Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 650/776 | < Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >

• CSS: 100% of container height without modifying the container

  - by Rena

  Yeah, this ugly question again. I'm writing some HTML that gets inserted into a page. I have no control over the rest of the page. The structure is something like: <table <tr <td rowspan="2"left column</td <td height="1"top row above content</td </tr <tr<td height="220"my content here</td</tr </table I can write whatever I want into that table cell (including style tags to pack in my CSS), but I can't touch anything outside of it, which means I can't set the height of any parent element (including html and body), add a doctype (it has none), etc - that already kills just about every solution I can find (all seem to be "add a doctype" and/or "give the parent container a fixed height"). What I want to do is simply have a <div fill the entire cell. Width is no problem but unsurprisingly height is being a massive pain. Writing "height: 100%" doesn't do anything unless the container has a fixed height (the height="220" attribute apparently doesn't count) or the div uses absolute positioning - and then it seems to want to use 100% of the window's height (and width even) instead of the cell's. The root of the problem is the left column varies in height, as does the content, and when the left column cell is larger than the content, it won't expand to fill the cell it's in. If I set a fixed height for the content, it'll be much larger than necessary most of the time, and if I don't, it doesn't take up all of the cell and leaves an ugly gap at the bottom.

  Read the article

• KSH: Variables containing double quotes

  - by nitrobass24

  I have a string called STRING1 that could contain double quotes. I am echoing the string through sed to pull out puntuation then sending to array to count certain words. The problem is I cannot echo variables through double quotes to sed. I am crawling our filesystems looking for files that use FTP commands. I grep each file for "FTP" STRING1=`grep -i ftp $filename` If you echo $STRING1 this is the output (just one example) myserver> echo "Your file `basename $1` is too large to e-mail. You must ftp the file to BMC tech support. \c" echo "Then, ftp it to ftp.bmc.com with the user name 'anonymous.' \c" echo "When the ftp is successful, notify technical support by phone (800-537-1813) or by e-mail ([email protected].)" Then I have this code STRING2=`echo $STRING1|sed 's/[^a-zA-Z0-9]/ /g'` I have tried double quoting $STRING1 like STRING2=`echo "$STRING1"|sed 's/[^a-zA-Z0-9]/ /g'` But that does not work. Single Qoutes, just sends $STRING1 as the string to sed...so that did not work. What else can I do here?

  Read the article

• Can't add/remove items from a collection while foreach is iterating over it

  - by flockofcode

  If I make my own implementation of IEnumerator interface, then I am able ( inside foreach statement )to add or remove items from a albumsList without generating an exception.But if foreach statement uses IEnumerator supplied by albumsList, then trying to add/delete ( inside the foreach )items from albumsList will result in exception: class Program { static void Main(string[] args) { string[] rockAlbums = { "rock", "roll", "rain dogs" }; ArrayList albumsList = new ArrayList(rockAlbums); AlbumsCollection ac = new AlbumsCollection(albumsList); foreach (string item in ac) { Console.WriteLine(item); albumsList.Remove(item); //works } foreach (string item in albumsList) { albumsList.Remove(item); //exception } } class MyEnumerator : IEnumerator { ArrayList table; int _current = -1; public Object Current { get { return table[_current]; } } public bool MoveNext() { if (_current + 1 < table.Count) { _current++; return true; } else return false; } public void Reset() { _current = -1; } public MyEnumerator(ArrayList albums) { this.table = albums; } } class AlbumsCollection : IEnumerable { public ArrayList albums; public IEnumerator GetEnumerator() { return new MyEnumerator(this.albums); } public AlbumsCollection(ArrayList albums) { this.albums = albums; } } } a) I assume code that throws exception ( when using IEnumerator implementation A supplied by albumsList ) is located inside A? b) If I want to be able to add/remove items from a collection ( while foreach is iterating over it), will I always need to provide my own implementation of IEnumerator interface, or can albumsList be set to allow adding/removing items? thank you

  Read the article

• PHP Function parameters - problem with var not being set

  - by Marty

  So I am obviously not a very good programmer. I have written this small function: function dispAdjuggler($atts) { extract(shortcode_atts(array( 'slot' => '' ), $atts)); $adspot = ''; $adtype = ''; // Get blog # we're on global $blog_id; switch ($blog_id) { case 1: // root blog HOME page if (is_home()) { switch ($slot) { case 'top_leaderboard': $adspot = '855525'; $adtype = '608934'; break; case 'right_halfpage': $adspot = '855216'; $adtype = '855220'; break; case 'right_med-rectangle': $adspot = '858222'; $adtype = '613526'; break; default: throw new Exception("Ad slot is not defined"); break; } When I reference the function on a page like so: <?php dispAdjuggler("top_leaderboard"); ?> The switch is throwing the default exception. What am I doing wrong here? Thanks!!

  Read the article

• A little confused about MVC and where to put a database query

  - by jax

  OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

  Read the article

• Multiple generic types in one container

  - by Lirik

  I was looking at the answer of this question regarding multiple generic types in one container and I can't really get it to work: the properties of the Metadata class are not visible, since the abstract class doesn't have them. Here is a slightly modified version of the code in the original question: public abstract class Metadata { } public class Metadata<T> : Metadata { // ... some other meta data public T Function{ get; set; } } List<Metadata> metadataObjects; metadataObjects.Add(new Metadata<Func<double,double>>()); metadataObjects.Add(new Metadata<Func<int,double>>()); metadataObjects.Add(new Metadata<Func<double,int>>()); foreach( Metadata md in metadataObjects) { var tmp = md.Function; // <-- Error: does not contain a definition for Function } The exact error is: error CS1061: 'Metadata' does not contain a definition for 'Function' and no extension method 'Function' accepting a first argument of type 'Metadata' could be found (are you missing a using directive or an assembly reference?) I believe it's because the abstract class does not define the property Function, thus the whole effort is completely useless. Is there a way that we can get the properties?

  Read the article

• Symbols (pdb) for native dll are not loaded due to post build step

  - by sean e

  I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

  Read the article

• eclipse error with android: id cannot be resolved or is not a field

  - by Jaynathan Leung

  Hi, I just started playing around with android development, and already with just an attempt at making a button, I have encountered a problem. The error I'm given in the following code is right on "R.id.button1". It says id cannot be resolved or is not a field. Do I need to manually reference every single object I make in the layout xml file? I found that this did work, but it does seem to be a bit much for every button I want to make... package com.example.helloandroid; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class HelloAndroid extends Activity { /** Called when the activity is first created. */ private Button button1; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); button1 = (Button)findViewById(R.id.button1); button1.setOnClickListener(new OnClickListener() { public void onClick(View v) { finish(); } }); } }

  Read the article

• Why doesn't my UIViewController class keep track of an NSArray instance variable.

  - by TaoStoner

  Hey, I am new to Objective-C 2.0 and Xcode, so forgive me if I am missing something elementary here. Anyways, I am trying to make my own UIViewController class called GameView to display a new view. To work the game I need to keep track of an NSArray that I want to load from a plist file. I have made a method 'loadGame' which I want to load the correct NSArray into an instance variable. However it appears that after the method executes the instance variable loses track of the array. Its easier if I just show you the code.... @interface GameView : UIViewController { IBOutlet UIView *view IBOutlet UILabel *label; NSArray *currentGame; } -(IBOutlet)next; -(void)loadDefault; ... @implementation GameView - (IBOutlet)next{ int numElements = [currentGame count]; int r = rand() % numElements; NSString *myString = [currentGame objectAtIndex:(NSUInteger)r]; [label setText: myString]; } - (void)loadDefault { NSDictionary *games; NSString *path = [[NSBundle mainBundle] bundlePath]; NSString *finalPath = [path stringByAppendingPathComponent:@"Games.plist"]; games = [NSDictionary dictionaryWithContentsOfFile:finalPath]; currentGame = [games objectForKey:@"Default"]; } when loadDefault gets called, everything runs perfectly, but when I try to use the currentGame NSArray later in the method call to next, currentGame appears to be nil. I am also aware of the memory management issues with this code. Any help would be appreciated with this problem.

  Read the article

• Why is my code stopping and not returning an exception?

  - by BeckyLou

  I have some code that starts a couple of threads to let them execute, then uses a while loop to check for the current time passing a set timeout period, or for the correct number of results to have been processed (by checking an int on the class object) (with a Thread.Sleep() to wait between loops) Once the while loop is set to exit, it calls Abort() on the threads and should return data to the function that calls the method. When debugging and stepping through the code, I find there can be exceptions in the code running on the separate threads, and in some cases I handle these appropriately, and at other times I don't want to do anything specific. What I have been seeing is that my code goes into the while loop and the thread sleeps, then nothing is returned from my function, either data or an exception. Code execution just stops completely. Any ideas what could be happening? Code sample: System.Threading.Thread sendThread = new System.Threading.Thread(new System.Threading.ThreadStart(Send)); sendThread.Start(); System.Threading.Thread receiveThread = new System.Threading.Thread(new System.Threading.ThreadStart(Receive)); receiveThread.Start(); // timeout Int32 maxSecondsToProcess = this.searchTotalCount * timeout; DateTime timeoutTime = DateTime.Now.AddSeconds(maxSecondsToProcess); Log("Submit() Timeout time: " + timeoutTime.ToString("yyyyMMdd HHmmss")); // while we're still waiting to receive results & haven't hit the timeout, // keep the threads going while (resultInfos.Count < this.searchTotalCount && DateTime.Now < timeoutTime) { Log("Submit() Waiting..."); System.Threading.Thread.Sleep(10 * 1000); // 1 minute } Log("Submit() Aborting threads"); // <== this log doesn't show up sendThread.Abort(); receiveThread.Abort(); return new List<ResultInfo>(this.resultInfos.Values);

  Read the article

• Eclipse BIRT - Unnecessary inline style with external CSS when rendering HTML

  - by Etienne

  Hello! I am designing a report using external CSS with BIRT 2.5. When BIRT renders the html report, it creates copies of each external style to inline styles (name style_x) in the resulting html. The report.design contains: <list-property name="cssStyleSheets"> <structure> <property name="fileName">… mycss.css</property> <property name="externalCssURI"> http://.../mycss.css </property> </structure> </list-property> The resulting html contains: <style type="text/css"> .style_0 {…} .style_1 {…} …. </style> <link rel="stylesheet" type="text/css" href="http://.../mycss.css"></link> For each reference of my styles, the rendered html elements use both styles usually like this: <div class="style_x myclass" …. > …. </div> Is there any way to get rid of the useless inline styles when rendering html?

  Read the article

• ASP.NET MVC4: How do I keep from having multiple identical results in my lookup tables

  - by sehummel

  I'm new to ASP.NET so this may be an easy question. I'm seeding my database with several rows of dummy data. Here is one of my rows: new Software { Title = "Microsoft Office", Version = "2012", SerialNumber = "12346231434543", Platform = "PC", Notes = "Macs really rock!", PurchaseDate = "2011-12-04", Suite = true, SubscriptionEndDate = null, SeatCount = 0, SoftwareTypes = new List<SoftwareType> { new SoftwareType { Type="Suite" }}, Locations = new List<Location> { new Location { LocationName = "Paradise" }}, Publishers = new List<SoftwarePublisher> { new SoftwarePublisher { Publisher = "Microsoft" }}} But when I do this, a new row is created for each location, with the LocationName being set in each row like this. We only have two locations. How do I get it to create a LocationID property for the Software class and in my Locations class. Here is my Location class: public class Location { public int Id { get; set; } [Required] [StringLength(20)] public string LocationName { get; set; } public virtual Software Software { get; set; } } I have this line in my Software class to reference this table: public virtual List<Location> Locations { get; set; } Again, what I want when I am done is a Locations table with two entries, and a LocationID field in my Software table. How do I do this?

  Read the article

• Using static variables for Strings

  - by Vivart

  below content is taken from Best practice: Writing efficient code but i didn't understand why private static String x = "example"; faster than private static final String x ="example"; Can anybody explain this. Using static variables for Strings When you define static fields (also called class fields) of type String, you can increase application speed by using static variables (not final) instead of constants (final). The opposite is true for primitive data types, such as int. For example, you might create a String object as follows: private static final String x = "example"; For this static constant (denoted by the final keyword), each time that you use the constant, a temporary String instance is created. The compiler eliminates "x" and replaces it with the string "example" in the bytecode, so that the BlackBerry® Java® Virtual Machine performs a hash table lookup each time that you reference "x". In contrast, for a static variable (no final keyword), the String is created once. The BlackBerry JVM performs the hash table lookup only when it initializes "x", so access is faster. private static String x = "example"; You can use public constants (that is, final fields), but you must mark variables as private.

  Read the article

• Should I use early returns in C#?

  - by Bobby

  I've learned Visual Basic and was always taught to keep the flow of the program without interruptions, like Goto, Exit and Return. Using nested ifs instead of one return statement seems very natural to me. Now that I'm partly migrating towards C#, I wonder what the best practice is for C-like languages. I've been working on a C# project for some time, and of course discover more code of ExampleB and it's hurting my mind somehow. But what is the best practice for this, what is more often used and are there any reasons against one of the styles? public void ExampleA() { if (a != b) { if (a != c) { bool foundIt; for (int i = 0; i < d.Count && !foundIt; i++) { if (element == f) foundIt = true; } } } } public void ExampleB() { if (a == b) return; if (a == c) return; foreach (object element in d) { if (element == f) break; } }

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• T4 trouble compiling transformation

  - by John Leidegren

  I can't figure this one out. Why doesn't T4 locate the IEnumerable type? I'm using Visual Studio 2010. And I just hope someone knows why? <#@ template debug="true" hostspecific="false" language="C#" #> <#@ assembly name="System.Data, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" #> <#@ import namespace="System" #> <#@ import namespace="System.Data" #> <#@ import namespace="System.Data.SqlClient" #> <#@ output extension=".cs" #> public static class Tables { <# var q = @" SELECT tbl.name 'table', col.name 'column' FROM sys.tables tbl INNER JOIN sys.columns col ON col.object_id = tbl.object_id "; // var source = Execute(q); #> } <#+ static IEnumerable Execute(string cmdText) { using (var conn = new SqlConnection(@"Data Source=.\SQLEXPRESS;Initial Catalog=t4build;Integrated Security=True;")) { conn.Open(); var cmd = new SqlCommand(cmdText, conn); using (var reader = cmd.ExecuteReader()) { while (reader.Read()) { } } } } #> Error 2 Compiling transformation: The type or namespace name 'IEnumerable' could not be found (are you missing a using directive or an assembly reference?) c:\Projects\T4BuildApp\T4BuildApp\TextTemplate1.tt 26 9

  Read the article

• Doctrine: Unable to execute either CROSS JOIN or SELECT FROM Table1, Table2?

  - by ropstah

  Using Doctrine I'm trying to execute either a 1. CROSS JOIN statement or 2. a SELECT FROM Table1, Table2 statement. Both seem to fail. The CROSS JOIN does execute, however the results are just wrong compared to executing in Navicat. The multiple table SELECT doesn't event execute because Doctrine automatically tries to LEFT JOIN the second table. The cross join statement (this runs, however it doesn't include the joined records where the refClass User_Setting doesn't have a value): $q = new Doctrine_RawSql(); $q->select('{s.*}, {us.*}') ->from('User u CROSS JOIN Setting s LEFT JOIN User_Setting us ON us.usr_auto_key = u.usr_auto_key AND us.set_auto_key = s.set_auto_key') ->addComponent('u', 'User u') ->addComponent('s', 'Setting s') ->addComponent('us', 'u.User_Setting us') ->where('s.sct_auto_key = ? AND u.usr_auto_key = ?',array(1, $this->usr_auto_key)); And the select from multiple tables (this doesn't event run. It does not spot the many-many relationship between User and Setting in the first ->from() part and throws an exception: "User_Setting" with an alias of "us" in your query does not reference the parent component it is related to.): $q = new Doctrine_RawSql(); $q->select('{s.*}, {us.*}') ->from('User u, Setting s LEFT JOIN User_Setting us ON us.usr_auto_key = u.usr_auto_key AND us.set_auto_key = s.set_auto_key') ->addComponent('u', 'User u') ->addComponent('s', 'Setting s') ->addComponent('us', 'u.User_Setting us') ->where('s.sct_auto_key = ? AND u.usr_auto_key = ?',array(1, $this->usr_auto_key));

  Read the article

• Run code before class instanciation in ActionScript 3

  - by soow.fr

  I need to run code in a class declaration before its instanciation. This would be especially useful to automatically register classes in a factory. See: // Main.as public class Main extends Sprite { public function Main() : void { var o : Object = Factory.make(42); } } // Factory.as public class Factory { private static var _factory : Array = new Array(); public static function registerClass(id : uint, c : Class) : void { _factory[id] = function () : Object { return new c(); }; } public static function make(id : uint) : Object { return _factory[id](); } } // Foo.as public class Foo { // Run this code before instanciating Foo! Factory.registerClass(42, Foo); } AFAIK, the JIT machine for the ActionScript language won't let me do that since no reference to Foo is made in the Main method. The Foo class being generated, I can't (and don't want to) register the classes in Main: I'd like to register all the exported classes in a specific package (or library). Ideally, this would be done through package introspection, which doesn't exist in ActionScript 3. Do you know any fix (or other solution) to my design issue?

  Read the article

• how can access public properties of MasterPage from external Class ?

  - by eugeneK

  Why i can't access MasterPage's public property (MessagePlaceholder) from other Class (Errors) ? Error compiler gives me is "Error 1 The type or namespace name 'MyMasterPage' could not be found (are you missing a using directive or an assembly reference?)" my master page code behind using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public partial class MyMasterPage : System.Web.UI.MasterPage { public string MessagePlaceholder { get { return messagePlaceholder.InnerHtml; } set { messagePlaceholder.InnerHtml = value; } } protected void Page_Load(object sender, EventArgs e) { if (!IsPostBack) { messagePlaceholder.InnerHtml = Errors.getMessage(); } } } my Errors Class public static string getMessage() { HttpContext c = HttpContext.Current; string messageType = ""; if (c.Session["errorMessage"] != null) { messageType = "errorMessage"; } else if (c.Session["successMessage"] != null) { messageType = "successMessage"; } if (!string.IsNullOrEmpty(messageType)) { StringBuilder userMessageSb = new StringBuilder(); userMessageSb.Append(string.Format("<div id=\"{0}\" title=\"{1}\">{2}</div>", messageType, messageType.Replace("Message",string.Empty), c.Session[messageType])); // fix so message will not re-appear c.Session.Remove(messageType); messageType = userMessageSb.ToString(); } return messageType; } public static void setSuccess(string successMessage, bool isRedirect) { HttpContext.Current.Session["successMessage"] = successMessage; } public static void setError(string errorMessage, bool isRedirect) { HttpContext.Current.Session["errorMessage"] = errorMessage; if (!isRedirect) { ((HttpContext.Current.CurrentHandler as System.Web.UI.Page).Master as MyMasterPage).MessagePlaceholder = getMessage(); } } this is how i set error if (true) { Errors.setError("this is an error demo", false); return; } or with redirect after error if (true) { Errors.setError("yet another error", true); Response.Redirect("~/error.aspx"); }

  Read the article

• public class ImageHandler : IHttpHandler

  - by Ken

  cmd.Parameters.AddWithValue("@id", new system.Guid (imageid)); What using System reference would this require? Here is the handler: using System; using System.Collections.Specialized; using System.Web; using System.Web.Configuration; using System.Web.Security; using System.Globalization; using System.Configuration; using System.Data.SqlClient; using System.Data; using System.IO; using System.Web.Profile; using System.Drawing; public class ImageHandler : IHttpHandler { public void ProcessRequest(HttpContext context) { string imageid; if (context.Request.QueryString["id"] != null) imageid = (context.Request.QueryString["id"]); else throw new ArgumentException("No parameter specified"); context.Response.ContentType = "image/jpeg"; Stream strm = ShowProfileImage(imageid.ToString()); byte[] buffer = new byte[8192]; int byteSeq = strm.Read(buffer, 0, 8192); while (byteSeq > 0) { context.Response.OutputStream.Write(buffer, 0, byteSeq); byteSeq = strm.Read(buffer, 0, 8192); } //context.Response.BinaryWrite(buffer); } public Stream ShowProfileImage(String imageid) { string conn = ConfigurationManager.ConnectionStrings["MyConnectionString1"].ConnectionString; SqlConnection connection = new SqlConnection(conn); string sql = "SELECT image FROM Profile WHERE UserId = @id"; SqlCommand cmd = new SqlCommand(sql, connection); cmd.CommandType = CommandType.Text; cmd.Parameters.AddWithValue("@id", new system.Guid (imageid));//Failing Here!!!! connection.Open(); object img = cmd.ExecuteScalar(); try { return new MemoryStream((byte[])img); } catch { return null; } finally { connection.Close(); } } public bool IsReusable { get { return false; } } }

  Read the article

• Batch insert mode with hibernate and oracle: seems to be dropping back to slow mode silently

  - by Chris

  I'm trying to get a batch insert working with Hibernate into Oracle, according to what i've read here: http://docs.jboss.org/hibernate/core/3.3/reference/en/html/batch.html , but with my benchmarking it doesn't seem any faster than before. Can anyone suggest a way to prove whether hibernate is using batch mode or not? I hear that there are numerous reasons why it may silently drop into normal mode (eg associations and generated ids) so is there some way to find out why it has gone non-batch? My hibernate.cfg.xml contains this line which i believe is all i need to enable batch mode: <property name="jdbc.batch_size">50</property> My insert code looks like this: List<LogEntry> entries = ..a list of 100 LogEntry data classes... Session sess = sessionFactory.getCurrentSession(); for(LogEntry e : entries) { sess.save(e); } sess.flush(); sess.clear(); My 'logentry' class has no associations, the only interesting field is the id: @Entity @Table(name="log_entries") public class LogEntry { @Id @GeneratedValue public Long id; ..other fields - strings and ints... However, since it is oracle, i believe the @GeneratedValue will use the sequence generator. And i believe that only the 'identity' generator will stop bulk inserts. So if anyone can explain why it isn't running in batch mode, or how i can find out for sure if it is or isn't in batch mode, or find out why hibernate is silently dropping back to slow mode, i'd be most grateful. Thanks

  Read the article

• How can I use multi-threading with a "for" or "foreach" loop?

  - by saafh

  I am trying to run the for loop in a separate thread so that the UI should be responsive and the progress bar is visible. The problem is that I don't know how to do that :). In this code, the process starts in a separate thread, but the next part of the code is executed at the same time. The messageBox is displayed and the results are never returned (e.g. the listbox's selected index property is never set). It doesn't work even if I use, "taskEx.delay()". TaskEx.Run(() => { for (int i = 0; i < sResults.Count(); i++) { if (sResults.ElementAt(i).DisplayIndexForSearchListBox.Trim().Contains(ayaStr)) { lstGoto.SelectedIndex = i; lstGoto_SelectionChanged(lstReadingSearchResults, null); IsIndexMatched = true; break; } } }); //TaskEx.delay(1000); if (IsIndexMatched == true) stkPanelGoto.Visibility = Visibility.Collapsed; else //the index didn't match { MessagePrompt.ShowMessage("The test'" + ayaStr + "' does not exist.", "Warning!"); } Could anyone please tell me how can I use multi-threading with a "for" or "foreach" loop?

  Read the article

• twitter streaming api instead of search api

  - by user1711576

  I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

  Read the article

• Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

  - by AngeDeLaMort

  I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

  Read the article

• LINQ to SQL Converter

  - by user609511

  How can I convert My LINQ to SQL ? i have this LINQ statement: int LimCol = Convert.ToInt32(LimitColis); result = oListTUP .GroupBy(x => new { x.Item1, x.Item2, x.Item3, x.Item4, x.Item5 }) .Select(g => new { Key = g.Key, Sum = g.Sum(x => x.Item6), Poids = g.Sum(x => x.Item7), }) .Select(p => new { Key = p.Key, Items = Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)), CalculPoids = p.Poids / Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)).Count() }) .SelectMany(p => p.Items.Select(i => Tuple.Create(p.Key.Item1, p.Key.Item2, p.Key.Item3, p.Key.Item4, p.Key.Item5, i, p.CalculPoids))) .ToList(); } It works well, but somehow want to push it and it become too complicated, so I want to convert it into Pure SQL. I have tried SQL Profiler and LinqPad, but neither shows me the SQL. How can I see the SQL code from My LINQ ? Thank you in advance.

  Read the article

< Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >