Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 639/972 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Opera bug with JS autoselecting text (if more than 1 div)

    - by E L
    Here is HTML code. It supposed to select all text in "Container" div <B onclick="SelectText(document.getElementById('Container'));">select all text</B> <Div id="Container"> <Div>123456</Div> <Div>123456</Div> <Div onclick="SelectText();">123456</Div> </Div> here is JS code of the SelectText() function function SelectText(target){ if(target==null){ var e = window.event || e; if (!e) var e = window.event; var target=e.target || e.srcElement; } var rng, sel; if ( document.createRange ) { rng = document.createRange(); rng.selectNode( target ); sel = window.getSelection(); sel.removeAllRanges(); sel.addRange( rng ); } else { var rng = document.body.createTextRange(); rng.moveToElementText( target ); rng.select(); } } Problem is that in Opera 12.02 when "select all text" is clicked, all text seems like selected, but it's not selected (I can't rightclick it and copy). (terrific, but IE works fine with it) Why not in Opera?!!! And what can I do to make Opera 12.02 believe that all text in "Container" is selected?

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Change URL of a saved HTML file

    - by Paul Camilleri
    I am new to HTML so this question might sound a bit lame. Anyways I have a saved webpage on my desktop that when i open it in google chrome i want it to show a specific URL instead of its current location. Any ideas how i might get this to work? I tried using the history.pushState but i have no idea why it is not working. I created a simple page for now to test it: <html> <head> <script> function setURL() { history.pushState("Test","page2", "www.test.com"); } </script> </head> <body> <button type="button" onclick="setURL()">Set Url</button> </body> </html> Any help would be greatly appreciated. Thank you

    Read the article

  • Best way to make sure I get all available options array/loop

    - by jaz872
    OK, here is my problem. I'm looking for the best way to loop through a bunch of options to make sure that I hit all available options. Some detail. I've created a feature that allows a client to build images that are basically other images layered on top of each other. These other images are split up into different groups. They have links on the side of the image that they can click to scroll through all the different images to view them. I'm now making an automated process that is going to run the function that changes the image when a user clicks one of the links. I need to make sure that every possible combo of the different images is hit during this process. So I have an array with the number of options for each group. The current array is [3, 9, 3, 3] My question is what is the best way to loop through this to make sure that all possible options will be shown? I apologize if this seems simple for someone out there, but I'm just having trouble wrapping my head around it. Hopefully if that person is out there, they can give a helping hand :)

    Read the article

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

  • Having an issue wit mouseup event

    - by user3680715
    Hello everyone I have this code working fine but I want the script to stop on the mouse up event. Here is an example of what I have now. How can I stop the script on mouse up event so that it looks like it only shows the coordinates when dragging over the image. Thank you! http://jsfiddle.net/Hc7x4/20/ $(document).ready(function () { $("#map-catcher").mousedown(function (e) { $("#map-catcher").mousemove(function (e) { $("#coord").text("x:"+e.offsetX+", y:"+e.offsetY); return; }); $("#map-catcher").mouseup(function (e) { return; }); }); });

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • How to hide URL from users when submitting this form?

    - by Camran
    I have a form with many many fields... When submitting these fields, I use the POST method which hides the actual variables passed along to the PHP page. However, I can't get rid of the complete link. Changing from GET to POST did make all the form fields invisible in the URL, but this part is still visible: mydomain.com/bin/query# I want it to be invisible, or say: mydomain.com/search I have mod_rewrite enabled so there is a possibility to do this with mod_rewrite I think, but I am new to mod_rewrite so I need your help... How should I hide this URL? If you need more input let me know...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • Load the <?php the_permalink(); ?> with an ajax loader

    - by fxg
    I´m working on a wordpress template. I´m trying to load the single.php of a post using ajax. I´m doing all the load thru a loader.js file that has this: // load single project page $("#project_slider").live("click", function(){ $("#content").hide(); $("#content").load("<?php the_permalink(); ?>", function(){ $(this).fadeIn("slow"); }); }); The problem is that I can´t just put on the .load because it doesn´t works. this is the markup: <div id="project_page" class="item"> <a href="#"> <img src="<?php the_field('artworks_thumbnail'); ?>" alt="" width="240" height="173"> </a> <div class="art_title"> <p>SWEET LIFE</p> </div> <div class="mask"></div> </div> How can I add the permalink via the loader.js?

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >