Search Results

Search found 49026 results on 1962 pages for 'open source alternative'.

Page 651/1962 | < Previous Page | 647 648 649 650 651 652 653 654 655 656 657 658  | Next Page >

  • sphinx xmlpipe2 cassandra and ruby 1.9

    - by user369083
    Hi, I start to using cassandra and I want to index my db with sphinx. I wrote ruby script which is used as xmlpipe, and I configure sphinx to use it. source xmlsrc { type = xmlpipe2 xmlpipe_command = /usr/local/bin/ruby /home/httpd/html/app/script/sphinxpipe.rb } When I run script from console output looks fine, but when I run indexer sphinx return error $ indexer test_index Sphinx 0.9.9-release (r2117) Copyright (c) 2001-2009, Andrew Aksyonoff using config file '/usr/local/etc/sphinx.conf'... indexing index 'test_index'... ERROR: index 'test_index': source 'xmlsrc': attribute 'id' required in <sphinx:document> (line=10, pos=0, docid=0). total 0 docs, 0 bytes total 0.000 sec, 0 bytes/sec, 0.00 docs/sec total 0 reads, 0.000 sec, 0.0 kb/call avg, 0.0 msec/call avg total 0 writes, 0.000 sec, 0.0 kb/call avg, 0.0 msec/call avg my script is very simple $stdout.sync = true puts %{<?xml version="1.0" encoding="utf-8"?>} puts %{<sphinx:docset>} puts %{<sphinx:schema>} puts %{<sphinx:field name="body"/>} puts %{</sphinx:schema>} puts %{<sphinx:document id="ba32c02e-79e2-11df-9815-af1b5f766459">} puts %{<body><![CDATA[aaa]]></body>} puts %{</sphinx:document>} puts %{</sphinx:docset>} I use ruby 1.9.2-head, ubuntu 10.04, sphinx 0.9.9 How can I get this to work?

    Read the article

  • People not respecting good practices at workplace

    - by VexXtreme
    Hi There are some major issues in my company regarding practices, procedures and methodologies. First of all, we're a small firm and there are only 3-4 developers, one of which is our boss who isn't really a programmer, he just chimes in now and then and tries to do code some simple things. The biggest problems are: Major cowboy coding and lack of methodologies. I've tried explaining to everyone the benefits of TDD and unit testing, but I only got weird looks as if I'm talking nonsense. Even the boss gave me the reaction along the lines of "why do we need that? it's just unnecessary overhead and a waste of time". Nobody uses design patterns. I have to tell people not to write business logic in code behind, I have to remind them not to hardcode concrete implementations and dependencies into classes and cetera. I often feel like a nazi because of this and people think I'm enforcing unnecessary policies and use of design patterns. The biggest problem of all is that people don't even respect common sense security policies. I've noticed that college students who work on tech support use our continuous integration and source control server as a dump to store their music, videos, series they download from torrents and so on. You can imagine the horror when I realized that most of the partition reserved for source control backups was used by entire seasons of TV series and movies. Our development server isn't even connected to an UPS and surge protection. It's just plugged straight into the wall outlet. I asked the boss to buy surge protection, but he said it's unnecessary. All in all, I like working here because the atmosphere is very relaxed, money is good and we're all like a family (so don't advise me to quit), but I simply don't know how to explain to people that they need to stick to some standards and good practices in IT industry and that they can't behave so irresponsibly. Thanks for the advice

    Read the article

  • ASP.NET MVC2: Client-side validation not working with Start.js

    - by Shaggy13spe
    Ok, this is strange. I would hope it's something I'm doing wrong and not that MS has two technologies that simply don't work together. (UPDATE: See bottom of post for Script tag order in HEAD section) I'm trying to use the dataView template and client-side validation. If I include a reference to: <script src="http://ajax.microsoft.com/ajax/beta/0911/Start.js" type="text/javascript"></script> by itself, the dataview template works fine. but if I put in the following references: <script src="http://ajax.microsoft.com/ajax/jquery.validate/1.7/jquery.validate.min.js" type="text/javascript"></script> <script src="../../Scripts/MicrosoftAjax.js" type="text/javascript"></script> <script src="../../Scripts/MicrosoftMvcAjax.js" type="text/javascript"></script> <script src="../../Scripts/MicrosoftMvcValidation.js" type="text/javascript"></script> then I get the following error: > Error: Type._registerScript is not a > function Source File: > http://ajax.microsoft.com/ajax/beta/0911/MicrosoftAjaxTemplates.js > Line: 1 and: > Error: Sys.get("$listings") is null > Source File: > http://localhost:12370/Listings Line: > 76 Here's the code calling the dataview: $(document).ready(function () { LoadMap(); Sys.require([Sys.components.dataView, Sys.scripts.jQuery], function() { $("#listings").dataView(); Sys.get("$listings").set_data(listings.Data); updateMap(listings.Data); }); }); I would really appreciate any help with this one. Thanks! UPDATE: I've tried moving around the order of the last 4 script tags, but to no avail.

    Read the article

  • Bulk Copy from one server to another

    - by Joseph
    Hi All, I've one situation where I need to copy part of the data from one server to another. The table schema are exactly same. I need to move partial data from the source, which may or may not be available in the destination table. The solution I'm thinking is, use bcp to export data to a text(or .dat) file and then take that file to the destination as both are not accessible at the same time (Different network), then import the data to the destination. There are some conditions I need to satisfy. 1. I need to export only a list of data from the table, not whole. My client is going to give me IDs which needs to be moved from source to destination. I've around 3000 records in the master table, and same in the child tables too. What I expect is, only 300 records to be moved. 2. If the record exists in the destination, the client is going to instruct as whether to ignore or overwrite case to case. 90% of the time, we need to ignore the records without overwriting, but log the records in a log file. Please help me with the best approach. I thought of using BCP with query option to filter the data, but while importing, how do I bypass inserting the existing records? If I need to overwrite, how to do it? Thanks a lot in advance. ~Joseph

    Read the article

  • Verifying Time Machine backups

    - by jtimberman
    I'm preparing my system for a Snow Leopard upgrade, and I prepare for the worst case scenario: full reinstall and restore. I would like to verify that my Time Machine backups are valid, and will restore correctly. My Time Machine backups go to a Linux server running Netatalk, and the backups complete successfully. How do I do a test restore to an alternative location, or otherwise verify my data without overwriting any existing files? Do I need to save anything in particular externally to make sure I can access the backups if I have to reinstall from scratch?

    Read the article

  • displaying images in a list box so the image resizes based on parent container

    - by MikeU
    I have an expander with a list box in it that displays image thumbnails. I want the images to be sized according to the size of the listbox and the list box to be sized based on the width of the expander. When I expand the expander I want the list box and the images to resize also. Does anyone know how I can accomplish this? <Expander Style="{DynamicResource ExpanderStyle}" Name="pictureExpander" IsExpanded="True" ExpandDirection="Left" Collapsed="pictureExpander_Collapsed" Expanded="pictureExpander_Expanded" Grid.Column="4"> <ListBox Name="photoList" ItemsSource="{Binding Source={StaticResource PhotoBin}}" IsSynchronizedWithCurrentItem="True" HorizontalAlignment="Stretch" ScrollViewer.CanContentScroll="False"> <ListBox.ItemContainerStyle> <Style TargetType="{x:Type ListBoxItem}"> <Style.Resources> <SolidColorBrush x:Key="{x:Static SystemColors.HighlightBrushKey}" Color="Yellow" /> </Style.Resources> <Style.Triggers> <Trigger Property="IsSelected" Value="True"> <Setter Property="BorderBrush" Value="Black"/> <Setter Property="BorderThickness" Value="5"/> </Trigger> </Style.Triggers> </Style> </ListBox.ItemContainerStyle> <ListBox.ItemTemplate> <DataTemplate> <Image Source="{Binding FileLocation}" Margin="0,5" HorizontalAlignment="Stretch" MouseLeftButtonDown="DragImage" /> </DataTemplate> </ListBox.ItemTemplate> </ListBox> </Expander>

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

    - by ijjo
    i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

    Read the article

  • Are there any tools for monitoring individual Apache virtual hosts in real-time?

    - by Dave Forgac
    I'm looking for a way to monitor and record Apache traffic, separated by virtual host. I am currently using Munin to capture this and other data for the entire server however I can't seem to find a way to do this by vhost. This link describes using a module called mod_watch which is apparently no longer in development: http://www.freshnet.org/wordpress/2007/03/08/monitoring-apaches-virtualhost-with-munin/ The file that is listed as being compatible with Apache 2.x is reported to have problems with missing vhosts an reporting data correctly. Does anyone know of a reliable way to determine real-time traffic per vhost? If I can find this it should be easy enough to write a new Munin plugin. Edit: What I'd really like to see is something similar to the Apache server-status scoreboard page with the number of connections / requests separated by virtual host. This would give me the ability to check which vhost may be experiencing a spike in traffic in real time and would also provide the data needed for a Munin module (or some alternative performance monitoring / analysis system.)

    Read the article

  • Error Cannot create an Instance of "ObjectName" in Designer when using <UserControl.Resources>

    - by Mike Bynum
    Hi All, I'm tryihg to bind a combobox item source to a static resource. I'm oversimplfying my example so that it's easy to understand what i'm doing. So I have created a class public class A : ObservableCollection<string> { public A() { IKBDomainContext Context = new IKBDomainContext(); Context.Load(Context.GetIBOptionsQuery("2C6C1Q"), p => { foreach (var item in SkinContext.IKBOptions) { this.Add(item); } }, null); } } So the class has a constructor that populates itself using a domaincontext that gets data from a persisted database. I'm only doing reads on this list so dont have to worry about persisting back. in xaml i add a reference to the namespace of this class then I add it as a usercontrol.resources to the page control. <UserControl.Resources> <This:A x:Key="A"/> </UserControl.Resources> and then i use it this staticresource to bind it to my combobox items source.in reality i have to use a datatemplate to display this object properly but i wont add that here. <Combobox ItemsSource="{StaticResource A}"/> Now when I'm in the designer I get the error: Cannot Create an Instance of "A". If i compile and run the code, it runs just fine. This seems to only affect the editing of the xaml page. What am I doing wrong?

    Read the article

  • My SqlComand on SSIS - DataFlow OLE DB Command seems not works

    - by Angel Escobedo
    Hello Im using OLE DB Source for get rows from a dBase IV file and it works, then I split the data and perform a group by with aggregate component. So I obtain a row with two columns with "null" value : CompanyID | CompanyName | SubTotal | Tax | TotalRevenue Null Null 145487 27642.53 173129.53 this success because all rows have been grouped with out taking care about the firsts columns and just Summing the valuable columns, so I need to change that null for default values as CompanyID = "100000000" and CompanyName = "Others". I try use SqlCommand on a OLE DB Command Component : SELECT "10000000" AS RUCCLI , "Otros - Varios" AS RAZCLI FROM RGVCAFAC <property id="1505" name="SqlCommand" dataType="System.String" state="default" isArray="false" description="The SQL command to be executed." typeConverter="" UITypeEditor="Microsoft.DataTransformationServices.Controls.ModalMultilineStringEditor, Microsoft.DataTransformationServices.Controls, Version=10.0.0.0, Culture=neutral, PublicKeyToken=89845dcd8080cc91" containsID="false" expressionType="Notify">SELECT "10000000" AS RUCCLI , "Otros - Varios" AS RAZCLI FROM RGVCAFAC</property> but nothings happens, why? and finally the task finish when the data is inserted on a SQL Server Table. Im using the same connection manager on extracting data and transform. (View Code) <DTS:Property DTS:Name="ConnectionString">Data Source=C:\CONTA\Resocen\Agosto\;Provider=Microsoft.Jet.OLEDB.4.0;Persist Security Info=False;Extended Properties=dBASE IV;</DTS:Property></DTS:ConnectionManager></DTS:ObjectData></DTS:ConnectionManager> all work is on memory, Im not using cache manager connections

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • WPF resource merged to Application.Resources but not resolved at runtime

    - by arconaut
    I have a brush that is part of a ResourceDictionary that is merged to Application.Resources. But for some reason it's not resolved at runtime when a style is being applied to one of the controls. However, if I call Application.Current.FindResource("BrushName") from the Immediate Window at the time when exception is thrown, the resource is found. Am I missing something? Isn't WPF supposed to try to look for the resource in the app's resources? UPDATE The application is quite big, so I can't post all actual code but here's the way the resources are merged and used: Brushes.xaml <ResourceDictionary ...> <SolidColorBrush x:Key="BrushName" Color="#12345678" /> <\ResourceDictionary> SomeStyles.xaml <ResourceDictionary ...> <Style x:Key="SomeStyle"> <Setter Property="SomeProperty" Value="{StaticResource BrushName}" /> </Style> </ResourceDictionary> App.xaml <Application ...> <Application.Resources> <ResourceDictionary> <ResourceDictionary.MergedDictionaries> <ResourceDictionary Source="Brushes.xaml" /> <ResourceDictionary Source="SomeStyles.xaml" /> </ResourceDictionary.MergedDictionaries> </ResourceDictionary> </Application.Resources> </Application ...> And then some control might use the style using the resource like this: ... Style={StaticResource SomeStyle} ...

    Read the article

  • Indy IdSMTP and attachments in Thunderbird

    - by Lobuno
    Hello! Using the latest snapshot of Indy tiburon on D2010. A very simple project like: var stream: TFileStream; (s is TidSMTP and m is TidMessage) begin s.Connect; Stream := TFileStream.Create('c:\Test.zip', fmOpenRead or fmShareExclusive); try with TIdAttachmentMemory.Create(m.MessageParts, Stream) do begin ContentType := 'application/x-zip-compressed'; Name := ExtractFilePath('C:\'); //' FileName := 'Test.zip'; end; finally FreeAndNil(Stream); end; s.Send(m); s.Disconnect(); end; Everything works Ok in Outlook, The bat!, OE, yahoo, etc... but in Thunderbird the attachment is not shown. Looking at the source of the message in Thunderbird, the attachment is there. The only difference I can find between messages send by indy and other clients is that Indy messages have this order: Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" MIME-Version: 1.0 while any other clients have the order: MIME-Version: 1.0 Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" Don't know if THAT is the source of the problem, but if so: is this a bug on Thunderbird or is this a problem with indy which "malforms" the headers of the messages? Is this order a problem? Does that matter anyway?

    Read the article

  • WCF Service Layer in n-layered application: performance considerations

    - by Marconline
    Hi all. When I went to University, teachers used to say that in good structured application you have presentation layer, business layer and data layer. This is what I heard for more than 5 years. When I started working I discovered that this is true but sometimes is better to have more than just three layers. Two or three days ago I discovered this article by John Papa that explain how to use Entity Framework in layered application. According to that article you should have: UI Layer and Presentation Layer (Model View Pattern) Service Layer (WCF) Business Layer Data Access Layer Service Layer is, to me, one of the best ideas I've ever heard since I work. Your UI is then completely "diconnected" from Business and Data Layer. Now when I went deeper by looking into provided source code, I began to have some questions. Can you help me in answering them? Question #0: is this a good enterpise application template in your opinion? Question #1: where should I host the service layer? Should it be a Windows Service or what else? Question #2: in the source code provided the service layer expose just an endpoint with WSHttpBinding. This is the most interoperable binding but (I think) the worst in terms of performances (due to serialization and deserializations of objects). Do you agree? Question #3: if you agree with me at Question 2, which kind of binding would you use? Looking forward to hear from you. Have a nice weekend! Marco

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • Issues with ForceBindIP on Windows 7 (x64)

    - by Craig
    I am desperately needing a solution to binding certain applications to specific network interfaces. ForceBindIP seems to be my only solution. Although the website claims it works up to XP, Google says that many users running 7 have had it work successfully. I have UAC disabled, yet still: Does anyone know why this is happening? If not, does anyone know a viable alternative to ForceBindIP? I'm a gamer and I'm addictively trying to torrent on a secondary connection while playing games online.

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

  • RuntimeException from xmlbeans - can't find compiled schema

    - by findango
    I'm getting a RuntimeException while executing some code that depends on generated xmlbeans classes. I can't figure out if this is: me missing something during code-generation or packaging a runtime dependency missing a misleading error message, and I should be looking elsewhere. The xbean.jar version is the same in the build and execution environment. Anyone seen this before or have any ideas? Thanks. ...snip... Caused by: java.lang.RuntimeException: Could not instantiate SchemaTypeSystemImpl (java.lang.reflect.InvocationTargetException): is the version of xbean.jar correct? at schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.TypeSystemHolder.loadTypeSystem(Unknown Source) at schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.TypeSystemHolder.(Unknown Source) ... 38 more Caused by: java.lang.reflect.InvocationTargetException at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:494) ... 40 more Caused by: org.apache.xmlbeans.SchemaTypeLoaderException: XML-BEANS compiled schema: Could not locate compiled schema resource schemaorg_apache_xmlbeans/system/s2B8331230CBD98F4933B0B025B6BF726/index.xsb (schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.index) - code 0 at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl$XsbReader.(SchemaTypeSystemImpl.java:1504) at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl.initFromHeader(SchemaTypeSystemImpl.java:260) at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl.(SchemaTypeSystemImpl.java:183) ... 44 more ...snip...

    Read the article

  • WPF Update Binding when Bound directly to DataContext w/ Converter

    - by Adam
    Normally when you want a databound control to 'update,' you use the "PropertyChanged" event to signal to the interface that the data has changed behind the scenes. For instance, you could have a textblock that is bound to the datacontext with a property "DisplayText" <TextBlock Text="{Binding Path=DisplayText}"/> From here, if the DataContext raises the PropertyChanged event with PropertyName "DisplayText," then this textblock's text should update (assuming you didn't change the Mode of the binding). However, I have a more complicated binding that uses many properties off of the datacontext to determine the final look and feel of the control. To accomplish this, I bind directly to the datacontext and use a converter. In this case I am working with an image source. <Image Source="{Binding Converter={StaticResource ImageConverter}}"/> As you can see, I use a {Binding} with no path to bind directly to the datacontext, and I use an ImageConverter to select the image I'm looking for. But now I have no way (that I know of) to tell that binding to update. I tried raising the propertychanged event with "." as the propertyname, which did not work. Is this possible? Do I have to wrap up the converting logic into a property that the binding can attach to, or is there a way to tell the binding to refresh (without explicitly refreshing the binding)? Any help would be greatly appreciated. Thanks! -Adam

    Read the article

  • Currency exchange rates for paypal

    - by Jacco
    Does anyone know a way to get the currency exchange rates for paypal? We have custom shopping cart and use Paypal (Website Payments Standard) to handle payments. Our 'home' currency is Euro, but we would like to present our customers the option to pay in different currencies (USD, CAD, AUD and GBP). PayPal offers the option to:     a) automatically convert our Euro quoted prices to, for example, USD upon checkout     b) checkout in USD directly With option a): We get paid in Euro, the customer pays for the currency exchange (good). The customer does not know what he/she is going to be charged in USD until checkout. (bad) With option b) The customer pays in USD, then the currency is converted into EUR and we pay the the currency exchange. The customer never has to worry about the different currencies (excellent) We do not know the exchange rate PayPal is going to use so we cannot quote the correct prices to our customer (showstopper) So my question is:   Does anybody know a way to get the PayPal exchange rates? or   Does anybody know how to make a good estimate? Update: PayPal updates it's exchange rate 2 times a day. (at least, that is what they state). They use the Interbank Exchange Rate provided by ??? and add a 2.5% spread above this rate to determine their retail foreign exchange rates. Unforunately, there the Interbank Exchange Rates vary from source to source and from minute to minute. We have been monitoring the PayPal exchange rates and cross referenced them with the Official reference rates provides by the European Central Bank. the results vary widely, somewhere from 1 to 6 ! percent...

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

< Previous Page | 647 648 649 650 651 652 653 654 655 656 657 658  | Next Page >