Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 637/972 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • How do I return a subset in jQuery plugin?

    - by wamp
    By default it's like this: $.fn.ellipsis = function() { ... return this.each(function(){ //do some operation on each element here to see if it qualifies } } But now I want to return a subset of all, only those qualify in this.each(function() {}), how to modify the code so that it finally returns only those that qualify?

    Read the article

  • How to add "Back to top" link at bottom at <div> is browser window is shorter than page, using jquer

    - by metal-gear-solid
    How to add "Back to top" link at bottom at is browser window is shorter than page, using jquery? <div id="mainContent"> <p>Some content</p> </div> If some content is bigger than browser window ( I mean if vertical bar comes on the page) then i want to add Back to top just before closing the div. <div id="mainContent"> <p>Some content</p> <p>Some content</p> <p>Some content</p> <a href="#"> Back to top </a> </div>

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Local variable vs parameter

    - by Dhana
    function doIt(param) { var localVar = param; //do lots of stuff with localVar } function doIt(param) { //do lots of stuff with param } Is there any difference in terms of efficiency between the code above?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to break a jquery variable dynamically based on condition

    - by Adi
    I have a jquery variable which has is showing the value in the console as .. ["INCOMING", 0, "INETCALL", 0, "ISD", 31.8, "LOCAL", 197.92, "STD", 73.2] Now as per my need i have to break these values and make it like this ["INCOMING", 0],["INETCALL", 0],["ISD", 31.8],["LOCAL", 197.92],["STD", 73.2] but these values i need to make in the required formate dynamically as this is received from database. Here is my ajax call to get the values from server side.. var dbdata=""; $(document).ready(function() { $.ajax({ type: 'GET', url: 'getPieChartdata', async:false, dataType: "text", success: function(data) { dbdata=JSON.parse(data); } }); console.log(dbdata); }); Please guys help me . Thanks in advance..

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • jQuery/Tablesorter: maintain secondary alphabetical sort

    - by user460847
    I have a table of names and ages that I want the user to be able to sort. When the page initally loads, sortList lists the rows in order from oldest to youngest, and then secondarily from A to Z. I want the same thing (a SECONDARY alphabetical sort) when the user actually clicks on the age <th>, but sortForce is making the alphabetical sort primary. Is there an alternative? $('#super_results table').tablesorter({ sortForce: [[0,0]], sortList: [[1,1],[0,0]] }); Or am I misunderstanding sortForce? Documentation here.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >