Search Results

Search found 16914 results on 677 pages for 'single threaded'.

Page 629/677 | < Previous Page | 625 626 627 628 629 630 631 632 633 634 635 636  | Next Page >

• (mySQL) Unable to query 2 tables properly for data

  - by Devner

  I have 2 tables. One is 'page_links' and the other is 'rpp'. Table page_links is the superset of table rpp. The following is the schema of my tables: -- Table structure for table `page_links` -- CREATE TABLE IF NOT EXISTS `page_links` ( `page` varchar(255) NOT NULL, `page_link` varchar(100) NOT NULL, `heading_id` tinyint(3) unsigned NOT NULL, PRIMARY KEY (`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `page_links` -- INSERT INTO `page_links` (`page`, `page_link`, `heading_id`) VALUES ('a1.php', 'A1', 8), ('b1.php', 'B1', 8), ('c1.php', 'C1', 5), ('d1.php', 'D1', 5), ('e1.php', 'E1', 8), ('f1.php', 'F1', 8), ('g1.php', 'G1', 8), ('h1.php', 'H1', 1), ('i1.php', 'I1', 1), ('j1.php', 'J1', 8), ('k1.php', 'K1', 8), ('l1.php', 'L1', 8), ('m1.php', 'M1', 8), ('n1.php', 'N1', 8), ('o1.php', 'O1', 8), ('p1.php', 'P1', 4), ('q1.php', 'Q1', 5), ('r1.php', 'R1', 4); -- Table structure for table `rpp` -- CREATE TABLE IF NOT EXISTS `rpp` ( `role_id` tinyint(3) unsigned NOT NULL, `page` varchar(255) NOT NULL, `is_allowed` tinyint(1) NOT NULL, PRIMARY KEY (`role_id`,`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `rpp` -- INSERT INTO `rpp` (`role_id`, `page`, `is_allowed`) VALUES (3, 'a1.php', 1), (3, 'b1.php', 1), (3, 'c1.php', 1), (3, 'd1.php', 1), (3, 'e1.php', 1), (3, 'f1.php', 1), (3, 'h1.php', 1), (3, 'i1.php', 1), (3, 'l1.php', 1), (3, 'm1.php', 1), (3, 'n1.php', 1), (4, 'a1.php', 1), (4, 'b1.php', 1), (4, 'q1.php', 1), (5, 'r1.php', 1); WHAT I AM TRYING TO DO: I am trying to query both the above tables (in a single query) in such a way that all the pages from page_links are displayed along with the is_allowed value from rpp for a particular role. For example, I want to get the is_allowed value of all the pages from rpp for role_id = 3 and at the same time, list all the available pages from page_links. A clear example of my expected result would be: page is_allowed role_id ---------------------------------------- a1.php 1 3 b1.php 1 3 c1.php 1 3 d1.php 1 3 e1.php 1 3 f1.php 1 3 g1.php NULL NULL h1.php 1 3 i1.php 1 3 j1.php NULL NULL k1.php NULL NULL l1.php 1 3 m1.php 1 3 n1.php 1 3 o1.php NULL NULL p1.php NULL NULL q1.php NULL NULL r1.php NULL NULL One more example of my desired result could be achieved by doing a LEFT JOIN rpp ON page_links.page = rpp.page but we need to omit using role_id = 3 (or any value) to be able to get that. But I do want to specify the role_id as well and get the results. I need the query to be able to get this result. I would appreciate any replies that could help me with this. If you can suggest me any changes as well to the table(s) design to be able to achieve the desired result, that's good as well. Thanks in advance.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Is it possible to create a service like Feed My Inbox on my own server?

  - by Mark Bowen

  I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

  Read the article

• What database table structure should I use for versions, codebases, deployables?

  - by Zac Thompson

  I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

  Read the article

• CodeIgniter Third party class not loading

  - by Jatin Soni

  I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

  Read the article

• What to Expect in Rails 4

  - by mikhailov

  Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

  Read the article

• match "//" comments with regex but not inside a quote

  - by Wireless102

  I need to match and replace some comments. for example: $test = "the url is http://www.google.com";// comment "<-- that quote needs to be matched I want to match the comments outside of the quotes, and replace any "'s in the comments with &quot;'s. I have tried a number of patterns and different ways of running them but with no luck. The regex will be run with javascript to match php "//" comments UPDATE: I took the regex from borkweb below and modified it. used a function from http://ejohn.org/blog/search-and-dont-replace/ and came up with this: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript"> function t_replace(data){ var q = {}, ret = ""; data.replace(/(?:((["'\/]*(("[^"]*")|('[^']*'))?[\s]*)?[\/\/|#][^"|^']*))/g, function(value){ q[key] = value; }); for ( var key in q ){ ret = q[key]; } var text = data.split(ret); var out = ret + text[1]; out = out.replace(/"/g,"&quot;"); out = out.replace(/'/g,"&apos;"); return text[0] + out; } </script> </head> <body> <script type="text/javascript"> document.write(t_replace("$test = \"the url is http://www.google.com\";// c'o\"mment \"\"\"<-- that quote needs to be matched")+"<br>"); document.write(t_replace("$test = 'the url is http://www.google.com';# c'o\"mment \"\"\"<-- that quote needs to be matched")); </script> </body> </html> it handles all the line comments outside of single or double quotes. Is there anyway I could optimize this function?

  Read the article

• Thoughts on streamlining multiple .Net apps

  - by John Virgolino

  We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

  Read the article

• whats wrong with this php mysql_real_escape_string

  - by skyhigh

  Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

  Read the article

• Sessions not persisting between requests

  - by klonq

  My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

  Read the article

• mod_rewrite not working for a specific directory

  - by punkish

  This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

  Read the article

• Is it Bad Practice to use C++ only for the STL containers?

  - by gmatt

  First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

  Read the article

• How do I remove elements from a jQuery wrapped set

  - by Bungle

  I'm a little confused about which jQuery method and/or selectors to use when trying to select an element, and then remove certain descendant elements from the wrapped set. For example, given the following HTML: <div id="article"> <div id="inset"> <ul> <li>This is bullet point #1.</li> <li>This is bullet point #2.</li> <li>This is bullet point #3.</li> </ul> </div> <p>This is the first paragraph of the article</p> <p>This is the second paragraph of the article</p> <p>This is the third paragraph of the article</p> </div> I want to select the article: var $article = $('#article'); but then remove <div id="inset"></div> and its descendants from the wrapped set. I tried the following: var $article = $('#article').not('#inset'); but that didn't work, and in retrospect, I think I can see why. I also tried using remove() unsuccessfully. What would be the correct way to do this? Ultimately, I need to set this up in such a way that I can define a configuration array, such as: var selectors = [ { select: '#article', exclude: ['#inset'] } ]; where select defines a single element that contains text content, and exclude is an optional array that defines one or more selectors to disregard text content from. Given the final wrapped set with the excluded elements removed, I would like to be able to call jQuery's text() method to end up with the following text: This is the first paragraph of the article.This is the second paragraph of the article.This is the third paragraph of the article. The configuration array doesn't need to work exactly like that, but it should provide roughly equivalent configuration potential. Thanks for any help you can provide!

  Read the article

• small scale web site - global javascript file style/format/pattern - improving maintainability

  - by yaya3

  I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

  Read the article

• Perl - Calling subclass constructor from superclass (OO)

  - by Emmel

  This may turn out to be an embarrassingly stupid question, but better than potentially creating embarrassingly stupid code. :-) This is an OO design question, really. Let's say I have an object class 'Foos' that represents a set of dynamic configuration elements, which are obtained by querying a command on disk, 'mycrazyfoos -getconfig'. Let's say that there are two categories of behavior that I want 'Foos' objects to have: Existing ones: one is, query ones that exist in the command output I just mentioned (/usr/bin/mycrazyfoos -getconfig`. Make modifications to existing ones via shelling out commands. Create new ones that don't exist; new 'crazyfoos', using a complex set of /usr/bin/mycrazyfoos commands and parameters. Here I'm not really just querying, but actually running a bunch of system() commands. Affecting changes. Here's my class structure: Foos.pm package Foos, which has a new($hashref-{name = 'myfooname',) constructor that takes a 'crazyfoo NAME' and then queries the existence of that NAME to see if it already exists (by shelling out and running the mycrazyfoos command above). If that crazyfoo already exists, return a Foos::Existing object. Any changes to this object requires shelling out, running commands and getting confirmation that everything ran okay. If this is the way to go, then the new() constructor needs to have a test to see which subclass constructor to use (if that even makes sense in this context). Here are the subclasses: Foos/Existing.pm As mentioned above, this is for when a Foos object already exists. Foos/Pending.pm This is an object that will be created if, in the above, the 'crazyfoo NAME' doesn't actually exist. In this case, the new() constructor above will be checked for additional parameters, and it will go ahead and, when called using -create() shell out using system() and create a new object... possibly returning an 'Existing' one... OR As I type this out, I am realizing it is perhaps it's better to have a single: (an alternative arrangement) Foos class, that has a -new() that takes just a name -create() that takes additional creation parameters -delete(), -change() and other params that affect ones that exist; that will have to just be checked dynamically. So here we are, two main directions to go with this. I'm curious which would be the more intelligent way to go.

  Read the article

• Symfony2 Forms: is it possible to bind a form in an "unconventional way"?

  - by DonCallisto

  Imagine this scenario: in our company there is an employee that "play" around graphic,css,html and so on. Our new project will born under symfony2 so we're trying some silly - but "real" - stuff (like authentication from db, submit data from a form and persist it to db and so on..) The problem As far i know, learnt from symfony2 "book" that i found on the site (you can find it here), there is an "automated" way for creating and rendering forms: 1) Build the form up into a controller in this way $form = $this->createFormBuilder($task) ->add('task','text'), ->add('dueDate','date'), ->getForm(); return $this->render('pathToBundle:Controller:templateTwig', array('form'=>$form->createview()); 2) Into templateTwig render the template {{ form_widget(form) }} // or single rows method 3) Into a controller (the same that have a route where you can submit data), take back submitted information if($rquest->getMethod()=='POST'){ $form->bindRequest($request); /* and so on */ } Return to scenario Our graphic employee don't want to access controllers, write php and other stuff like those. So he'll write a twig template with a "unconventional" (from symfony2 point of view, but conventional from HTML point of view) method: /* into twig template */ <form action="{{ path('SestanteUserBundle_homepage') }}" method="post" name="userForm"> <div> USERNAME: <input type="text" name="user_name" value="{{ user.username}}"/> </div> <div> EMAIL: <input type="text" name="user_mail" value="{{ user.email }}"/> </div> <input type="hidden" name="user_id" value="{{ id }}" /> <input type="submit" value="modifica i dati"> </form> Now, if into the controller that handle the submission of data we do something like that public function indexAction(Request $request) { if($request->getMethod() == 'POST'){ // sono arrivato per via di un submit, quindi devo modificare i dati prima di farli vedere a video $defaultData = array('message'=>'ho visto questa cosa in esempio, ma non capisco se posso farne a meno'); $form = $this->createFormBuilder($defaultData) ->add('user_name','text') ->add('user_mail','email') ->add('user_id','integer') ->getForm(); $form->bindRequest($request); //bindo la form ad una request $data = $form->getData(); //mi aspetto un'array chiave=>valore /* .... */ We expected that $data will contain an array with key,value from the submitted form. We found that it isn't true. After googling for a while and try with other "bad" ideas, we're frozen into that. So, if you have a "graphic office" that can't handle directly php code, how can we interface from form(s) to controller(s) ? UPDATE It seems that Symfony2 use a different convention for form's field name and lookup once you've submitted that. In particular, if my form's name is addUser and a field is named userName, the field's name will be AddUser[username] so maybe it have a "dynamic" lookup method that will extract form's name, field's name, concat them and lookup for values. Is it possible?

  Read the article

• Java replacement for C macros

  - by thkala

  Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

  Read the article

• NHibernate and objects with value-semantics

  - by Groo

  Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

  Read the article

• Parsing string logic issue c#

  - by N0xus

  This is a follow on from this question My program is taking in a string that is comprised of two parts: a distance value and an id number respectively. I've split these up and stored them in local variables inside my program. All of the id numbers are stored in a dictionary and are used check the incoming distance value. Though I should note that each string that gets sent into my program from the device is passed along on a single string. The next time my program receives that a signal from a device, it overrides the previous data that was there before. Should the id key coming into my program match one inside my dictionary, then a variable held next to my dictionaries key, should be updated. However, when I run my program, I don't get 6 different values, I only get the same value and they all update at the same time. This is all the code I have written trying to do this: Dictionary<string, string> myDictonary = new Dictionary<string, string>(); string Value1 = ""; string Value2 = ""; string Value3 = ""; string Value4 = ""; string Value5 = ""; string Value6 = ""; void Start() { myDictonary.Add("11111111", Value1); myDictonary.Add("22222222", Value2); myDictonary.Add("33333333", Value3); myDictonary.Add("44444444", Value4); myDictonary.Add("55555555", Value5); myDictonary.Add("66666666", Value6); } private void AppendString(string message) { testMessage = message; string[] messages = message.Split(','); foreach(string w in messages) { if(!message.StartsWith(" ")) outputContent.text += w + "\n"; } messageCount = "RSSI number " + messages[0]; uuidString = "UUID number " + messages[1]; if(myDictonary.ContainsKey(messages[1])) { Value1 = messageCount; Value2 = messageCount; Value3 = messageCount; Value4 = messageCount; Value5 = messageCount; Value6 = messageCount; } } How can I get it so that when programs recives the first key, for example 1111111, it only updates Value1? The information that comes through can be dynamic, so I'd like to avoid harding as much information as I possibly can.

  Read the article

• jQuery reports incorrect element height in Firefox iframe

  - by Augustus

  Here a short test to demonstrate my problem. I have a page that loads an iframe: <html> <head> <title></title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.js"></script> </head> <body> <iframe id="iframe" src="box.html" style="width: 100px; height: 100px"></iframe> <script> $('#iframe').bind('load', function () { var div = $(this).contents().find('div'); alert(div.height()); alert(div.innerHeight()); alert(div.outerHeight()); alert(div.outerHeight(true)); }); </script> </body> </html> The iframe (box.html) contains a single styled div: <html> <head> <title></title> <style> div { height: 50px; width: 50px; margin: 5px; padding: 5px; border: 2px solid #00f; background-color: #f00; } </style> </head> <body> <div></div> </body> </html> The four alerts should return 50, 60, 64 and 74, respectively. This works as expected in Safari and Chrome. In FF 3.5.1, they all return 64. This is wrong. Does anyone know how I can force FF/jQuery to return the correct values?

  Read the article

• How to page multiple data sets in ASP.NET MVC

  - by REA_ANDREW

  On a single view I will have three sets of paged data. Which means for each model I will have The Objects The Page Index The Page Size My initial thought was for example: public class PagedModel<T> where T:class { public IList<T> Objects { get; set; } public int ModelPageIndex { get; set; } public int ModelPageSize { get; set; } } Then having a model which is to be supplied to the action as for example: public class TypesViewModel { public PagedModel<ObjectA> Types1 { get; set; } public PagedModel<ObjectB> Typed2 { get; set; } public PagedModel<ObjectC> Types3 { get; set; } } So if I then for example have the Index view inherit from the type: System.Web.Mvc.ViewPage<uk.co.andrewrea.forum.Web.Models.TypesViewModel> Now my initial aciton method for the index is simply: public ActionResult Index() { var forDisplayPurposes = new TypesViewModel(); return View(forDisplayPurposes); } If I then want to page, it is here where I am struggling to decide which action to take. Lets say that I select the next page of the Types2 PageModel. What should the action look like for this in order to return the new view showing the second page of the Types2 PageModel I was thinking possibly to duplicate the action but use it with POST [AcceptVerbs(HttpVerbs.Post)] public ActionResult Index(TypesViewModel model) { return View(model); } Is this a good way to approach it. I understand there is always Session, but I was just wondering how such a thing is achieved currently out there. If any best methods have been mutually accepted and things. So simply, one page with multiple paged models. How to persist the data for each using a wrapper model. Which way should you pass in the model and which way should you page the data, i.e. Form Post Lastly, I have seen the routes take this into account i.e. {controller}/{action}/{id}/{pageindex}/{pagesize} but this only accounts for one model and I do not really wwant to repeat the pagesize and pageindex values for the number of models I have inside the wrapper model. Thanks for your time!! Andrew

  Read the article

• What common routines do you put in your Program.cs for C#

  - by Rick

  I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

  Read the article

• Using Selenium-IDE with a rich Javascript application?

  - by Darien

  Problem At my workplace, we're trying to find the best way to create automated-tests for an almost wholly javascript-driven intranet application. Right now we're stuck trying to find a good tradeoff between: Application code in reusable and nest-able GUI components. Tests which are easily created by the testing team Tests which can be recorded once and then automated Tests which do not break after small cosmetic changes to the site XPath expressions (or other possible expressions, like jQuery selectors) naively generated from Selenium-IDE are often non-repeatable and very fragile. Conversely, having the JS code generate special unique ID values for every important DOM-element on the page... well, that is its own headache, complicated by re-usable GUI components and IDs needing to be consistent when the test is re-run. What successes have other people had with this kind of thing? How do you do automated application-level testing of a rich JS interface? Limitations We are using JavascriptMVC 2.0, hopefully 3.0 soon so that we can upgrade to jQuery 1.4.x. The test-making folks are mostly trained to use Selenium IDE to directly record things. The test leads would prefer a page-unique HTML ID on each clickable element on the page... Training the testers to write or alter special expressions (such as telling them which HTML class-names are important branching points) is a no-go. We try to make re-usable javascript components, but this means very few GUI components can treat themselves (or what they contain) as unique. Some of our components already use HTML ID values in their operation. I'd like to avoid doing this anyway, but it complicates the idea of ID-based testing. It may be possible to add custom facilities (like a locator-builder or new locator method) to the Selenium-IDE installation testers use. Almost everything that goes on occurs within a single "page load" from a conventional browser perspective, even when items are saved Current thoughts I'm considering a system where a custom locator-builder (javascript code) for Selenium-IDE will talk with our application code as the tester is recording. In this way, our application becomes partially responsible for generating a mostly-flexible expression (XPath or jQuery) for any given DOM element. While this can avoid requiring more training for testers, I worry it may be over-thinking things.

  Read the article

• I need help converting a C# string from one character encoding to another?

  - by Handleman

  According to Spolsky I can't call myself a developer, so there is a lot of shame behind this question... Scenario: From a C# application, I would like to take a string value from a SQL db and use it as the name of a directory. I have a secure (SSL) FTP server on which I want to set the current directory using the string value from the DB. Problem: Everything is working fine until I hit a string value with a "special" character - I seem unable to encode the directory name correctly to satisfy the FTP server. The code example below uses "special" character é as an example uses WinSCP as an external application for the ftps comms does not show all the code required to setup the Process "_winscp". sends commands to the WinSCP exe by writing to the process standardinput for simplicity, does not get the info from the DB, but instead simply declares a string (but I did do a .Equals to confirm that the value from the DB is the same as the declared string) makes three attempts to set the current directory on the FTP server using different string encodings - all of which fail makes an attempt to set the directory using a string that was created from a hand-crafted byte array - which works Process _winscp = new Process(); byte[] buffer; string nameFromString = "Sinéad O'Connor"; _winscp.StandardInput.WriteLine("cd \"" + nameFromString + "\""); buffer = Encoding.UTF8.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.UTF8.GetString(buffer) + "\""); buffer = Encoding.ASCII.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.ASCII.GetString(buffer) + "\""); byte[] nameFromBytes = new byte[] { 83, 105, 110, 130, 97, 100, 32, 79, 39, 67, 111, 110, 110, 111, 114 }; _winscp.StandardInput.WriteLine("cd \"" + Encoding.Default.GetString(nameFromBytes) + "\""); The UTF8 encoding changes é to 101 (decimal) but the FTP server doesn't like it. The ASCII encoding changes é to 63 (decimal) but the FTP server doesn't like it. When I represent é as value 130 (decimal) the FTP server is happy, except I can't find a method that will do this for me (I had to manually contruct the string from explicit bytes). Anyone know what I should do to my string to encode the é as 130 and make the FTP server happy and finally elevate me to level 1 developer by explaining the only single thing a developer should understand?

  Read the article

• Deleting a node in a family tree

  - by user559142

  Hi, I'm trying to calclulate the best way to delete a node in a family tree. First, a little description of how the app works. My app makes the following assumption: Any node can only have one partner. That means that any child a single node has, it will also be the partner nodes child too. Therefore, step relations, divorces etc aren't compensated for. A node always has two parents - A mother and father cannot be added seperately. If the user doesn't know the details - the nodes attributes are set to a default value. Also any node can add parents, siblings, children to itself. Therefore in law relationships can be added. I have the following classes: FamilyMember String fName; String lName; String dob; String gender; FamilyMember mother, father, partner; ArrayListchildren; int index; int generation; void linkParents(); void linkPartner(); void addChild(); //gets & sets for fields Family ArrayListfamily; void addMember(); void removeMember(); FamilyMember getFamilyMember(index); ArrayListgetFamilyMembers(); FamilyTree Family family; void removeMember(); //need help void displayFamilyMembers(); void addFamilyMember(); void enterDetails(); void displayAncestors(); void displayDescendants(); void printDescendants(); FamilyMember findRootNode(); void sortGenerations(); void getRootGeneration(); I am having trouble with identifying the logic for removing a member. All other functions work fine. Has anyone developed a family tree app before who knows how to deal with removing various different nodes in the family "tree"? e.g. removing a leaf removing a leaf with partner (what if partner has parents etc) removing a parent It seems to be another recursive property but my head is swelling from over thought.

  Read the article

< Previous Page | 625 626 627 628 629 630 631 632 633 634 635 636  | Next Page >