Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 621/2320 | < Previous Page | 617 618 619 620 621 622 623 624 625 626 627 628  | Next Page >

• Can I set JFrame's normal size while it is maximized?

  - by icza

  I'd like to set the normal size of a visible JFrame while it is in Frame.MAXIMIZED_BOTH state (by normal size i mean the size of frame when it is in Frame.NORMAL state) . The reason I want to do this is so that when the user un-maximizes the frame, it will have the proper size I want it to be. But if I do so, the window will switch to normal state. If I set the size first, then switch to MAXIMIZED_BOTH state, then I will see a disturbing blink or resize (which I don't want to). I've also tried setting the size first, then changing state to MAXIMIZED_BOTH, and then making it visible, but the state change is deferred if the window is not visible (and will only be executed once it is made visible, also resulting in a visual resize). So what can I do if I want my frame to have a predefined normal size, but I want it to appear maximized?

  Read the article

• Why doesn't list.get(0).equals(null) work?

  - by Jessy

  The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

  Read the article

• Is using a DataSet's column Expression works in background same as manual calculation?

  - by Harikrishna

  I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

  Read the article

• input type="file" auto click

  - by cf_PhillipSenn

  How do I automatically open the browse dialog of an input type="file" when the page first opens?

  Read the article

• Delegate Example From C# In Depth Confusion

  - by ChloeRadshaw

  I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

  Read the article

• C# Same DataSource + Multiple DataGridViews = Data Binding Issues?

  - by C. Griffin

  Here's what I'm doing: I have (2) DataGridView controls DGV #1 is bound to the DataSet, DGV #2 is bound to a DataView of the SAME DataSet Now, what I'm needing to accomplish here is this: When a user checks a boolean column on the original DGV, the second DGV should now display the newly checked row also. The context is that the first DGV is a master list, and the second one is a "favorite" view of the first. When I check the rows, the favorite column does NOT update. Do I need to use a DataAdapter to actually update the database, or can I operate directly on the DataSet (DataTable) -- or even with the Rows in the original DataGridView?

  Read the article

• How to hang up (disconnect, terminate,..) incomings call???

  - by Cesar Valiente

  "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

  Read the article

• How to get sub array in PHP?

  - by wamp

  I want to get an array composed of the first 4 rows of the original array $arr, how to do it in PHP?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How do i resolve method Overlapping in java/Processing [duplicate]

  - by user3718913

  This question already has an answer here: How do I compare strings in Java? 24 answers I have two methods/function in a class, called, Qestion1 and Question2, i want it in such a way that after the user has answered Question one correctly, the Question 2 method is called. Whenever i call the method 2, it displays both of them together instead exiting the first method first. Here's a dummy code to illustrate what i'm saying: void Question1() { String question="What is the capital of England?"; String Answer="London"; if(Answer=='London') { Question2(); } } void Question2() { String question="What is the capital of California?"; String Answer="Sacramento"; if(Answer=='Sacramento') { Question3(); } } Pls, this question is in no way related to that other question. Pls peruse the thread again.

  Read the article

• SSIS - user variable used in derived column transform is not available - in some cases

  - by soo

  Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

  Read the article

• Is there a Twitter Bootstrap class that means "initially hidden"?

  - by bgp

  Using Bootstrap 3, I have an element on a page I want to show later in response to the user clicking a button. Example: <div id="search_results"> ... gets populated from ajax data later ... </div> <button id="search_button" type="button" class="btn btn-primary pull-right">Search</button> <script> $('#search_button').click(function() { // ... do the call to search // and in the callback: $('#search_results').show(); }); </script> The search_results div should be initially hidden. Is there some normal/best practice way of doing this with bootstrap? Yes, I do realize I can just put style="display:none" on search_results, but is that the best way to do it? It would seem to be a bit better to have a style that semantically means "initially hidden". (NOTE: The hidden or hide classes don't do this as they are !important and show(), toggle(), etc. use an inline style which does not override them, i.e. setting "hidden" as the class makes it unshowable from jQuery.)

  Read the article

• Image error with wordpress and php

  - by bubdada

  It may seem stupid question, but i've a serious problem... if you could check out orcik.net the thumbnail images does not appear. I figured out the reason but I don't know how to solve.. http://orcik.net/projects/thumb/orcikthumb.php?src=http://orcik.net/wp-content/uploads/2010/05/mac-safari-search-cache.png If you go to the above link you will get page not found error. However, if you go to the link below you'll get the thumbnail version of the image... http://orcik.net/projects/thumb/orcikthumb.php?src=/wp-content/uploads/2010/05/mac-safari-search-cache.png I'm using this piece of code on wordpress and the line appears like <a href="<?php the_permalink() ?>" rel="bookmark"> <img src="<?php bloginfo('template_directory'); ?>/includes/orcikthumb.php?src=<?php get_thumbnail($post->ID, 'full'); ?>&amp;h=<?php echo get_theme_mod($height); ?>&amp;w=<?php echo get_theme_mod($width); ?>&amp;zc=1" alt="<?php the_title(); ?>" /> </a> Thus, I believe I can't change the directory of image. But I could not figure out why I am getting page not found error. Is that might be CHMOD'es??? or something else?? Thanks

  Read the article

• null pointer exception in textview of setcontent

  - by kitokid

  I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

  Read the article

• Using the same cookie in two logins

  - by cer9ss

  Hi everyone, I need your help I've a MVC project that uses Jquery, where I've implemented a mechanism of "Remember Me" using cookies to save, clear and retrieve the login and password. I also have two screens where the user does the login. I want that both logins manipulate the same cookie. I've got to implement it, but I've realized that each one has a different behaviour. I mean, the cookie's value I save in the first login is not the same than the value that retrieves the second login (when I open it). In other words, if I mark "remind me" on the first login, it isn't reflected on the second login and viceversa. What can I do to make that both of them manipulate and read the same values from the same cookie? Is it possible? PS: For this situations I'm using the same web navigator: Firefox or IE. Thanks in advance

  Read the article

• Strange Locking Behaviour in SQL Server 2005

  - by SQL Learner

  Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

  Read the article

• compare two characters based on subset

  - by schultem

  I have a simple dataframe with two columns: df <- data.frame(x = c(1,1,2,2,3), y = c(rep(1:2,2),1), target = c('a','a','a','b','a')) I would like to compare the strings in the target column (find out whether they are equal or not, i.e., TRUE or FALSE) within every level of x (same number for x). First I would like to compare lines 1 and 2, then 3 and 4 ... My problem is that I am missing some comparisons, for example, line 5 has only one case instead of two - so it should turn out to be FALSE. Variable y indicates the first and second case within x. I played around with ddply doing something like: ddply(df, .(x), summarise, ifelse(as.character(df[df$y == '1',]$target), as.character(df[df$y == '2',]$target),0,1)) which is ugly ... and does not work ... Any insights how I could achieve this comparison? Thanks

  Read the article

• Given a 2d array sorted in increasing order from left to right and top to bottom, what is the best w

  - by Phukab

  I was recently given this interview question and I'm curious what a good solution to it would be. Say I'm given a 2d array where all the numbers in the array are in increasing order from left to right and top to bottom. What is the best way to search and determine if a target number is in the array? Now, my first inclination is to utilize a binary search since my data is sorted. I can determine if a number is in a single row in O(log N) time. However, it is the 2 directions that throw me off. Another solution I could use, if I could be sure the matrix is n x n, is to start at the middle. If the middle value is less than my target, then I can be sure it is in the left square portion of the matrix from the middle. I then move diagnally and check again, reducing the size of the square that the target could potentially be in until I have honed in on the target number. Does anyone have any good ideas on solving this problem? Example array: Sorted left to right, top to bottom. 1 2 4 5 6 2 3 5 7 8 4 6 8 9 10 5 8 9 10 11

  Read the article

• Mootools accordion inside another...

  - by jimbo

  Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

  Read the article

• Can I have different name and id attributes on a form element?

  - by ewitkows

  Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

  Read the article

• Shall I optimize or let compiler to do that?

  - by Knowing me knowing you

  What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

  Read the article

• JDBC Pagination

  - by Zeeshan

  Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

  Read the article

• What scripts should not be ported from bash to python?

  - by Jack

  I decided to rewrite all our Bash scripts in Python (there are not so many of them) as my first Python project. The reason for it is that although being quite fluent in Bash I feel it's somewhat archaic language and since our system is in the first stages of its developments I think switching to Python now will be the right thing to do. Are there scripts that should always be written in Bash? For example, we have an init.d daemon script - is it OK to use Python for it? We run CentOS. Thanks.

  Read the article

• Portrait vs Landscape Launch Images

  - by andrewx

  An iPad app can support inclusion of launch images in both orientations; presumably, if your app supports auto-rotation, then this would suggest to me that if the user launches an app while the device is in Landscape mode, then the Landscape launch image is used. But in all the apps I've built and released, this has never been the case. Never once has the Landscape launch image appeared, only the Portrait. After loading, the app will auto-rotate to whatever orientation the device is in, but at launch, it assumes you are in Portrait. Always. Why? I have seen many other apps in the store that behave this way, but then there are some seem to always automatically know immediately at first launch, from that first launch image, that you are in Landscape, if that's the case. How is this done?

  Read the article

• which one is a faster/better sql practice?

  - by artsince

  Suppose I have a 2 column table (id, flag) and id is sequential. I expect this table to contain a lot of records. I want to periodically select the first row not flagged and update it. Some of the records on the way may have already been flagged, so I want to skip them. Does it make more sense if I store the last id I flagged and use it in my select statement, like select * from mytable where id > my_last_id order by id asc limit 1 or simply get the first unflagged row, like: select * from mytable where flagged = 'F' order by id asc limit 1 Thank you!

  Read the article

< Previous Page | 617 618 619 620 621 622 623 624 625 626 627 628  | Next Page >