Search Results

Search found 11438 results on 458 pages for 'self imposed homework'.

Page 64/458 | < Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >

  • Incorrect logic flow? function that gets coordinates for a sudoku game

    - by igor
    This function of mine keeps on failing an autograder, I am trying to figure out if there is a problem with its logic flow? Any thoughts? Basically, if the row is wrong, "invalid row" should be printed, and clearInput(); called, and return false. When y is wrong, "invalid column" printed, and clearInput(); called and return false. When both are wrong, only "invalid row" is to be printed (and still clearInput and return false. Obviously when row and y are correct, print no error and return true. My function gets through most of the test cases, but fails towards the end, I'm a little lost as to why. bool getCoords(int & x, int & y) { char row; bool noError=true; cin>>row>>y; row=toupper(row); if(row>='A' && row<='I' && isalpha(row) && y>=1 && y<=9) { x=row-'A'; y=y-1; return true; } else if(!(row>='A' && row<='I')) { cout<<"Invalid row"<<endl; noError=false; clearInput(); return false; } else { if(noError) { cout<<"Invalid column"<<endl; } clearInput(); return false; } }

    Read the article

  • how to return a list using SwingWorker

    - by Ender
    I have an assignment where i have to create an Image Gallery which uses a SwingWorker to load the images froma a file, once the image is load you can flip threw the image and have a slideshow play. I am having trouble getting the list of loaded images using SwingWorker. This is what happens in the background it just publishes the results to a TextArea // In a thread @Override public List<Image> doInBackground() { List<Image> images = new ArrayList<Image>(); for (File filename : filenames) { try { //File file = new File(filename); System.out.println("Attempting to add: " + filename.getAbsolutePath()); images.add(ImageIO.read(filename)); publish("Loaded " + filename); System.out.println("Added file" + filename.getAbsolutePath()); } catch (IOException ioe) { publish("Error loading " + filename); } } return images; } } when it is done I just insert the images in a List<Image> and that is all it does. // In the EDT @Override protected void done() { try { for (Image image : get()) { list.add(image); } } catch (Exception e) { } } Also I created an method that returns the list called getImages() what I need to get is the list from getImages() but doesn't seam to work when I call execute() for example MySwingWorkerClass swingworker = new MySwingWorkerClass(log,list,filenames); swingworker.execute(); imageList = swingworker.getImage() Once it reaches the imageList it doesn't return anything the only way I was able to get the list was when i used the run() instead of the execute() is there another way to get the list or is the run() method the only way?. or perhaps i am not understanding the Swing Worker Class.

    Read the article

  • Pseudo Transparant images

    - by Samuel
    Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

    Read the article

  • Vector insert() causes program to crash

    - by wrongusername
    This is the first part of a function I have that's causing my program to crash: vector<Student> sortGPA(vector<Student> student) { vector<Student> sorted; Student test = student[0]; cout << "here\n"; sorted.insert(student.begin(), student[0]); cout << "it failed.\n"; ... It crashes right at the sorted part because I can see "here" on the screen but not "it failed." The following error message comes up: Debug Assertion Failed! (a long path here...) Expression: vector emplace iterator outside range For more information on how your program can cause an assertion failure, see the Visual C++ documentation on asserts. I'm not sure what's causing the problem now, since I have a similar line of code elsewhere student.insert(student.begin() + position(temp, student), temp); that does not crash (where position returns an int and temp is another declaration of a struct Student). What can I do to resolve the problem, and how is the first insert different from the second one?

    Read the article

  • Check if there are any repeated elements in an array recursively

    - by devoured elysium
    I have to find recursively if there is any repeated element in an integer array v. The method must have the following signature: boolean hasRepeatedElements(int[] v) I can't see any way of doing that recursively without having to define another method or at least another overload to this method (one that takes for example the element to go after or something). At first I thought about checking for the current v if there is some element equal to the first element, then creating a new array with L-1 elements etc but that seems rather inefficient. Is it the only way? Am I missing here something?

    Read the article

  • Initialize a Variable Again.

    - by SoulBeaver
    That may sound a little confusing. Basically, I have a function CCard newCard() { /* Used to store the string variables intermittantly */ std::stringstream ssPIN, ssBN; int picker1, picker2; int pin, bankNum; /* Choose 5 random variables, store them in stream */ for( int loop = 0; loop < 5; ++loop ) { picker1 = rand() % 8 + 1; picker2 = rand() % 8 + 1; ssPIN << picker1; ssBN << picker2; } /* Convert them */ ssPIN >> pin; ssBN >> bankNum; CCard card( pin, bankNum ); return card; } that creates a new CCard variable and returns it to the caller CCard card = newCard(); My teacher advised me that doing this is a violation of OOP principles and has to be put in the class. He told me to use this method as a constructor. Which I did: CCard::CCard() { m_Sperre = false; m_Guthaben = rand() % 1000; /* Work */ /* Convert them */ ssPIN >> m_Geheimzahl; ssBN >> m_Nummer; } All variables with m_ are member variables. However, the constructor works when I initialize the card normally CCard card(); at the start of the program. However, I also have a function, that is supposed to create a new card and return it to the user, this function is now broken. The original command: card = newCard(); isn't available anymore, and card = new CCard(); doesn't work. What other options do I have? I have a feeling using the constructor won't work, and that I probably should just create a class method newCard, but I want to see if it is somehow at all possible to do it the way the teacher wanted. This is creating a lot of headaches for me. I told the teacher that this is a stupid idea and not everything has to be classed in OOP. He has since told me that Java or C# don't allow code outside of classes, which sounds a little incredible. Not sure that you can do this in C++, especially when templated functions exist, or generic algorithms. Is it true that this would be bad code for OOP in C++ if I didn't force it into a class?

    Read the article

  • Interview question: How do I detect a loop in this linked list?

    - by jjujuma
    Say you have a linked list structure in Java. It's made up of Nodes: class Node { Node next; // some user data } and each Node points to the next node, except for the last Node, which has null for next. Say there is a possibility that the list can contain a loop - i.e. the final Node, instead of having a null, has a reference to one of the nodes in the list which came before it. What's the best way of writing boolean hasLoop(Node first) which would return true if the given Node is the first of a list with a loop, and false otherwise? How could you write so that it takes a constant amount of space and a reasonable amount of time? Here's a picture of what a list with a loop looks like: Node->Node->Node->Node->Node->Node--\ \ | ----------------

    Read the article

  • Calculate Age, Given Date of Birth

    - by bond
    Given a date of birth, how would I go about calculating an age in C? For example, if today's date is 20/04/2010 and the date of birth given is 12/08/86, then age will be 23 years, 8 months, and 8 days. Any suggestions would be appreciated. Thanks!

    Read the article

  • SQL Query with computed column

    - by plotnick
    help me please with a query. Assume that we have a table with columns: Transaction StartTime EndTime Now, I need a query with computed column of (value = EndTime-Startime). Actually I need to group Users(Transaction has a FK for Users) and sort them by average time spent for transaction.

    Read the article

  • Help me find some good 'Reflection' reading materials??

    - by IbrarMumtaz
    If it wasn't you guys I would've never discovered Albahari.com's free threading ebook. My apologies if I come off as being extremely lazy but I need to make efficient use of my time and make sure am not just swallowing any garbage of the web. Therefore I am looking for the best and most informative and with a fair bit of detail for the Reflection chapter in .Net. Reflection is something that comes up time and time again and I want to extend my reading from what I know already from the official 70-536 book. I'm not a big fan of MSDN but at the moment that's al I'm using. Anyone got any other good published reading material off the inter web that can help revision for the entrance exam??? Would be greatly appreciated !!! Thanks in Advance, Ibrar

    Read the article

  • mv() while reading

    - by K'
    on Linux ext3 filesystem, what happens if mv() is called on the same file (file descriptor) while reading the file? It is actually an exam question and I can only say something like: CPU traps OS for interrupt handling etc, etc. I would appreciate if OS guys out there can help me out, please :D

    Read the article

  • Perl : how to interrupt/resume loop by user hitting a key?

    - by Michael Mao
    Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

    Read the article

  • Losing data after reading them correct from file

    - by user1388172
    i have the fallowing class of object with a class a data structure which i use in main combined. The ADT(abstract data type) is a linked list. After i read from file the input data and create and object which at print looks just fine after a print. after i push_back() the 3-rd int variable get initializated to 0. So example and code: Example: ex.in: 1 7 31 2 2 2 3 3 3 now i create objects from each line, which at print look as they suppose, but after push_back(): 1 7 0 2 2 0 3 3 0 Class.h: class RAngle { private: int x,y,l,b; public: int solution,prec; RAngle(){ x = y = solution = prec = b = l =0; } RAngle(int i,int j,int k){ x = i; y = j; l = k; solution = 0; prec=0; b=0; } friend ostream& operator << (ostream& out, const RAngle& ra){ out << ra.x << " " << ra.y << " " << ra.l <<endl; return out; } friend istream& operator >>( istream& is, RAngle& ra){ is >> ra.x; is >> ra.y; is >> ra.l; return is ; } }; ADT.h: template <class T> class List { private: struct Elem { T data; Elem* next; }; Elem* first; T pop_front(){ if (first!=NULL) { T aux = first->data; first = first->next; return aux; } T a; return a; } void push_back(T data){ Elem *n = new Elem; n->data = data; n->next = NULL; if (first == NULL) { first = n; return ; } Elem *current; for(current=first;current->next != NULL;current=current->next); current->next = n; } Main.cpp(after i call this function in main which prints object as they suppose to be the x var(from RAngle class) changes to 0 in all cases.) void readData(List <RAngle> &l){ RAngle r; ifstream f_in; f_in.open("ex.in",ios::in); for(int i=0;i<10;++i){ f_in >> r; cout << r; l.push_back(r); }

    Read the article

  • calling a function from another function in python

    - by user1040503
    I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

    Read the article

  • Programming help Loop adding

    - by Deonna
    I know this probably really simple but Im not sure what im doing wrong... The assignment states: For the second program for this lab, you are to have the user enter an integer value in the range of 10 to 50. You are to verify that the user enters a value in that range, and continue to prompt him until he does give you a value in that range. After the user has successfully entered a value in that range, you are to display the sum of all the integers from 1 to the value entered. I have this so far: #include <iostream.h> int main () { int num, sum; cout << "do-while Loop Example 2" << endl << endl; do { cout << "Enter a value from 10 to 50: "; cin >> num; if (num < 10 || num > 50) cout << "Out of range; Please try again..." << endl; } while (num < 10 || num > 50); { int i; int sum = 0; for (num = 1; num <= 50; num ++) sum = sum + num; } cout << endl << "The sum is " << sum << endl; return 0; } Im just not sure exactly what i'm doing wrong... I keep getting the wrong sum for the total...

    Read the article

  • What is the 'order' of a perceptron

    - by Martin
    A few simple marks for those who know the answer. I'm doing revision for exams at the moment and one of the past questions is: What is meant by the order of a perceptron? I can't find any information about this in my lecture notes, and even google seems at a loss. My guess is that the order is the number of layers in a neural network, but this doesn't seem quite right.

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • Which database I can used and relationship in it ??

    - by mimo-hamad
    My projece make me confused which I didn't find clear things that make me understand the required database and the relationships in it So, would a super one help me to solve it ?!! ;D this is required: 1) Model the data stored in the database (Identify the entities, roles, relationships, constraints, etc.) 2) Write the Oracle commands to create the database, find appropriate data, and populate the database 3) Write five different queries on your database, using the SELECT/FROM/WHERE construct provided in SQL. Your five queries should illustrate several different aspects of database querying, such as: a. Queries over more than one relation (by listing more than one relation in the FROM clause) b. Queries involving aggregate functions, such as SUM, COUNT, and AVG c. Queries involving complicated selects and joins d. Queries involving GROUP BY, HAVING or other similar functions. e. Queries that require the use of the DISTINCT keyword. And this the condition that we need to determine it to solve the required Q's above : 5) It is desired to develop an Internet membership club to buy products at special prices online. To join, new members must be referred by another existing member of the club. The system will keep the following information for each member: The member ID, referring member, birth date, member name, address, phone, mobile, credit card type, number and expiration date. The items are always shipped to the member's address noted in the membership application. The shipping fees will differ for each order.For each item to be requested, the member will select an item from a long list of possible items. For each item in the database, we store an item ID, an item name, description, and list price. The list price will be different from the actual sale price. The available quantity and the back-ordered quantity (the back-ordered quantity is the quantity on-order by the club from its suppliers) is also noted

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • BFS algorithm problem

    - by Gorkamorka
    The problem is as follows: A wanderer begins on the grid coordinates (x,y) and wants to reach the coordinates (0,0). From every gridpoint, the wanderer can go 8 steps north OR 3 steps south OR 5 steps east OR 6 steps west (8N/3S/5E/6W). How can I find the shortest route from (X,Y) to (0,0) using breadth-first search? Clarifications: Unlimited grid Negative coordinates are allowed A queue (linked list or array) must be used No obstacles present

    Read the article

  • Find if there is an element repeating itself n/k times

    - by gleb-pendler
    You have an array size n and a constant k (whatever) You can assume the the array is of int type (although it could be of any type) Describe an algorithm that finds if there is an element(s) that repeats itself at least n/k times... if there is return one. Do so in linear time (O(n)) The catch: do this algorithm (or even pseudo-code) using constant memory and running over the array only twice

    Read the article

  • C++ How do I properly use getline for ifstream members.

    - by John
    Ok so I have a problem with getline. I have a file that contains a couple strings. I created it by myself and I have each string on a seperate line. Ex. textfile.txt Line 1 Line 2 Line 3 Line 4 //Little snip of code ifstream inFile("textfile.txt"); getline(inFile, string1); When I debug the program and ask it to print out string1 it shows that "Line 1\r" is saved into string1. I understand that it's from me actually hitting enter when I created the file. This problem causes my program to have a segmentation fault. I know my code works because if I use ofstream to write the file first and then i read it in, it works. So for my quesiton, is their anyway to use the getline function without it picking up the escape sequence \r? If i am not clear just let me know.

    Read the article

  • Recursive function for a binary search in C++

    - by boomsnack
    Create a recursive function for the binary search. This function accepts a sorted array and a give item being search for and returns the index of the item if this give item in the array or returns -1 if this give item is not in the array. Moreover, write a test program to test your function. Sorry for the bad english but my teacher can not write it or speak it very well. This is for a final project and determines whether I graduate or not I went to the tutor and he did not know how to do it either. Any help is greatly appreicated.

    Read the article

  • how to demonstrate that a protocol is certain with those specifications.

    - by kawtousse
    Hi every one, we have 4 persons A, B, C and D witch want to know the averge of their salary SA SB SC SD but no one wants that the others know his salary. For that they use this protocol: A-B: [N+SA ]KB B-C:[N+SA+SB]KC C-D:[N+SA+SB+SC]KD D-A:[N+SA+SB+SC+SD]KA where the notation [m]KY represents the message x crypted xith the public key of y Is this protocol certain. can we trust it. want you please give me justification. thanks for help.

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

< Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >