Search Results

Search found 29753 results on 1191 pages for 'best practices'.

Page 644/1191 | < Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >

  • img captions based on src value match

    - by Basho
    I am trying t o create img captions based on src value match. JQUERY : What is the best way to extract "Author-ABC" from an img with src value wwww.abcd.com/images/imagename_Author-ABC_.jpg and replace the alt value with this value. DRUPAL : Is there a way to preprocess this a drupal template function and save the value in img alt attribute? Ideas? Basho

    Read the article

  • Redis - which PHP module to use?

    - by Patrick
    If i check redis php supported language (http://code.google.com/p/redis/wiki/SupportedLanguages), there's 4 PHP ones: Redis PHP Bindings,phpredis,Predis,Redisent. Question is, which is the best and good to use? Thanks!

    Read the article

  • Distinguish between single and double click events in Qt

    - by Jesse
    I have a QAbstractItemView that needs to react to single and double click events. The actions are different depending on whether it was single clicked or double clicked. The problem that is occurring is that the single click event is received prior to the double click event. Is there a recommended way/best practice for distinguishing between the two? I don't want to perform the single click action when the user has actually double clicked. I am using Qt 4.6

    Read the article

  • Browser Detection

    - by Jrgns
    What's the best / simplest / most accurate way to detect the browser of a user? Ease of extendability and implementation is a plus. The less technologies used, the better. The solution can be server side, client side, or both. The results should eventually end up at the server, though. The solution can be framework agnostic. The solution will only be used for reporting purposes.

    Read the article

  • Proper two-level iPad UITableView

    - by Knodel
    I have an iPad app with split view. In the root view I need to make a two-level UITableView, so the UIWebView in the DetailView shows corresponding content. What I need is to make a two-level UITableView without editing, moving etc, so it can send the name of the selected row in the second level of the table to the DetailViewController. What is the best way to do it? Thanks in advance!

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • How to read using C++ (C#) sound stream sent by flash?

    - by Oleg
    Hello. I need to read sound stream sent by flash audio in my C++ application (C++ is not a real limitation, it may be C# or any other desktop language). Now flash app sends audio to another flash app but I need to receive the same audio by desktop application. So, is there a standard or best way how to do it? Thank you for your answers.

    Read the article

  • Ipad - Display thumbnail from video

    - by ludo
    Hi, I have a video store in my bundle, how can I display a thumbnail of it with the new Media Player Framework from the Ipad (thumbnail + the white play button on it), I can also store my video online it will be better. Someone have an idea? best Regards,

    Read the article

  • How to secure the communication between an MSSQL database and a c# administrative tool?

    - by citronas
    How can I secure the communication between a C# programm running locally on my computer and a MSSQL Server in a hosted environment? I have an asp.net application that is secured by SSL encryption. So using the asp.net from an open wlan connection is no problem. How can I achieve the same kind of encryption for my administrative tool? Would it be best to write a service? But how would that connection to the service be secured?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • showcase website in album

    - by proyb2
    What is the best gallery to showcase web design you have came across? Plan to get various creative agencies to showcase their works on an advertisement platform so that new user will be able to see various portfolio. When it come to select a suitable album, I am indecisive if it too plain (Load and display) or too flashy (coverflow album), which album/gallery script do you recommend for our corporate theme? I would prefer background to be white.

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Create a custom menu for BlackBerry

    - by Dachmt
    Hi I'm a beginner in BlackBerry programming, I need to replace in my application the default menu (when you press the menu button) by a custom menu, horizontal. The best to describe is I want the same result as the WeatherEye application for BlackBerry... I know how to create the default menu, but this one I have no idea! Thank you,

    Read the article

  • Ruby 1.9 and Rackspace's email api (SOAP)

    - by kjs3
    Is anyone out there working with SOAP on Ruby 1.9? Rackspace has email addresses for $2/month and an api to programmatically create/destroy accounts which looks like the best I've found. Fusemail has $2 addresses too but you need a minimum of 80 to get access to the api. So, I either need to find a solution to working with Rackspace or a different email host.

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Rearrange items in ListBox

    - by superexsl
    Hey, I have a ListBox with a number of ListBoxItem objects. What is the best way to allow users to rearrange the items by dragging and dropping? Do I have to use StackPanels instead? Thanks for any suggestions

    Read the article

  • Percent of internet running Google Native Client?

    - by anon
    Anyone have numbers on how many machines / % of internet uses have Google Native Client? I'm curious about google NaCL as a platform: it seems to combine the best of the web (just a webpage, accessible on any machine) and desktop apps (OpenGL, C/C++ power). The only question is -- what percent of the world actually use it. Anyone have data on this? Thanks!

    Read the article

  • Is there a good J2ME IDE?

    - by William
    Is there a good J2ME IDE? I mean something lightweight, and portable. Something that can run what you program on it. My favorite Java IDE is JCreator Lite. Is there something like that for J2ME? Also, which would you say is the best J2ME IDE?

    Read the article

  • Programmatically add an application to Windows Firewall

    - by RichieACC
    I have an application that is installed and updated via ClickOnce. The application downloads files via FTP, and therefore needs to be added as an exception to the windows firewall. Because of the way that ClickOnce works, the path to the EXE changes with every update, so the exception needs to change also. What would be the best way to have the changes made to the firewall so that it's invisible to the end user? (The application is written in C#)

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Undo/Redo using Memento: Stack, Queue or just LinkedList?

    - by serhio
    What is the best having when implementing Memento pattern (for Undo/Redo) in witch collection to Keep Mementos? Basically, I need this(c = change, u = undo, r = redo): 0 *c -1 0 *c -2 -1 0 *c -3 -2 -1 0 <u -2 -1 0 1 *c -3 -2 -1 0 Variants: LinkedList - possible in principle, maybe not optimized. Queue - not adapted for this task, IMO. Stack - not adapted for undo AND redo; Double Stack - maybe optimal, but can't control the undo maximum size.

    Read the article

< Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >