Search Results

Search found 67619 results on 2705 pages for 'help documentation'.

Page 633/2705 | < Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >

• external postfix forwarding to zimbra server

  - by Marko

  I want to migrate from my current mail server (old_server) for my domain mydomain.com. old_server setup is Postfix+LDAP+Cyrus. Now I want to migrate my domain mail to Zimbra server (zimbra), but I am considering option to leave current mail server working in the first phase, and then to only have subset of email addresses to be forwarded to zimbra server. It seems that zimbra refers this in their documentation as 'edge MTA'. Current config mydomain.com MX: old_server <---------- smtp send ----------> smtp receive New config mydomain.com MX: old_server zimbra <------------------------------------------- smtp send ----------> smtp receive ---- forward ----> smtp receive I need following: old_server to receive mail for my domain as before, but for some of the email addresses I want them to be delivered to zimbra server. I should be able to determine which email addresses will be forwarded. I would like to avoid possible false spam detections for mails from mydomain.com due to this setup. Questions: How should I configure postfix on old_server to support this mail forwarding? To avoid false spam detection, can I have outgoing mail from mydomain.com to be sent by zimbra or should I use old_server? Is there anything extra I would need to do in order to avoid possibility of my outgoing mails being marked as spam on other servers?

  Read the article

• mysql startup, shtudown and logging on osx

  - by Joelio

  Hi, I am trying to troubleshoot some mysql problems (I have a table I cant seem to delete or drop, it hangs forever) I have 10.5.8 osx, I dont remember how/if I installed mysql, here is what I know: it automatically starts on boot the process looks like this: /usr/local/mysql/libexec/mysqld --basedir=/usr/local/mysql --datadir=/usr/local/mysql/var --pid-file=/usr/local/mysql/var/Joels-New-Pro.local.pid _mysql 96 0.0 0.0 75884 684 ?? Ss Sat06PM 0:00.02 /bin/sh /usr/local/mysql/bin/mysqld_safe when I run: /usr/local/mysql/libexec/mysqld --verbose --help it says: /usr/local/mysql/libexec/mysqld Ver 5.0.45 for apple-darwin9.1.0 on i686 (Source distribution) it seems to use my.cnf from /etc/my.cnf Now here are my questions: I dont see anything in the startupitems that remotely looks like mysql ls /Library/StartupItems/ BRESINKx86Monitoring ChmodBPF HP IO HP Trap Monitor Parallels ParallelsTransporter 1.) So how does it startup automatically? 2.) How do I start & stop this type of installation? Also, looking at the config, the logs have no values: /usr/local/mysql/libexec/mysqld --verbose --help|grep '^log' log (No default value) log-bin (No default value) log-bin-index (No default value) log-bin-trust-function-creators FALSE log-bin-trust-routine-creators FALSE log-error log-isam myisam.log log-queries-not-using-indexes FALSE log-short-format FALSE log-slave-updates FALSE log-slow-admin-statements FALSE log-slow-queries (No default value) log-tc tc.log log-tc-size 24576 log-update (No default value) log-warnings 1 3.) Does that mean there is no logging enabled in mysetup? thanks in advance! Joel

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Setting up a Pagefile and Partition in Server 2008

  - by Brett Powell

  I am setting up 18 new machines for our company, and I have instructions from my new boss on setting up a Pagefile and Partition. I have looked at their existing machines to base the new setups off of, but there is no consistency between any 2 machines, which has left me extremely frustrated to say the least. My instructions are... 1) Set a static pagefile (use recommended value as max/min), set it on SSD if SSD available. 2) Make 3 partitions: C: is used for OS and install files D: is used for backups on machines with a SSD. On machines without SSD create a D: partition for pagefile (2*installed RAM for partition size) E: must be the partition hosting user files I have never messed with Pagefiles before, and looking at their existing machines is offering no help. My questions are... 1) As the machines I am setting up have no SSD (just 2 SATA drives) does it sound like the Pagefile should be setup on the C: (primary) drive or the D:? The instructions are vague so I have no idea. 2) As C: and D: are both Physical drives, does it sound like C: should be partitioned out to create the E: drive or D:? Thanks for any help I can get. I am extremely stressed out under a massive workload right now, and these vague instructions are quite infuriating.

  Read the article

• Bacula v5.0.2 Windows Installation Issues

  - by JohnyD

  First off, I am very new to Bacula but I'm very intriqued from what I've read. I'm looking to set up Bacula 5.0.2 on a Windows 2008 R2 server. I've run the installer and at the end it asks me to configure DIR name, DIR password, DIR Address. Windows documentation is somewhat hard to come by and I'm not certain what exactly I'm supposed to enter here. Do I need to create a local account that matches this info? Will the installation process create the account for me? Will this be the account that handles the FD daemon/service? I'm also not certain if Address means network location or local direcory. I apologize for my ignorance. Currently I'm trying to use the following information: Name: john pass: john address: thin1 (server name although I have also tried thin1.fqdm.local and 10.0.0.104) This info allows for the installer to complete successfully. However, when I run the BAT it hangs at, "Connecting to Director thin1:9101". The Bacula File Service is currently running under the local system account. What am I doing wrong? What do I have yet to do? Once I get this working properly I assume I will need to install clients on all my Windows boxes? Also, this is a 64-bit cpu but I am installing the 32-bit client. Are there any issues with this? Should I be using the 32-bit client? Thanks very much for the help.

  Read the article

• Puppet and Vim fighting over Ruby version

  - by devians

  I have installed puppet from the .dmg from puppetlabs. If I remove ruby 1.9.3, puppet works, but other things like my vim install (dependant plugins) do not. According to http://docs.puppetlabs.com/guides/platforms.html#ruby-versions 1.9.3 is supported. So whats going wrong with puppet? % uname -a Darwin Kusanagi.local 11.4.2 Darwin Kernel Version 11.4.2: Thu Aug 23 16:25:48 PDT 2012; root:xnu-1699.32.7~1/RELEASE_X86_64 x86_64 % which ruby /usr/local/bin/ruby % ruby --version ruby 1.9.3p327 (2012-11-10 revision 37606) [x86_64-darwin11.4.2] % /usr/bin/ruby --version ruby 1.8.7 (2012-02-08 patchlevel 358) [universal-darwin11.0] % brew info ruby 1 ? ruby: stable 1.9.3-p327, HEAD http://www.ruby-lang.org/en/ Depends on: pkg-config, readline, gdbm, libyaml /usr/local/Cellar/ruby/1.9.3-p327 (796 files, 17M) * https://github.com/mxcl/homebrew/commits/master/Library/Formula/ruby.rb ==> Options --with-tcltk Install with Tcl/Tk support --with-suffix Suffix commands with "19" --universal Build a universal binary --with-doc Install documentation ==> Caveats NOTE: By default, gem installed binaries will be placed into: /usr/local/Cellar/ruby/1.9.3-p327/bin You may want to add this to your PATH. % puppet /usr/local/Cellar/ruby/1.9.3-p327/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load such file -- puppet/util/command_line (LoadError) from /usr/local/Cellar/ruby/1.9.3-p327/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require' from /usr/bin/puppet:3:in `<main>'

  Read the article

• Plesk 10 - creating and using vhost.conf

  - by MrFidge

  I'm having some issues setting up and using a vhost.conf for one of my domains. So far none of the domains have required any extra configuration but now I need to use a PEAR module, so I'm looking to include /usr/share/pear in the PHP settings for the domain. vhost file created in /var/www/vhosts/domain.com/conf/vhost.conf <Directory /var/www/vhosts/domain.com/httpdocs> php_admin_value include_path ".:/usr/share/pear" </Directory> I then restart Plesk using: /usr/local/psa/admin/sbin/websrvmng --reconfigure-vhost --vhost-name=domain.com Or as plesk says that command is obsolete in Plesk 10 I've tried using /usr/local/psa/admin/sbin/httpdmng --reconfigure-domain domain.com And for good luck I've restarted apache too each time. Net result - none of the PEAR includes work unless I edit the include_path in /etc/php.ini! Any tips on how to get this MOFO working? I've had a look through the documentation but TBH I just don't have time to read 40 pages of Plesk manual for one line of code, this can't be that hard, surely! Thanks for any pointers, H

  Read the article

• Exim 4 Virtual Domains and Catchall on Debian (Squeeze)

  - by parazuce

  Hello, I've been at it for about 4 hours now. Searching as well as trying different tutorials. Here's my setup: I have 2 domains, both under my own DNS server (MX records setup as well). I have exim4 successfully running, and it is able to send messages from both of those domains. I have tested this using sendmail, and manually setting the "From" attribute. Exim successfully delivers mail to users no matter which domain was specified. I'm fine with that, but I'm having an issue editing virtual domains, and adding custom delivery options (such as a catch all). I've been searching for about 4 hours, and I can't find any up-to-date documentation on how to do this. The old methods would be to add a line such as: domainlist local_domains = @:localhost:dsearch;/etc/exim4/virtual Once that line was added, I made a directory at /etc/exim4/virtual, then created files inside such as example.com which would then contain rules for delivery under that domain. This did not work, however. Searching further, I've found that exim no longer supports dsearch (I guess because they claim it never has?) This is where I'm stuck. I'm on a "split" configuration as well.

  Read the article

• Dismount USB External Drive using powershell

  - by JC

  Hello, I am attempting to dismount an external USB drive using powershell and I cannot successfuly do this. The following script is what I use: #get the Win32Volume object representing the volume I wish to eject $drive = Get-WmiObject Win32_Volume -filter "DriveLetter = 'F:'" #call dismount on that object there by ejecting drive $drive.Dismount($Force , $Permanent) I then check my computer to check if drive is unmounted but it is now. The boolean parameters $force and $permanent have been tried with different permutations to no avail. The exit code returned by the dismount command changes when the params are toggled. (0,0) = exit code 0 (0,1) = exit code 2 (1,0) = exit code 0 (1,1) = exit code 2 The documentation for exit code 2 indicates that there are existing mount points as a reason why it cannot dismount. Although I am trying to dismount the only mount point that exists so I am unsure what this exit code is trying to tell me. Having already trawled the web for people experiencing similar problems I have only found one additional command to try and that is the following: # executed after the .Dismount() command $drive.Put() This additional command does not help. I am running out of things to try, so any assistance anyone can give me would be greatly appreciated, Thanks.

  Read the article

• win8: access denied to external USB disk; update access rights fails

  - by Gerard

  I use to work with 2 laptops (vista and win7), my work being files on an external usb disk. My oldest laptop broke down, so I bought a new one. I had no option other than take win8. 1/ I suspect something changed with access rights, as my external disk suffered some "access denied" problem on win8. I was prompted (by win8) somehow to fix the access rights, which I tried to do, getting to the properties - security. This process was very slow and ended up saying "disk is not ready". Additonnally, the usb somehow was not recognized anymore. 2/ Back to win7, I was warned that my disk needed to be verified, which I did. In this process, some files were lost (most of them i could recover from the folder found00x, but I have some backup anyway). Also, I don't know why, but under win7, all the folder showed with a lock. 3/ Then back again to win8. Same problem : access denied to my disk + no way to change access rights as it gets stuck "disk is not ready". Now I am pretty sure there is some kind of bug or inconsistence in win8 / win7. I did 2/ and 3/ a few times. At some point, I also got an access denied in win7. I could restore access rigths to the disk to "system" (properties - security - EDIT for full control to group "system" ...). But then I still get the same access right pb on win8, and getting stuck in the process to restore full control to "system" -- and "admin" groups. Now, after I tried for more than 3 days, I am losing my patience with that bloody win8 which I did not want to buy but had no choice. I upgraded win8 with the windows updates available. Does not help. Anybody can help me ?

  Read the article

• Network Management Cable Labeling Techniques and their alternatives [closed]

  - by Alex

  Possible Duplicate: What is the most effective solution you used to label cables? Yes i know there are a lot of howtos and already answered questions about this topic, like this one: How do you organise the cables in your racks? Currently i am searching the web for different techniques (alternatives) for labeling the cables at the server racks and/or data centers. Unfortunately i do not have any experience with labeling/documentation of network cables in a large scale. As far as I could lookup by now the current labeling techniques are coloring and a self defined print-labeling technique (numbering, text) maybe also according to a standard which are usually used. I want to know if QR, RFID (ok RFID in a data center would be stupid due to the radio frequency wouldn't it be?), Barcodes or similar (??) have already been used by some administrators or why they did not consider such techniques at all? Too complicated (with QR scanner etc..) if you are in front of the cables and want to get quick feedback for what the cable is? What alternatives are out there? Advantages/Disadvantages? Best-Practice? I would appreciate any help on this topic, thank you! Regards, Alex

  Read the article

• Mod_Perl configuration for multiple domains

  - by daliaessam

  Reading the Mod_Perl module documentation, can we configure it on per domain basis, what I mean can we configure it to run on every domain or specific domain only. What I see in the docs is: Registry Scripts To enable registry scripts add to httpd.conf: Alias /perl/ /home/httpd/2.0/perl/ <Location /perl/> SetHandler perl-script PerlResponseHandler ModPerl::Registry PerlOptions +ParseHeaders Options +ExecCGI </Location> and now assuming that we have the following script: #!/usr/bin/perl print "Content-type: text/plain\n\n"; print "mod_perl 2.0 rocks!\n"; saved in /home/httpd/httpd-2.0/perl/rock.pl. Make the script executable and readable by everybody: % chmod a+rx /home/httpd/httpd-2.0/perl/rock.pl Of course the path to the script should be readable by the server too. In the real world you probably want to have a tighter permissions, but for the purpose of testing, that things are working, this is just fine. From what I understand above, we can run Perl scripts only from one specific folder that we put the directive above. So the question again, can we make this directive per domain for all domains or for specific number of domains?

  Read the article

• Enabling AHCI in BIOS for SSD

  - by Robert

  I am trying to help a friend with a desktop upgrade. It is an old machine with an Intel DG31 main board. The board has 1 IDE port to which a DVD-ROM drive is connected, and 2 SATA ports. 1 SATA port had a hard drive with XP on it. I have made that the secondary drive now and wiped the OS as requested, so it is just for data. The new SSD has been installed but I read that for best results one must enable AHCI in the BIOS? So I checked and in the BIOS there is a SATA Mode setting with 2 options - Native and Legacy. I think Native means AHCI? After setting to Native, I installed Windows 7 Home Premium and all the latest drivers from Intel's website and all Windows Updates. Now when I check Device Manager I see this: Also Microsoft says HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\Msahci\Start and HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\IastorV\Start should have value 0 for AHCI but I see that the value is 3 for both. So does this mean that Native mode is not AHCI? Or Windows 7 ignored BIOS setting and installed in IDE mode, maybe because both cables are present? Please help me enable AHCI on this system. Thanks!

  Read the article

• Difference between accessing a website using Local host and IP address

  - by Cdeez

  I have developed an ASP.NET website and deployed into my IIS server. Now to see that my IIS is installed fine, I type local host in my address bar, and I get the welcome screen of IIS and its documentation in a separate window. Now I gave the url of my website http://localhost/mysites/site2/Default.aspx I access my site. Also giving my IP address instead of local host like: http://192.168.1.46/mysites/site2/Default.aspx also works. Just out of curiosity I wanted to see what happens when I give my IP address in addressbar. It asks me a user name and password saying:The server 192.168.1.46:80 requires a user name and password. I donot know what user name and password it is asking, and as of my knowledge I thought localhost points to my own IP address internally. But what is the difference and also what username and password do I need for it? Update: On chrome and IE just giving localhost displays the welcome screen, but on mozilla, localhost is also asking for a username and password.

  Read the article

• What is the correct iptables rule when NATing multiple private subnets?

  - by Jose Mendez

  I have a Centos minimal 6.5 acting as a router. eth0 is connected to a Cisco switch trunk port, allowing VLANs 200-213. I have several VLAN interfaces just as this link suggests: https://access.redhat.com/documentation/en-US/Red_Hat_Enterprise_Linux/6/html/Deployment_Guide/s2-networkscripts-interfaces_802.1q-vlan-tagging.html And have IPv4 forwarding, so all my network devices from any of the networks 200-213 can communicate with each other using this linux box as their router. Problem is, I need them to access the Internet, so I added the following rule: iptables -t nat -A POSTROUTING -s 192.168.0.0/16 -j SNAT --to 1.1.1.56 1.1.1.56 is the "outside" address. This works fine, devices connected to the internal networks can ping Intertnet addresses BUT, they stop being able to talk to each other across subnets, so 192.168.211.55 can ping 8.8.8.8, but can't talk to 192.168.213.5. As soon as I do a service iptables restart to remove the rule, I can start talking across internal subnets again. What would be the correct way to set up NAT for multiple private subnets? Or maybe the correct way to set up forwarding?

  Read the article

• Fedora 17 - Dropping into debug shell after attempted partitioning

  - by i.h4d35

  So I tried creating a new partition on Fedora 17 using fdisk as follows: Command (m for help): n Command action e extended p primary partition (1-4) p Partition number (1-4): 1 First cylinder (2048-823215039, default 2048): Using default value 2048 Last cylinder or +size or +sizeM or +sizeK (1-9039, default 9039): +15G Once this was done,instead of formatting the partition I created, I ran the partprobe command to write the changes to the partition table. On rebooting the computer, it drops to the debug shell and gives me the error as follows: dracut warning:unable to process initqueue dracut warning:/dev/disk/by-uuid/vg_mymachine does not exist dropping to debug shell dracut:/# While trying to run fsck on the said partition from the debug shell, it says "etc/fstab not found" and inside /etc I see a fstab.empty file. Is it now possible to retrieve what I have from the computer? Any help would be appreciated. Thanks in advance Edit: I've also tried the following steps for additional troubleshooting: I tried to boot using the Fedora disk and tried the rescue mode - says no Linux partition detected. I tried to create an fstab file by combining the entries from blkid and the /etc/mtab file and using the UUIDs from the mtab file - It didn't work. As soon as I rebooted the machine, it promptly dropped me in to the debug shell and the fstab file which i created wansn't there anymore in /etc (part of this solution)

  Read the article

• Can't Login to phpPgAdmin

  - by Devin

  I'm trying to set up phpPgAdmin on my test machine so that I can interface with PostgreSQL without always having to use the psql CLI. I have PostgreSQL 9.1 installed via the RPM repository, while I installed phpPgAdmin 5.0.4 "manually" (by extracting the archive from the phpPgAdmin website). For the record, my host OS is CentOS 6.2. I made the following configuration changes already: PostgreSQL Inside pg_hba.conf, I changed all METHODs to md5. I gave the postgres account a password I added a new account named webuser with a password (note that I did not do anything else to the account, so I can't exactly say that I know what permissions it has and all) phpPgAdmin config.inc.php Changed the line $conf['servers'][0]['host'] = ''; to $conf['servers'][0]['host'] = '127.0.0.1'; (I've also tried using localhost as the value there). Set $conf['extra_login_security'] to false. Whenever I try to log in to phpPgAdmin, I get "Login failed", even if I use successful credentials (ones that work in psql). I've tried to go through some of the steps noted in Question 3 in the FAQ, but it hasn't worked out well so far there. It likely does not help that this is my first day working with PostgreSQL. I'm farily familiar with MySQL, but I have to use PostgreSQL for the project I'm working on. Could anyone offer some help for how to set up phpPgAdmin on CentOS 6.2? If I've done something terribly wrong in my configuration so far, it's no big deal to blow something/everything away, as it's not like I've stored any data there yet! I appreciate any insight you may have!

  Read the article

• Passenger not booting Rails App

  - by firecall

  I'm at the end of ability, so time to ask for help. My hosting company are moving me to a new server. I've got my own VPS. It's a fresh CentOS 5 install with Plesk 9.5.2 Essentially Passenger just doesnt seem to be booting the Rails app. It's like it doesnt see it's a Rails app to be booted. I've got Rails 3.0 install with Ruby 1.9.2 built from source. I can run Bundle Install and that works. I've currently got Passenger 3 RC1 installed as per here, but have tried v2 as well. My conf/vhost.conf file looks like this: DocumentRoot /var/www/vhosts/foosite.com.au/httpdocs/public/ RackEnv development #Options Indexes I've got a /etc/httpd/conf.d/passenger.conf file which looks like this: LoadModule passenger_module /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4/ext/apache2/mod_passenger.so PassengerRoot /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4 PassengerRuby /usr/local/bin/ruby PassengerLogLevel 2 and all I get is a 403 forbidden or the directory listing if I enable Indexes. I dont know what else to do! Yikes. There's nothing in the Apache error log that I can see. The new server admin isnt much help as I think he's a bit junior and says he doesnt know about Rails... sigh :/ I'm a programmer and server admin isnt my bag :(

  Read the article

• Magento Apache Config & Memory Issues

  - by cheshirepine

  I have a Magento installation on a VPS that is giving me a headache. This particular VPS has a reasonable spec - 2gb Memory and 50gb storage. It runs a single domain, with a single Magento install - and nothing else. About 5 months ago we started having issues. Every so often (about once every 2 or 3 weeks) the VPS would crash - all processes stopped and the only way to restart the container is via Virtuozzo. Now, however its 2 or 3 times a week. My VPS hosts confirm I am breaching the 2gb memory limit, at which point all VPS processes are killed to stop it bringing the entire node down. I have not made any config changes to it at all - I was running New Relic on it for a short while, but have removed that in case it was contributing to the issues. I can see nothing in the logs which indicates an issue and we have no CRON jobs running at the time the crashes happen. The site generates steady, but not huge amounts of traffic (averaging usually less than 100 visits per day) Is there anything in particular I should have done to the Apache or PHP configs to help? Im not a massivley experienced Apache admin, but know more than enough to solve most problems... Failing that, any other ideas that might help? Can't afford for this site to be down this much.

  Read the article

• Event Log: atapi - the device did not respond within the timeout period - Freeze

  - by rjlopes

  Hi, I have a Windows Server 2003 that stops working randomly (displays image on monitor but is completely frozen), all I could found on the event log as causes were an error from atapi and a warning from msas2k3. The event log entries are: Event Type: Error Event Source: atapi Event Category: None Event ID: 9 Date: 22-07-2009 Time: 16:13:33 User: N/A Computer: SERVER Description: The device, \Device\Ide\IdePort0, did not respond within the timeout period. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 64 00 ......d. 0008: 00 00 00 00 09 00 04 c0 .......À 0010: 01 01 00 50 00 00 00 00 ...P.... 0018: f8 06 20 00 00 00 00 00 ø. ..... 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 01 00 00 00 ........ 0030: 00 00 00 00 07 00 00 00 ........ Event Type: Warning Event Source: msas2k3 Event Category: None Event ID: 129 Date: 22-07-2009 Time: 16:14:23 User: N/A Computer: SERVER Description: Reset to device, \Device\RaidPort0, was issued. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 68 00 ......h. 0008: 00 00 00 00 81 00 04 80 ......? 0010: 04 00 00 00 00 00 00 00 ........ 0018: 00 00 00 00 00 00 00 00 ........ 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 00 00 00 00 ........ 0030: 01 00 00 00 81 00 04 80 ......? Any hints?

  Read the article

• Which Firefox add-on is responsible for a rendering bug?

  - by Gilles

  I've found a page that isn't rendered correctly by Firefox with my usual profile. It is rendered correctly with a blank profile. I have quite a few add-ons. One of them is surely the culprit. How can I find out which? Userscripts often affect the rendering. But I turned off Greasemonkey, and it didn't help. So it's something else, presumably an extension (what else could it be? I have no chrome/userChrome.css.). I'm looking for an easy way to find out which one, easier than disabling a bunch of extensions and restarting umpteen times. Related: Create a tool to help users identify a problematic add-on by bisecting the list of installed add-ons — a similar problem which would admit a similar solution. I want to automate this as much as possible; something like git bisect, that doesn't require me to change my actual profile, would be ideal. A Linux-specific solution is fine with me.

  Read the article

• GRE Tunnel over IPsec with Loopback

  - by Alek

  I'm having a really hard time trying to estabilish a VPN connection using a GRE over IPsec tunnel. The problem is that it involves some sort of "loopback" connection which I don't understand -- let alone be able to configure --, and the only help I could find is related to configuring Cisco routers. My network is composed of a router and a single host running Debian Linux. My task is to create a GRE tunnel over an IPsec infrastructure, which is particularly intended to route multicast traffic between my network, which I am allowed to configure, and a remote network, for which I only bear a form containing some setup information (IP addresses and phase information for IPsec). For now it suffices to estabilish a communication between this single host and the remote network, but in the future it will be desirable for the traffic to be routed to other machines on my network. As I said this GRE tunnel involves a "loopback" connection which I have no idea of how to configure. From my previous understanding, a loopback connection is simply a local pseudo-device used mostly for testing purposes, but in this context it might be something more specific that I do not have the knowledge of. I have managed to properly estabilish the IPsec communication using racoon and ipsec-tools, and I believe I'm familiar with the creation of tunnels and addition of addresses to interfaces using ip, so the focus is on the GRE step. The worst part is that the remote peers do not respond to ping requests and the debugging of the general setup is very difficult due to the encrypted nature of the traffic. There are two pairs of IP addresses involved: one pair for the GRE tunnel peer-to-peer connection and one pair for the "loopback" part. There is also an IP range involved, which is supposed to be the final IP addresses for the hosts inside the VPN. My question is: how (or if) can this setup be done? Do I need some special software or another daemon, or does the Linux kernel handle every aspect of the GRE/IPsec tunneling? Please inform me if any extra information could be useful. Any help is greatly appreciated.

  Read the article

• Setting up AJP with JBoss 7

  - by purlogic

  I have two different versions of JBoss on a server, JBoss 6.0 Final and JBoss 7.0.2. I can one run or the other by switching a couple of sym links and issuing a "service jboss start" command. I am, by no means, an expert in JBoss, however JBoss 6.0 appears to have AJP running out of the box with no initial configuration required on port 8009. With JBoss 7, however, I had to vi the file "standalone/configuration/standalone.xml" and add a few entries. Those entries are: In the <subsystem /> tag, I added: <connector name="ajp" protocol="AJP/1.3" socket-binding="ajp" /> In the <socket-binding-group /> tag I added: <socket-binding name="ajp" port="8009"/> Then in Apache's configuration file (httpd.conf), I added: <Proxy *> AddDefaultCharset Off Order deny,allow Allow from all </Proxy> ProxyPass /app ajp://localhost:8009/app ProxyPassReverse /app ajp://localhost:8009/app AJP proxying works with 6, not with 7... I assume it's because I haven't properly set up AJP in JBoss 7 and not entirely sure how to do that. I have searched documentation on their site with not a lot of specifics on how to do so. Any help or insight into setting up AJP with JBoss 7 would be much appreciated!!

  Read the article

• Installed Paragon HFS+ for Windows 8, now my pc won't recognize the external firewire drive

  - by Steve

  I'm not incredibly knowledgeable about computers and I really need some help. Just got a Seagate external firewire drive this morning. I downloaded the necessary pc driver (Paragon HFS+ for Windows 8) through their website per the instructions that came with the drive. After installation, I restarted and the pc recognized the firewire drive just fine. About three hours into copying files from my pc to the firewire drive, it gave me an error and told me the files couldn't be copied. When I clicked to get out of the message, the computer crashed. After an hour of it trying to repair itself in safe mode, it restored me to an earlier version before the system crashed. Here's my current dilemma: The Paragon HFS+ is still showing up in my programs as installed, but the Device Manager is not recognizing the drive. When I try to uninstall and reinstall Paragon, it interrupts me with a message saying "The setup must update files or services that cannot be updated while the system is running" and basically gives me the finger. I have no idea what to do now, as it won't let me uninstall and reinstall Paragon, and I have no idea why it crashed my computer in the first place. Is there possibly another Mac - PC firewire driver I can try downloading instead? I really don't know what I'm doing and any help would be greatly appreciated.

  Read the article

• Can I have a single solid state drive and a RAID array on the same machine?

  - by jaminto

  Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

  Read the article

< Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >