Search Results

Search found 39406 results on 1577 pages for 'two legged'.

Page 625/1577 | < Previous Page | 621 622 623 624 625 626 627 628 629 630 631 632  | Next Page >

  • ARM assembly puzzle

    - by ivant
    First of all, I'm not sure if solution even exists. I spent more than a couple of hours trying to come up with one, so beware. The problem: r1 contains an arbitrary integer, flags are not set according to its value. Set r0 to 1 if r1 is 0x80000000, to 0 otherwise, using only two instructions. It's easy to do that in 3 instructions (there are many ways), however doing it in 2 seems very hard, and may very well be impossible.

    Read the article

  • INNER JOIN Returns Too Many Results

    - by Alon
    I have the following SQL: SELECT * FROM [Database].dbo.[TagsPerItem] INNER JOIN [Database].dbo.[Tag] ON [Tag].Id = [TagsPerItem].TagId WHERE [Tag].Name IN ('home', 'car') and it returns: Id TagId ItemId ItemTable Id Name SiteId 1 1 1 Content 1 home 1 2 1 2 Content 1 home 1 3 1 3 Content 1 home 1 4 2 4 Content 2 car 1 5 2 5 Content 2 car 1 6 2 12 Content 2 car 1 instead of just two records, which these names are "home" and "car". How can I fix it? Thanks.

    Read the article

  • How to write a spinlock without using CAS

    - by Martin
    Following on from a discussion which got going in the comments of this question. How would one go about writing a Spinlock without CAS operations? As the other question states: The memory ordering model is such that writes will be atomic (if two concurrent threads write a memory location at the same time, the result will be one or the other). The platform will not support atomic compare-and-set operations.

    Read the article

  • Generate RTT values

    - by Jean Gauthier
    Hi all, I'm writing a Java applet where I should be able to simulate a connection between two hosts. Hence I have to generate packet round-trip times at random. These RTTs can go from ~0 to infinity, but are typically oscillating around some average value (i.e. an extremely large or small value is very improbable but possible). I was wondering if anyone had an idea of how I could do this? Thanks in advance

    Read the article

  • problem Keyword token antlr

    - by batman_for
    If the 'for' is used both as a command and as "the English word": for_statement: 'for' ... id: 'for' | ID ; ID: ... right? My problem is how to differentiate the two cases. For example for_statement is only possible beginning of a line (only if preceded by ' ' or '\t'). Thanks.

    Read the article

  • Operator== in derived class never gets called.

    - by Robin Welch
    Can someone please put me out of my misery with this? I'm trying to figure out why a derived operator== never gets called in a loop. To simplify the example, here's my Base and Derived class: class Base { // ... snipped bool operator==( const Base& other ) const { return name_ == other.name_; } }; class Derived : public Base { // ... snipped bool operator==( const Derived& other ) const { return ( static_cast<const Base&>( *this ) == static_cast<const Base&>( other ) ? age_ == other.age_ : false ); }; Now when I instantiate and compare like this ... Derived p1("Sarah", 42); Derived p2("Sarah", 42); bool z = ( p1 == p2 ); ... all is fine. Here the operator== from Derived gets called, but when I loop over a list, comparing items in a list of pointers to Base objects ... list<Base*> coll; coll.push_back( new Base("fred") ); coll.push_back( new Derived("sarah", 42) ); // ... snipped // Get two items from the list. Base& obj1 = **itr; Base& obj2 = **itr2; cout << obj1.asString() << " " << ( ( obj1 == obj2 ) ? "==" : "!=" ) << " " << obj2.asString() << endl; Here asString() (which is virtual and not shown here for brevity) works fine, but obj1 == obj2 always calls the Base operator== even if the two objects are Derived. I know I'm going to kick myself when I find out what's wrong, but if someone could let me down gently it would be much appreciated.

    Read the article

  • Hibenate Unknown Entity

    - by Raj
    I have two jar files with hibernate classes mapped. One jar file is perfectly working and for the next jar file it is not mapped. I get Unknown Entity exception. Persistence.xml is good but i dont know why this is happening. Any guess what mite be the issue???

    Read the article

  • Logical equality in C

    - by andrew cooke
    [It seems odd this doesn't exist, so apologies in advance if it's a duplicate] I want to test for logical equality in C. In other words, I want to know whether two values would be equal if both were converted in the normal way associated with logical expressions. In C99, I think that (bool)a == (bool)b gives what I want. Is that correct? What is the normal way of writing this in traditional C?

    Read the article

  • Get records using left outer join

    - by Devendra Gohil
    I have two tables as given below Table A Table B Table C ============= ============== ========= Id Name Id AId CId Id Name 1 A 1 1 1 1 x 2 B 2 1 1 2 y 3 C 3 2 1 3 z 4 D 4 2 3 4 w 5 E 5 3 2 5 v Now I want all the records of Table A with matching Id column CId from Table B where CId = 1. So the output should be like below : Id Name CId 1 A 1 2 B 1 3 C 1 4 D Null 5 E Null Can anyone help me please?

    Read the article

  • MySQL SELECT Statment issue

    - by mouthpiec
    Hi, I have the following query which returns 2 tuples SELECT bar_id, bar_name, town_name, bar_telephone, subscription_type_id, type FROM towns, subscriptiontype, regions, bar LEFT JOIN barpictures bp ON bar.bar_id = bp.bar_id_fk WHERE town_id = town_id_fk AND bar.test_field = 0 AND subscription_type_id = subscription_type_id_fk AND region_id = region_id_fk AND (type like 'logo%' OR type IS NULL) The main difference between the tuples is that one has 'type' = logo and the other tuple has 'type' = logo_large. I need that instead of having two tuples, I need that I have 2 type attributes, one holding the "logo" and the other the "logo_large" eg bar_id, bar_name, town_name, bar_telephone, subscription_type_id, type1, type2 is this possible

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What are the limitations of assembler? (NASM)

    - by citronas
    Is there a technical limitation of what kind of programs I can write with assembler (NASM)? For now I've only seem some program that do arithmetic operations, like adding two numbers. Is it possible to write complex assembler programs, that provide a GUI, access the file system, plays sounds et cetera? I know I wouldn't write such programs, but I'm curious, if there are technical limitations on what kind of programs I can write with assembler.

    Read the article

  • mySQL - One large query vs Ajax indivdual queries

    - by Mark
    Hi guys, I guess no one will have a definative answer to this but considered predictions would be appriciated. I am in the process of developing a mySQL database for a web application and my question is: Is it more efficient to make a single query that returns a single row using AJAX or To request 100 - 700 rows when the user will likely only ever use the results of two or three? Really I am asking what is heavier for the server 2-3 requests with one result or 1 request with 100 - 700 results? Thanks, Mark

    Read the article

  • Logic for FOR loop in c#

    - by karthik
    My method has a parameter, I have to use that in my For loop to iterate. For example, I have a text file with 4 lines. If the Param is 1, the for loop must iterate through the last three lines If the Param is 2, the for loop must iterate through the last two lines If the Param is 3, the for loop must iterate through the last one line How can i pass this param in my For loop to achieve all the three scenarios stated above ?

    Read the article

  • Need some code modification in jquery slider plugin

    - by Mirage
    I am using JCarousel plugin for sliders. It is working fine. But i wan this effect in another plugin called moving boxes I have 3 List items in Jcarousel. i want that the middle should expand like in moving boxes. There are two functions in moving boxes JS file called slider.js returnToNormal("#panel_"+curPanel); growBigger("#panel_"+next); But i don't know how i can insert those in Jcarousel

    Read the article

  • Smoke testing a .NET web application

    - by pdr
    I cannot believe I'm the first person to go through this thought process, so I'm wondering if anyone can help me out with it. Current situation: developers write a web site, operations deploy it. Once deployed, a developer Smoke Tests it, to make sure the deployment went smoothly. To me this feels wrong, it essentially means it takes two people to deploy an application; in our case those two people are on opposite sides of the planet and timezones come into play, causing havoc. But the fact remains that developers know what the minimum set of tests is and that may change over time (particularly for the web service portion of our app). Operations, with all due respect to them (and they would say this themselves), are button-pushers who need a set of instructions to follow. The manual solution is that we document the test cases and operations follow that document each time they deploy. That sounds painful, plus they may be deploying different versions to different environments (specifically UAT and Production) and may need a different set of instructions for each. On top of this, one of our near-future plans is to have an automated daily deploy environment, so then we'll have to instruct a computer as to how to deploy a given version of our app. I would dearly like to add to that instructions for how to smoke test the app. Now developers are better at documenting instructions for computers than they are for people, so the obvious solution seems to be to use a combination of nUnit (I know these aren't unit tests per se, but it is a built-for-purpose test runner) and either the Watin or Selenium APIs to run through the obvious browser steps and call to the web service and explain to the Operations guys how to run those unit tests. I can do that; I have mostly done it already. But wouldn't it be nice if I could make that process simpler still? At this point, the Operations guys and the computer are going to have to know which set of tests relate to which version of the app and tell the nUnit runner which base URL it should point to (say, www.example.com = v3.2 or test.example.com = v3.3). Wouldn't it be nicer if the test runner itself had a way of giving it a base URL and letting it download say a zip file, unpack it and edit a configuration file automatically before running any test fixtures it found in there? Is there an open source app that would do that? Is there a need for one? Is there a solution using something other than nUnit, maybe Fitnesse? For the record, I'm looking at .NET-based tools first because most of the developers are primarily .NET developers, but we're not married to it. If such a tool exists using other languages to write the tests, we'll happily adapt, as long as there is a test runner that works on Windows.

    Read the article

  • How to refactor T-SQL stored procedure encapsulating it's parameters to a class

    - by abatishchev
    On my SQL Server 2008 I have a stored procedure with a large number of parameters. The first part of them is used in every call and parameters from the second part are used rarely. And I can't move the logic to two different stored procedures. Is there a way to encapsulate all this parameters to a class or struct and pass it as a stored procedure parameter? Can I use SQL CLR. Are there other ways?

    Read the article

  • Silverlight and Azure Tables

    - by Phil Wright
    Of the following two options... 1, Silverlight app talks directly to Azure Tables 2, Silverlight app talks to Web Role using WCF and that Web Role accesses Azure Tables Which are possible? Which is the recommend approach?

    Read the article

  • Consolidating Columns in Excel

    - by New to iPhone
    I have two columns in excel like the following a,apple a,bannana a,orange a,plum b,apple b,berry b,orange b,grapefruit c,melon c,berry c,kiwi I need to consolidate them like this on a different sheet a,apple,bannana,orange,plum b,apple,berry,orange,grapefruit c,melon,berry,kiwi Any help would be appreciated

    Read the article

  • How can I refactor this JavaScript code to avoid making functions in a loop?

    - by Bungle
    I wrote the following code for a project that I'm working on: var clicky_tracking = [ ['related-searches', 'Related Searches'], ['related-stories', 'Related Stories'], ['more-videos', 'More Videos'], ['web-headlines', 'Publication'] ]; for (var x = 0, length_x = clicky_tracking.length; x < length_x; x++) { links = document.getElementById(clicky_tracking[x][0]) .getElementsByTagName('a'); for (var y = 0, length_y = links.length; y < length_y; y++) { links[y].onclick = (function(name, url) { return function() { clicky.log(url, name, 'outbound'); }; }(clicky_tracking[x][1], links[y].href)); } } What I'm trying to do is: define a two-dimensional array, with each instance the inner arrays containing two elements: an id attribute value (e.g., "related-searches") and a corresponding description (e.g., "Related Searches"); for each of the inner arrays, find the element in the document with the corresponding id attribute, and then gather a collection of all <a> elements (hyperlinks) within it; loop through that collection and attach an onclick handler to each hyperlink, which should call clicky.log, passing in as parameters the description that corresponds to the id (e.g., "Related Searches" for the id "related-searches") and the value of the href attribute for the <a> element that was clicked. Hopefully that wasn't thoroughly confusing! The code may be more self-explanatory than that. I believe that what I've implemented here is a closure, but JSLint complains: http://img.skitch.com/20100526-k1trfr6tpj64iamm8r4jf5rbru.png So, my questions are: How can I refactor this code to make JSLint agreeable? Or, better yet, is there a best-practices way to do this that I'm missing, regardless of what JSLint thinks? Should I rely on event delegation instead? That is, attaching onclick event handlers to the document elements with the id attributes in my arrays, and then looking at event.target? I've done that once before and understand the theory, but I'm very hazy on the details, and would appreciate some guidance on what that would look like - assuming this is a viable approach. Thanks very much for any help!

    Read the article

  • Tile map collision detection

    - by hero
    There are many topics like this, but none with concrete answers. I am drawing a tile-map in the traditional way (two for loops) and keeping my player centered except when the edges of the map is reached. How would I create collision detection? I need to know how to translate tile location in the array to screen coordinates I think.

    Read the article

< Previous Page | 621 622 623 624 625 626 627 628 629 630 631 632  | Next Page >