Search Results

Search found 37817 results on 1513 pages for 'function signatures'.

Page 634/1513 | < Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Suggestion for R/LaTeX table creation package

    - by aL3xa
    I've been using xtable package for a long time, and looking forward to writting my first package in R... so I reckon that if I have some "cool" idea that's worth carying out, there's a great chance that somebody got there before me... =) I'm interested in functions/packages specialized for LaTeX table creation (through R, of course). I bumped on quantreg package which has latex.table function. Any suggestion for similar function(s)/package(s)? P.S. I'm thinking about building a webapp in which users can define their own presets/templates of tables, choose style, statistics, etc. It's an early thought, though... =)

    Read the article

  • Built in raytracing?

    - by acidzombie24
    Relating to this question i was wondering if .NET has any libs (or a function) i can use to detect if one point collides with another. I am not sure what angles i should use but is there some function like this func(point src, rect target, angle, distanceOfVision, listPointOrRectOfWalls) Pretty unlikely but i dont know a formula or how to start. Its a quick and dirty prototype. I am thinking of writing the func about but dropping angle and just make line of sight a rectangle and check if any points is between src and target.

    Read the article

  • Change the colors of JvectorMap when there are 2 maps on the page

    - by Youssef
    i am using Jvectormap to place 2 maps on my page. the maps are placed normally and everything is fine. they are placed in 2 different divs: <div id="map1"> </div> <div id="map2"> </div> and the Jquery: $(function () { $('#map1').vectorMap({ color: '#aaaaaa', backgroundColor: '#ffffff', hoverOpacity: 1, hoverColor: true }); }); $(function () { $('#map2').vectorMap({ color: '#aaaaaa', backgroundColor: '#ffffff', hoverOpacity: 1, }); }); Now when I try to change the colors of map2 dynamically using: $("#map2").vectorMap("set", "colors", colorsDictionnary); The colors of the first one only is changed. and this happens only when changing colors. Always the first one have it's colors changed even if I am using $("#map2") How can change the colors of the map2 without touching map1? Thank you very much for any help, I really need it

    Read the article

  • Avoid multiple autocomplete calls by wrapping it with SetTimeOut

    - by pixelboy
    Here's my issue : using an autocomplete jQuery plugin, I'd like to avoid multiple ajax requests when user strikes his keynoard by surrounding the $('#query1').autocomplete({ serviceUrl:'/actions/autocomplete?population=salon', minChars:3, maxHeight:300, width:200, clearCache:true, onSelect: function(suggestions,data){ $(".btn1").attr("href", "${pageContext.request.contextPath}/actions/espaceClients?participantId=" + data) } }); with something like var search = false; $('#query1, #query2, #query3').keyup(function(){ if (!search){ search = true; } if (search) { search = false; autocompleteThem(); } }); A you can see, above code is stupid, but it kinda shows what i'm trying to do. In simple words, if user dosen't type anything else in a certain period of time, then you can call autocomplete. I hope i'm being clear, as my brains are a mess...

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • Void pointer values comparing C++

    - by user2962977
    My actual question is it really possible to compare values contained in two void pointers, when you actually know that these values are the same type? For example int. void compVoids(void *firstVal, void *secondVal){ if (firstVal < secondVal){ cout << "This will not make any sense as this will compare addresses, not values" << endl; } } Actually I need to compare two void pointer values, while outside the function it is known that the type is int. I do not want to use comparison of int inside the function. So this will not work for me as well: if (*(int*)firstVal > *(int*)secondVal) Any suggestions? Thank you very much for help!

    Read the article

  • Clear Select options when selecting one field while using multiple forms on same page

    - by Nizam
    Hi all, I have a situation where the second select list option is generated from the first select list selected option. Like when we select Country corresponding states are generated in next select list. In my case I am having multiple forms on single page which are same. Can anyone let me know how to implement it on multiple forms. I tried the following code but it didn't work $(".country").change(function(){ $.get("sample.php?val=" + $(this).val(), function(data){ $(this).parent().next().children('.state').children('option').remove(); $(this).parent().next().children('.state').append(data); }); Waiting for your support thanks in advance

    Read the article

  • How should I port this Prototype to JQuery?

    - by blu
    There is currently this Prototype code that does a PUT: new Ajax.Request(someUrl, { method: 'put', parameters: { 'foo': bar }, onSuccess: function(response) { } .bind(this) }); I found this post but the solution uses an extra parameter supported by RoR, however I am targeting an ASP.NET backend. I searched a bit and found that not all browsers support PUT operations so apparently this could fail in certain browsers? This is already in prod, so a direct port would be fine for now I suppose. As an aside, what is the deal with the bind(this) in the onSuccess function?

    Read the article

  • jQuery get value from checked element with a given name

    - by Travis Leleu
    I've got an input like so: I'd like to use jQuery to grab that element, and add the function call foo() to the change event. Currently I can get it done, but there are two hacks involved. My (working) code: $(":input[name*=myfield]").change( function( $(":input[name*=myfield]") ) { foo(); }); )}; There are two hacks in there I'd like to eliminate. Keeping in mind that the input names are multidimensional arrays, how can I use the :input[name=somename], versus [name*=someone]? I'd imagine it's faster using an exact name rather than *=, but I can't get the escape sequence correct for the brackets on the multidimensional arrays. Can I chain the call together so that I don't have to select the element twice? Is the standard practice for that to select the HTML element into a var, then use that var? Or can I chain it together? Thanks for the help. Still working on getting my footing in JS/JQ.

    Read the article

  • jQuery: form input values turns up undefined

    - by Seerumi
    Having problem with this bit of code qith jQuery. it should pick the values from current form and then submit them, but when I try to get them with jQuery they always turn up undefined. I know the SQL results are fine since they show correctly in HTML table, so it must be my inferior javascript skills. New with jQuery and I'm at loss :( PHP/HTML: echo "<table>\n" while ($row = odbc_fetch_array($query)) { echo "<form class='catForm'>\n"; echo "<input type=hidden class='catID' name='catID' value='".$row['running_id']."'/>\n"; echo "<tr>\n"; echo "<td>".$row['running_id']."</td>\n"; echo "<td>".$row['site_id']."</td>\n"; echo "<td>".$row['main_category']."</td>\n"; echo "<td>".$row['map_name']."</td>\n"; echo "<td><input type=textfield class='bCatID' value='".$row['mapping_id']."' size=6/></td>\n"; echo "<td><input type=submit class='saveCat' value='Save'/></td>\n"; echo "<td><input type=submit class='killCat' value='Delete' /></td>\n"; echo "</tr>\n"; echo "</form>\n"; } echo "</table>"; jQuery: $(".catForm").submit(function () { var id = $(this).find('.catID').val(); var bCatID = $(this).find('.bCatID').val(); var dataString = 'id='+id+'&bCatID='+bCatID; $.ajax({ type: "POST", url: 'adminUI/bin/updateSCategories.php', dataType : 'json', data: dataString, success: function(data) { if (data.error == true) $('.failure').html("Error, save failed.").show().fadeOut(2000); if (data.error == false) $('.success').html("Saved succesfully").show().fadeOut(2000); }, error: function(XMLHttpRequest, textStatus, errorThrown) { $('.failure').html("Error, save failed.").show().fadeOut(2000); } }); return false; }); RESULT: id: undefined bCatID: undefined

    Read the article

  • Using new Image().src for click tracking

    - by razass
    I am attempting to figure out why this click tracker isn't working. The code was written by another developer so I am not entirely sure if this ever did work. function trackSponsor(o, p) { (new Image()).src = PATH_BASE + 'click/' + p + '/' + o + "?_cache=" + (+(new Date())); return false; } From what I can gather is that when this function is called it 'creates a new image' to fire a php script asynchronously. According to Firebug, the request is made however it is 'aborted' ~30ms in. The odd thing is that it will 'sometimes' work as in 1 in every 10+ regardless of the browser. I would much rather fix this so that it works instead of re-writing it as an ajax request. Any help is appreciated. Thanks in advance.

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • What is the proper way to declare a specialization of a template for another template type?

    - by Head Geek
    The usual definition for a specialization of a template function is something like this: class Foo { [...] }; namespace std { template<> void swap(Foo& left, Foo& right) { [...] } } // namespace std But how do you properly define the specialization when the type it's specialized on is itself a template? Here's what I've got: template <size_t Bits> class fixed { [...] }; namespace std { template<size_t Bits> void swap(fixed<Bits>& left, fixed<Bits>& right) { [...] } } // namespace std Is this the right way to declare swap? It's supposed to be a specialization of the template function std::swap, but I can't tell whether the compiler is seeing it as such, or whether it thinks that it's an overload of it or something.

    Read the article

  • How to have type hinting in PHP that specifies variable scope inside of a template? (specifically PhpStorm)

    - by Lance Rushing
    I'm looking for a doc comment that would define the scope/context of the current php template. (similar to @var) Example View Class: <?php class ExampleView { protected $pageTitle; public function __construct($title) { $this->pageTitle = $title; } public function render() { require_once 'template.php'; } } -- <?php // template.php /** @var $this ExampleView */ echo $this->pageTitle; PHPStorm gives an inspection error because the access on $pageTitle is protected. Is there a hint to give scope? Something like: <?php // template.php /** @scope ExampleView */ // <---???? /** @var $this ExampleView */ echo $this->pageTitle;

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

  • Javascript Canvas Element - Array Of Images

    - by Ben Shelock
    I'm just learning JS, trying to do things without jQuery, and I want to make something similar to this however I want to use an array of images instead of just the one. My image array is formed like this var image_array = new Array() image_array[0] = "image1.jpg" image_array[1] = "image2.jpg" And the canvas element is written like this. (Pretty much entirely taken from the Mozilla site) function draw() { var ctx = document.getElementById('canvas').getContext('2d'); var img = new Image(); img.src = 'sample.png'; img.onload = function(){ for (i=0;i<5;i++){ for (j=0;j<9;j++){ ctx.drawImage(img,j*126,i*126,126,126); } } } } It uses the image "sample.png" in that code but I want to change it to display an image from the array. Displaying a different one each time it loops. Apoligies if I've not explained this well.

    Read the article

  • [PHP] preg_replace: replacing using %

    - by Juan
    Hi all, I'm using the function preg_replace but I cannot figure out how to make it work, the function just doesn't seem to work for me. What I'm trying to do is to convert a string into a link if any word contains the % (percentage) character. For instance if I have the string "go to %mysite", I'd like to convert the mysite word into a link. I tried the following... $data = "go to %mysite"; $result = preg_replace('/(^|[\s\.\,\:\;]+)%([A-Za-z0-9]{1,64})/e', '\\1%<a href=#>\\2</a>', $data); ...but it doesn't work. Any help on this would be much appreciated. Thanks Juan

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • jQuery animation if load() returns something different...

    - by Dan LaManna
    setInterval(function() { var prevTopArticle = $("#toparticles table:first").html(); $("#toparticles").load("myurloffeed.com/topfeed", function() { alternateBG(); var newTopArticle = $("#toparticles table:first").html(); if (prevTopArticle!=newTopArticle) { $("#toparticles table:first").effect("highlight", {color:"#faffc4"}, 2000); } }); }, 8000); So it sets the current first table item to a variable, loads the toparticles div with the tables off the url, and if they are different it will perform the highlight effect, however it does the highlight effect anyway, completely unsure why it isn't working.

    Read the article

  • some confusions to singleton pattern in PHP

    - by SpawnCxy
    Hi all, In my team I've been told to write resource class like this style: class MemcacheService { private static $instance = null; private function __construct() { } public static function getInstance($fortest = false) { if (self::$instance == null) { self::$instance = new Memcached(); if ($fortest) { self::$instance->addServer(MEMTEST_HOST, MEMTEST_PORT); } else { self::$instance->addServer(MEM_HOST, MEM_PORT); } } return self::$instance; } } But I think in PHP resource handles will be released and initialized again every time after a request over. That means MemcacheService::getInstance() is totally equal new Memcached() which cannot be called singleton pattern at all. Please correct me if I'm wrong. Regards

    Read the article

  • Creating a program to find longest path

    - by stef89
    Hi everyone, I'm fairly new to programming and I'm having a few problems. Basically I have to make a function that will find the lengths of all the paths through a network diagram. I've been working on this for hours but I can't seem to get anywhere. Using recursion I can navigate through every path but I'm just unsure as to how I should record the lengths of the paths. Any help would be greatly appreciated. Thanks! $dependencies = array("","","","1","3","4,2"); $durations = array("5","3","4","11","9","10"); function tracePath($path,$dependencies,$durations,$returnArray=array()) { if($dependencies[$path] != "") { $currentTaskDependencies = preg_split("/[\s]*[,][\s]*/", $dependencies[$path]); for($i=0;$i<count($currentTaskDependencies);$i++) { tracePath($currentTaskDependencies[$i]-1,$dependencies,$durations,$returnArray[$i]); } } return $returnArray; } tracePath(6,$dependencies,$durations);

    Read the article

  • MooTools: How to use responseText directly

    - by Johny
    In following example of code, I want to traverse the responseText object which consist the html code came from request_page.php file. In onSuccess event, i want to check whether < Div with id 'ersDiv' has any errors posted in it. new Request.HTML({ url: 'request_page.php', onSuccess: function(responseText, responseXML) { // My expected code to handle responseText object alert(errorMessage); }, onFailure: function() { } }); request_page.php file is like this : <div align='center'><div id='ersDiv'>Page loaded with insufficient data</div></div>

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

< Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >