected. function test(){ var MGCFrame = eval("parent.parent"); if((ALLFRAMESLOADED == true)){ t2 = MGCFrame.setTimeout("this.IHHeader.frames[0].loadData()",1); } else{ t1 = MGCFrame.setTimeout("this.IHHeader.frames[0].test()",1000); } } Load data simply starts the data loading process. Thanks for any help you can provide.

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Passing data from one viewcontroller to another

    - by user1392515
    I subclassed two view controllers. The first one is supposed to pass data, a NSUrl object to the second one. .m of the first one: NSURL *temp = [NSURL URLWithString:@"http://example.com"]; UIViewController *presentationsFullScreen_ViewController = [self.storyboard instantiateViewControllerWithIdentifier:@"PresentationsFullScreen_ViewController"]; presentationsFullScreen_ViewController.urlToUse = temp; .h of the second one: #import <UIKit/UIKit.h> @interface PresentationsFullScreen_ViewController : UIViewController { NSURL *urlToUse; } @property (nonatomic,retain) NSURL *urlToUse; It is obviously not working and not compiling,telling me essentially that I didn't subclass it and that the property urlToUse is not found on UIViewController. How do I subclass correctly? Thanks!

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • How does linq decide between inner & outer joins

    - by user287795
    Hi Usually linq is using an left outer join for its queries but on some cases it decides to use inner join instead. I have a situation where that decision results in wrong results since the second table doesn't always have suitable records and that removes the records from the first table. I'm using a linqdatasource over a dbml where the relevant tables are identical but one holds historical records removed from the first. both have the same primary key. and I'm using a dataloadoption to load both tables at once with out round trips. Would you explain why linq decided to use an inner join here? Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • How to hang up (disconnect, terminate,..) incomings call???

    - by Cesar Valiente
    "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

    Read the article

  • it's not possible to loop .click function (To create multipple buttons)

    - by user1542680
    Im Trying to create multiple buttons that each one of them doing something else. It working great outside of the "each" loop, But in the moment I'm inserting the .click function in the .each function it doesn't work... Here is the Code: $.each(data.arr, function(i, s){ html += '<div id="mybtn'+s.id+'"><button class="first">Btn1</button><button class="second">Btn2</button></div>'; var btnclass="#mybtn"+s.id+" .first"; $(btnclass).click(function(){ //do something }); }); Please Let me know what is wrong... Thank you very much!!! Eran.

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • SSIS - user variable used in derived column transform is not available - in some cases

    - by soo
    Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

    Read the article

  • Is there a Twitter Bootstrap class that means "initially hidden"?

    - by bgp
    Using Bootstrap 3, I have an element on a page I want to show later in response to the user clicking a button. Example: <div id="search_results"> ... gets populated from ajax data later ... </div> <button id="search_button" type="button" class="btn btn-primary pull-right">Search</button> <script> $('#search_button').click(function() { // ... do the call to search // and in the callback: $('#search_results').show(); }); </script> The search_results div should be initially hidden. Is there some normal/best practice way of doing this with bootstrap? Yes, I do realize I can just put style="display:none" on search_results, but is that the best way to do it? It would seem to be a bit better to have a style that semantically means "initially hidden". (NOTE: The hidden or hide classes don't do this as they are !important and show(), toggle(), etc. use an inline style which does not override them, i.e. setting "hidden" as the class makes it unshowable from jQuery.)

    Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >