Search Results

Search found 7864 results on 315 pages for 'builder pattern'.

Page 64/315 | < Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How do I hide an inherited __published property in the derived class in a VCL component?

    - by Gary Benade
    I have created a new VCL component based on an existing VCL component. What I want to do now is set the Password and Username properties from an ini file instead of the property inspector. Robert Dunn Link I read on the delphi forum above you cannot unpublish a property and that the only workaround is to redeclare the property as read-only. I tried this but it all it does is make the property read only and grayed out in the object inspector. While this could work I would prefer if the property wasn't visible at all. __property System::UnicodeString Password = {read=FPassword}; Thanks in advance for any help or links to c++ VCL component writing tutorials. I am using CB2010

    Read the article

  • Can NSCollectionView autoresize the width of its subviews to display one column

    - by littlecharva
    Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Get text of button from IBAction - iPhone

    - by Organiccat
    When an IBAction is called: -(IBAction) onClick1: (id) sender; What is passed in the sender? Since it's hooked up through the IB, I'm not really sure. My question is how to get the text of the button to be the passed object (NSString most likely) so that I could call it inside the action implementation. -(IBAction) onClick1: (id) sender { NSLog(@"User clicked %@", sender); // Do something here with the variable 'sender' }

    Read the article

  • NSButton argument binding doesn't pass argument?

    - by Jeff
    I have a NSCollectionView with a NSButton in the collection view item. The xib's owner is set to my BatchListViewController and the controller has the method @interface BatchListViewController : NSViewController -(IBAction)another_click; @end I set the binding for target to be: This works fine but I also want to send the underlying model to the another_click method. According to the Apple docs, The objects specified in the argument bindings are passed as parameters to the selector specified in the target binding when the NSButton is clicked. So I set the binding for argument to be: This runs fine if I keep the selector method's signature the same another_click: but if I change it to -(IBAction)another_click:(id)arg; I get the dreaded error: BatchListViewController another_click]: unrecognized selector sent to instance What am I doing wrong? Apple's docs say this is possible but I haven't been able to find an example of this working. Even other SO threads are saying this isn't possible but that can't be right.

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Custom view with nib as subview doesn't seem to be loading

    - by Ben Collins
    I've created a custom view that loads its content from a nib, like this: /* PricingDataView.h */ #import <UIKit/UIKIt.h> @interface PricingDataView : UIView { UIView *contentView; } @property (nonatomic, retain) IBOutlet UIView *contentView; @end /* PricingDataView.m */ #import "PricingDataView.h" @implementation PricingDataView @synthesize contentView; - (id)initWithFrame:(CGRect)frame { if ((self = [super initWithFrame:frame])) { [[NSBundle mainBundle] loadNibNamed:@"PricingDataView" owner:self options:nil]; [contentView setFrame:frame]; [self addSubview:contentView]; } return self; } /* ... */ In the nib file I set PricingDataView as the type of the File's Owner, and connected the contentView outlet in IB. I placed a regular UIView from the Interface Library onto the full-sized view shown to the user, and then changed it's class name to PricingDataView. It all builds, but at runtime, nothing is rendered where my custom view is supposed to be. I put breakpoints in PricingDataView.initWithFrame, but they don't hit, so I know I'm missing something that would cause the view to be initialized. What I'm curious about is that int the process of loading my other views from nibs, all the initialization happens for me, but not with this one. Why?

    Read the article

  • Remove clear button (grey x) to the right of UISearchBar when cancel button tapped

    - by David Foster
    Right, to begin my question, here's some screenies of the problem already solved by the Spotify app: Spotify's Step 1: Standard UISearchBar not in editing mode. Spotify's Step 2: UISearchBar now in editing mode. Search term entered. Cancel button slides in from the right, and the clear button (grey x) appears. Spotify's Step 3: Cancel button pressed; keyboard slides out and the search bar is no longer in editing mode. Search term remains and the grey x button is now hidden. At present, the following code fires off when my cancel button is pressed: - (void)searchBarCancelButtonClicked:(UISearchBar *)searchBar { [searchBar resignFirstResponder]; [searchBar setShowsCancelButton:NO animated:YES]; } Which results in: My Step 3: Search bar now not in editing mode. Cancel button and keyboard has slid out. Search term remains but so does the grey x. So, my question is this: given that -resignFirstResponder (and -endEditing:, FYI) does not hide the grey x button when a search bar has had text entered into it, how does one hide it? Thanks again, friends.

    Read the article

  • Flex 4: StyleManager.getStyleManager()

    - by alexey
    I'm trying to compile existing Flex 4 project but having an error: Call to underfined method getStyleManager of StyleManager class. The code is: var styleManager:IStyleManager2 = StyleManager.getStyleManager(null); I found the method in Flex documentation but when I open StyleManager.as I can't find the method declaration. Used Flex SDK 4.0.0.10485 from here.

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Building a complex view with Three20 - resources?

    - by psychotik
    I'm using three20 for most of my iPhone app. One of the views I need to create is relatively complex. It needs a top bar (under the nav bar) with some controls and label, an image view below this bar (which occupies most of the body) and another bottom bar with more controls and labels (above the tab bar control). I don't have much UI experience - my only experience with anything UI is laying stuff out using CSS, etc on websites. Apple's online doc seems to assume that the reader knows a bunch about rectangles, layouts, frames, etc or is using InterfaceBuilder. And three20 isn't too well documented either. So my question is: Is it possible to design something like what I describe in IB and then still have a three20-based app use it? If so, any tips/pointers on how would be much appreciated. Can you point me to some documentation that explain how views/controls etc are rendered. I'm pretty sure I can figure it out if I find some decent explanation/tutorial for it.

    Read the article

  • VCL/Delphi/BCB - which IDE/language should I use?

    - by mawg
    I bought Delphi 1 when it came out - and was hooked. When BCB came out (around D3, iirc), I switched, mainly because I have used C/C++ professionally for a few decades. I have "been away" for 7 or 8 years and am now returning. I still have BCB 6 & Delphi 7 (not to mention Kylix). I always felt more comfortable with C++ than Pascal - purely because of work-day familiarity. But, realistically, iirc, most 3rd party VCL components are coded in Delphi/Pascal. And I think I used to have problems debugging Delphi components from BCB, but I could well remember wrongly. Anyhoo, now I am back and intend to use VCL components / hack the code of same / debug them & code a few of my own. Given that I am slightly more comfortable with C++, is there any compelling reason to choose Delphi over BCB, or is this just a case of how long my particular piece of string is?

    Read the article

  • UILabel applying CGAffineTransformMakeRotation causing mysterious crash

    - by quantumpotato
    In -(id)initWithNibName:(NSString *)nibNameOrNil bundle:(NSBundle *)nibBundleOrNil parentController:(GameViewController *)myGameController{ Have a series of transforming labels like so: deg90 = 1.570796326794897; //....transforms background.center = CGPointMake(160,230); background.transform = CGAffineTransformMakeRotation(deg90); BetLabel.text = @"test"; BetLabel.transform = CGAffineTransformMakeRotation(deg90); That last line is crashing me with: 2010-04-13 21:04:47.858 Game[1204:207] * Terminating app due to uncaught exception 'NSRangeException', reason: '* -[NSCFArray objectAtIndex:]: index (1) beyond bounds (1)' 2010-04-13 21:04:47.893 Game[1204:207] Stack: ( 864992541, 859229716, (lots of numbers) But if I comment it out, I get the text changing fine. Uh oh, just did a test.. turns out the other transforms were on UIImageViews. Apparently rotating a label in this xib is causing the crash. But in another file the transforms are working fine: newprofileentry.transform = CGAffineTransformMakeRotation(1.570796326794897); playerb0.transform = CGAffineTransformMakeRotation(1.570796326794897); playerb1.transform = CGAffineTransformMakeRotation(1.570796326794897); Tried substituting deg90 with the full float value, still the same crash. Tried cleaning cache, restarting IB and Xcode, cleaning all targets. Program has been running fine until I just added these labels. Tried deleting the label, readding and reconnecting the Outlet, too. Thanks for reading, hope someone has an idea about this. Cheers!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • Can't create flex4 project in flexbuilder using remoting or LiveCycle Data Servcies ES

    - by anopres
    I'm trying out the FlasBuilder ide with ColdFusion 8 on OS X. When I try to create a new project, I get stuck at the server setup screen that forces you to validate your paths for your ColdFusion root folder and your webroot. Every combination I try says either "LiveCycle Data Services is not installed at the specified location" or "Invalid root. The WEB-INF/flex folder must contain either flex-config.xml or services-config.xml." The flex-config.xml file is sitting in that directory. Is there some trick to getting this to work?

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • Changing drag cursor in VirtualTreeView

    - by Coder12345
    When using VirtualTreeView drag operation by default is [doCopy,doMove]. Move operation is indicated by arrow pointer with small box and Copy operation is indicated by same pointer icon but with added [+] next to it. By default VT uses copy operation and if you press modifier key (SHIFT key) it modifies operation to move therefore removing the [+] from pointer. Here is what I need: reverse the operations (default would be move, with modifier key pressed - copy) and thus reverse pointer arrow too replace modifier key - CTRL instead of SHIFT read in an event which of the two operations occurred and start copy or move operation Any pointers into right direction(s) appreciated.

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

< Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >