Search Results

Search found 24284 results on 972 pages for 'javascript intellisense'.

Page 637/972 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Is there a jQuery plugin for making a step-by-step type presentation?

    - by Earlz
    Hello, I was making a small thing in HTML and basically I have some "frames" like <div id="frame_1"> ... </div> <div id="frame_2"> ... </div> ... Basically what I want is for only one frame to be visible at one time and to navigate between frames easily with previous and next buttons (navigation by frame number a plus, but not required) Before I set out to write it myself I figured someone had already done it so has it been done?

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Pulling .live() functionality out of jQuery

    - by Daniel
    I am writing a Firefox Add-On that currently is depending on jQuery for the following things: Selectors Animations A special .live("focus") hail-mary event-catching maneuver that happens to work with jQuery 1.4.2 (but not 1.4.4) jQuery isn't well suited for functioning inside XUL, and it's a miracle we've gotten this far with it. We're trying to remove the jQuery requirements, the first two are easy (animations are simple, and we can use .querySelector() instead of jQuery), but the .live has proven impossible to do on our own. I've tried reading the source code, but I haven't been able to piece it apart. What is the jQuery .live function doing? There's clearly a lot more going on than document.addEventListener("focus"/"focusin",function_to_pick_apart_events). What else is going on here?

    Read the article

  • finding specific immediate children of an element using prototype

    - by tatilans
    Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

    Read the article

  • jQuery changing images with animation and waiting for it to trigger hyperlink

    - by user1476298
    I want to switch images on .click() using the url attr I can do so, but I can't figure out how to make it wait, until the animation is done to redirect to the new webpage. Here's the js $(function() { $('.cv').click(function(){ $("#cv img").fadeOut(2000, function() { $(this).load(function() { $(this).fadeIn(); }); $(this).attr("src", "images/cv2.png"); return true; }); }); }); Here's the html: <div id="cv" class="img one-third column"> <a class="cv" target="#" href="cv.joanlascano.com.ar"> <img src="images/cv1.png" alt="Curriculum"/> <br />CV</a> </div> Thank you in advantage!

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • My HTML5 web app crashes and I have no clue how to debug

    - by Shouvik
    Hi All, I have written a word game using HTML5 canvas tag and a little bit of audio. I developed the application on the chrome web browser on a linux system. Recently during the testing phase it was tried on safari 5.0.3 on Mac and the webpage froze. Not just the canvas element, but interactive element on the page froze. I have at some times experienced this problem on google chrome when I was developing but since the console did not throw any error before this happened, I did not give it much credence. Now as per requirements I am supposed to support both chrome and safari but this dismal performance on safari has left me shocked and I cannot see what error can be thrown which might lead to such a situation. Worse yet the CPU usage on using this application peaks to 70-80percent on my 2yr old macbook running ubuntu... I can only but pity the person who uses mac to operate this app, which undoubtedly is a heavier OS. Could someone help me out with a place I can start with to find out what exactly is causing this issue. I have run profiles on this webapp on google chromes console and noticed that in the heap spanshot value increases steadily with the playing of the game, specifically (root) value which jumps up by 900 counts. Any help would be very appreciated! Thanks EDIT: I don't know if this helps, but I have noticed that even on refreshing the page after the app becomes unresponsive the page reloads and I am still not able to interact with the page elements but the tab scroll bar continues to work and I can see my application window completely. So to summaries the tab stops accepting any sort of user interaction inside the page. Edit2: Nop. It doesn't work still... The app crashes on double click on the canvas element. The console is not throwing any errors either! =/ I have noticed this problem is isolated only to safari!

    Read the article

  • Prevent initial array from sorting

    - by George
    I have an array where the order of the objects is important for when I finally output the array in a document. However, I'm also sorting the array in a function to find the highest value. The problem is that I after I run the function to find the highest value, I can't get the original sort order of the array back. // html document var data = [75,300,150,500,200]; createGraph(data); // js document function createGraph(data) { var maxRange = getDataRange(data); // simpleEncode() = google encoding function for graph var dataSet = simpleEncode(data,maxRange); } function getDataRange(dataArray) { var num = dataArray.sort(sortNumber); return num[0]; } I've also tried setting data to dataA and dataB and using dataB in the getDataRange function and dataA in the simpleEncode function. Either way, data always end up being sorted from highest to lowest.

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • css to replace characters in paragraph tag

    - by Thariama
    Already checked exisitng questions for this, but didn't find an exact match. My aim is to replace characters (like spaces) on a webpage with a small image using css. Example: <p><span>This is a text</span></p> becomes: <p><span>ThisIMGisIMGaIMGtext</span></p> (where IMG stands for a visible image (middot-pic for a space f.e.)) I cannot think of a suitable css selector. But myabe one of you guys (or girls) know a solution. Is this possible at all?

    Read the article

  • jQuery - Why doesn't combining has() and gt() work in some cases?

    - by KatieK
    I wanted to select any ul which contains more than 3 lis. This code worked with the 1.2.6 jQuery library: $("ul:has(li:gt(2))") .each( function() { $(this).css("border", "solid red 1px"); }); But not 1.3.2 or 1.4.2. This code worked with the 1.4.2 jQuery library: $('ul').has('li:nth-child(3)').css('border', 'solid red 1px'); But not v1.2.6. Why does each version work with one library version, but not the other? Am I encountering some kind of bug, or am I doing something wrong? Any help understanding , or differences to be aware of between different versions of the jQuery libraries, would be much appreciated. Thanks!

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >