Search Results

Search found 19975 results on 799 pages for 'disk queue length'.

Page 669/799 | < Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >

  • Automatically generating Regex from set of strings residing in DB C#

    - by Muhammad Adeel Zahid
    Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

    Read the article

  • Race condition during thread start?

    - by user296353
    Hi, I'm running the following code to start my threads, but they don't start as intended. For some reason, some of the threads start with the same objects (and some don't even start). If I try to debug, they start just fine (extra delay added by me clicking F10 to step through the code). These are the functions in my forms app: private void startWorkerThreads() { int numThreads = config.getAllItems().Count; int i = 0; foreach (ConfigurationItem tmpItem in config.getAllItems()) { i++; var t = new Thread(() => WorkerThread(tmpItem, i)); t.Start(); //return t; } } private void WorkerThread(ConfigurationItem cfgItem, int mul) { for (int i = 0; i < 100; i++) { Thread.Sleep(10*mul); } this.Invoke((ThreadStart)delegate() { this.textBox1.Text += "Thread " + cfgItem.name + " Complete!\r\n"; this.textBox1.SelectionStart = textBox1.Text.Length; this.textBox1.ScrollToCaret(); }); } Anyone able to help me out? Cheers!

    Read the article

  • Reloading a JTree during runtime

    - by Patrick Kiernan
    I create a JTree and model for it out in a class separate to the GUI class. The data for the JTree is extracted from a file. Now in the GUI class the user can add files from the file system to an AWT list. After the user clicks on a file in the list I want the JTree to update. The variable name for the JTree is schemaTree. I have the following code for the when an item in the list is selected: private void schemaListItemStateChanged(java.awt.event.ItemEvent evt) { int selection = schemaList.getSelectedIndex(); File selectedFile = schemas.get(selection); long fileSize = selectedFile.length(); fileInfoLabel.setText("Size: " + fileSize + " bytes"); schemaParser = new XSDParser(selectedFile.getAbsolutePath()); TreeModel model = schemaParser.generateTreeModel(); schemaTree.setModel(model); } I've updated the code to correspond to the accepted answer. The JTree now updates correctly based on which file I select in the list.

    Read the article

  • Clustering on WebLogic exception on Failover

    - by Markos Fragkakis
    Hi all, I deploy an application on a WebLogic 10.3.2 cluster with two nodes, and a load balancer in front of the cluster. I have set the <core:init distributable="true" debug="true" /> My Session and Conversation classes implement Serializable. I start using the application being served by the first node. The console shows that the session replication is working. <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> When I shutdown the first node from the Administration console, I get this in the other node: <Jun 17, 2010 11:23:46 AM EEST> <Error> <Kernel> <BEA-000802> <ExecuteRequest failed java.lang.NullPointerException. java.lang.NullPointerException at org.jboss.seam.intercept.JavaBeanInterceptor.callPostActivate(JavaBeanInterceptor.java:165) at org.jboss.seam.intercept.JavaBeanInterceptor.invoke(JavaBeanInterceptor.java:73) at com.myproj.beans.SortingFilteringBean_$$_javassist_seam_2.sessionDidActivate(SortingFilteringBean_$$_javassist_seam_2.java) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2258) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2222) at weblogic.servlet.internal.session.ReplicatedSessionData.becomePrimary(ReplicatedSessionData.java:231) at weblogic.cluster.replication.WrappedRO.changeStatus(WrappedRO.java:142) at weblogic.cluster.replication.WrappedRO.ensureStatus(WrappedRO.java:129) at weblogic.cluster.replication.LocalSecondarySelector$ChangeSecondaryInfo.run(LocalSecondarySelector.java:542) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:516) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) at weblogic.work.ExecuteThread.run(ExecuteThread.java:173) > What am I doing wrong? This is the SortingFilteringBean: import java.util.HashMap; import java.util.LinkedHashMap; import org.jboss.seam.ScopeType; import org.jboss.seam.annotations.Name; import org.jboss.seam.annotations.Scope; import com.myproj.model.crud.Filtering; import com.myproj.model.crud.Sorting; import com.myproj.model.crud.SortingOrder; /** * Managed bean aggregating the sorting and filtering values for all the * application's lists. A light-weight bean to always keep in the session with * minimum impact. */ @Name("sortingFilteringBean") @Scope(ScopeType.SESSION) public class SortingFilteringBean extends BaseManagedBean { private static final long serialVersionUID = 1L; private Sorting applicantProductListSorting; private Filtering applicantProductListFiltering; private Sorting homePageSorting; private Filtering homePageFiltering; /** * Creates a new instance of SortingFilteringBean. */ public SortingFilteringBean() { // ********************** // Applicant Product List // ********************** // Sorting LinkedHashMap<String, SortingOrder> applicantProductListSortingValues = new LinkedHashMap<String, SortingOrder>(); applicantProductListSortingValues.put("applicantName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("applicantEmail", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productEmail", SortingOrder.ASCENDING); applicantProductListSorting = new Sorting( applicantProductListSortingValues); // Filtering HashMap<String, String> applicantProductListFilteringValues = new HashMap<String, String>(); applicantProductListFilteringValues.put("applicantName", ""); applicantProductListFilteringValues.put("applicantEmail", ""); applicantProductListFilteringValues.put("productName", ""); applicantProductListFilteringValues.put("productEmail", ""); applicantProductListFiltering = new Filtering( applicantProductListFilteringValues); // ********* // Home page // ********* // Sorting LinkedHashMap<String, SortingOrder> homePageSortingValues = new LinkedHashMap<String, SortingOrder>(); homePageSortingValues.put("productName", SortingOrder.ASCENDING); homePageSortingValues.put("productId", SortingOrder.ASCENDING); homePageSortingValues.put("productAtcCode", SortingOrder.UNSORTED); homePageSortingValues.put("productEmaNumber", SortingOrder.UNSORTED); homePageSortingValues.put("productOrphan", SortingOrder.UNSORTED); homePageSortingValues.put("productRap", SortingOrder.UNSORTED); homePageSortingValues.put("productCorap", SortingOrder.UNSORTED); homePageSortingValues.put("applicationTypeDescription", SortingOrder.ASCENDING); homePageSortingValues.put("applicationId", SortingOrder.ASCENDING); homePageSortingValues .put("applicationEmaNumber", SortingOrder.UNSORTED); homePageSortingValues .put("piVersionImportDate", SortingOrder.ASCENDING); homePageSortingValues.put("piVersionId", SortingOrder.ASCENDING); homePageSorting = new Sorting(homePageSortingValues); // Filtering HashMap<String, String> homePageFilteringValues = new HashMap<String, String>(); homePageFilteringValues.put("productName", ""); homePageFilteringValues.put("productAtcCode", ""); homePageFilteringValues.put("productEmaNumber", ""); homePageFilteringValues.put("applicationTypeId", ""); homePageFilteringValues.put("applicationEmaNumber", ""); homePageFilteringValues.put("piVersionImportDate", ""); homePageFiltering = new Filtering(homePageFilteringValues); } /** * @return the applicantProductListFiltering */ public Filtering getApplicantProductListFiltering() { return applicantProductListFiltering; } /** * @param applicantProductListFiltering * the applicantProductListFiltering to set */ public void setApplicantProductListFiltering( Filtering applicantProductListFiltering) { this.applicantProductListFiltering = applicantProductListFiltering; } /** * @return the applicantProductListSorting */ public Sorting getApplicantProductListSorting() { return applicantProductListSorting; } /** * @param applicantProductListSorting * the applicantProductListSorting to set */ public void setApplicantProductListSorting( Sorting applicantProductListSorting) { this.applicantProductListSorting = applicantProductListSorting; } /** * @return the homePageSorting */ public Sorting getHomePageSorting() { return homePageSorting; } /** * @param homePageSorting * the homePageSorting to set */ public void setHomePageSorting(Sorting homePageSorting) { this.homePageSorting = homePageSorting; } /** * @return the homePageFiltering */ public Filtering getHomePageFiltering() { return homePageFiltering; } /** * @param homePageFiltering * the homePageFiltering to set */ public void setHomePageFiltering(Filtering homePageFiltering) { this.homePageFiltering = homePageFiltering; } /** * For convenience to view in the Seam Debug page. * * @see java.lang.Object#toString() */ @Override public String toString() { StringBuilder sb = new StringBuilder(""); sb.append("\n\n"); sb.append("applicantProductListSorting"); sb.append(applicantProductListSorting); sb.append("\n\n"); sb.append("applicantProductListFiltering"); sb.append(applicantProductListFiltering); sb.append("\n\n"); sb.append("homePageSorting"); sb.append(homePageSorting); sb.append("\n\n"); sb.append("homePageFiltering"); sb.append(homePageFiltering); return sb.toString(); } } And this is the BaseManagedBean, inheriting the AbstractMutable. import java.io.IOException; import java.io.OutputStream; import java.util.List; import javax.faces.application.FacesMessage; import javax.faces.application.FacesMessage.Severity; import javax.faces.context.FacesContext; import javax.servlet.http.HttpServletResponse; import org.apache.commons.lang.ArrayUtils; import org.jboss.seam.core.AbstractMutable; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.myproj.common.exceptions.WebException; import com.myproj.common.util.FileUtils; import com.myproj.common.util.StringUtils; import com.myproj.web.messages.Messages; public abstract class BaseManagedBean extends AbstractMutable { private static final Logger logger = LoggerFactory .getLogger(BaseManagedBean.class); private FacesContext facesContext; /** * Set a message to be displayed for a specific component. * * @param resourceBundle * the resource bundle where the message appears. Either base or * id may be used. * @param summaryResourceId * the id of the resource to be used as summary. For the detail * of the element, the element to be used will be the same with * the suffix {@code _detail}. * @param parameters * the parameters, in case the string is parameterizable * @param severity * the severity of the message * @param componentId * the component id for which the message is destined. Note that * an appropriate JSF {@code <h:message for="myComponentId">} tag * is required for the to appear, or alternatively a {@code * <h:messages>} tag. */ protected void setMessage(String resourceBundle, String summaryResourceId, List<Object> parameters, Severity severity, String componentId, Messages messages) { FacesContext context = getFacesContext(); FacesMessage message = messages.getMessage(resourceBundle, summaryResourceId, parameters); if (severity != null) { message.setSeverity(severity); } context.addMessage(componentId, message); } /** * Copies a byte array to the response output stream with the appropriate * MIME type and content disposition. The response output stream is closed * after this method. * * @param response * the HTTP response * @param bytes * the data * @param filename * the suggested file name for the client * @param mimeType * the MIME type; will be overridden if the filename suggests a * different MIME type * @throws IllegalArgumentException * if the data array is <code>null</code>/empty or both filename * and mimeType are <code>null</code>/empty */ protected void printBytesToResponse(HttpServletResponse response, byte[] bytes, String filename, String mimeType) throws WebException, IllegalArgumentException { if (response.isCommitted()) { throw new WebException("HTTP response is already committed"); } if (ArrayUtils.isEmpty(bytes)) { throw new IllegalArgumentException("Data buffer is empty"); } if (StringUtils.isEmpty(filename) && StringUtils.isEmpty(mimeType)) { throw new IllegalArgumentException( "Filename and MIME type are both null/empty"); } // Set content type (mime type) String calculatedMimeType = FileUtils.getMimeType(filename); // not among the known ones String newMimeType = mimeType; if (calculatedMimeType == null) { // given mime type passed if (mimeType == null) { // none available put default mime-type newMimeType = "application/download"; } else { if ("application/octet-stream".equals(mimeType)) { // small modification newMimeType = "application/download"; } } } else { // calculated mime type has precedence over given mime type newMimeType = calculatedMimeType; } response.setContentType(newMimeType); // Set content disposition and other headers String contentDisposition = "attachment;filename=\"" + filename + "\""; response.setHeader("Content-Disposition", contentDisposition); response.setHeader("Expires", "0"); response.setHeader("Cache-Control", "max-age=30"); response.setHeader("Pragma", "public"); // Set content length response.setContentLength(bytes.length); // Write bytes to response OutputStream out = null; try { out = response.getOutputStream(); out.write(bytes); } catch (IOException e) { throw new WebException("Error writing data to HTTP response", e); } finally { try { out.close(); } catch (Exception e) { logger.error("Error closing HTTP stream", e); } } } /** * Retrieve a session-scoped managed bean. * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected Object getSessionBean(String sessionBeanName) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { throw new IllegalArgumentException("No such object in Session"); } else { return sessionScopedBean; } } /** * Set a session-scoped managed bean * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected boolean setSessionBean(String sessionBeanName, Object sessionBean) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { FacesContext.getCurrentInstance().getExternalContext() .getSessionMap().put(sessionBeanName, sessionBean); } else { throw new IllegalArgumentException( "This session-scoped bean was already initialized"); } return true; } /** * For testing (enables mock of FacesContext) * * @return the faces context */ public FacesContext getFacesContext() { if (facesContext == null) { return FacesContext.getCurrentInstance(); } return facesContext; } /** * For testing (enables mocking of FacesContext). * * @param aFacesContext * a - possibly mock - faces context. */ public void setFacesContext(FacesContext aFacesContext) { this.facesContext = aFacesContext; } }

    Read the article

  • How to delete a large cookie that causes Apache to 400

    - by jakemcgraw
    I've come across an issue where a web application has managed to create a cookie on the client, which, when submitted by the client to Apache, causes Apache to return the following: HTTP/1.1 400 Bad Request Date: Mon, 08 Mar 2010 21:21:21 GMT Server: Apache/2.2.3 (Red Hat) Content-Length: 7274 Connection: close Content-Type: text/html; charset=iso-8859-1 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML 2.0//EN"> <html><head> <title>400 Bad Request</title> </head><body> <h1>Bad Request</h1> <p>Your browser sent a request that this server could not understand.<br /> Size of a request header field exceeds server limit.<br /> <pre> Cookie: ::: A REALLY LONG COOKIE ::: </pre> </p> <hr> <address>Apache/2.2.3 (Red Hat) Server at www.foobar.com Port 80</address> </body></html> After looking into the issue, it would appear that the web application has managed to create a really long cookie, over 7000 characters. Now, don't ask me how the web application was able to do this, I was under the impression browsers were supposed to prevent this from happening. I've managed to come up with a solution to prevent the cookies from growing out of control again. The issue I'm trying to tackle is how do I reset the large cookie on the client if every time the client tries to submit a request to Apache, Apache returns a 400 client error? I've tried using the ErrorDocument directive, but it appears that Apache bails on the request before reaching any custom error handling.

    Read the article

  • Payapl sandbox a/c in Dotnet..IPN Response Invaild

    - by Sam
    Hi, I am Integrating paypal to mysite.. i use sandbox account,One Buyer a/c and one more for seller a/c...and downloaded the below code from paypal site string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } and when add this snippets in pageload event of success page i get the ipn response as INVALID but amount paid successfully but i am getting invalid..any help..Paypal Docs in not Clear. thanks in advance

    Read the article

  • Display ñ on a C# .NET application

    - by mmr
    I have a localization issue. One of my industrious coworkers has replaced all the strings throughout our application with constants that are contained in a dictionary. That dictionary gets various strings placed in it once the user selects a language (English by default, but target languages are German, Spanish, French, Portuguese, Mandarin, and Thai). For our test of this functionality, we wanted to change a button to include text which has a ñ character, which appears both in Spanish and in the Arial Unicode MS font (which we're using throughout the application). Problem is, the ñ is appearing as a square block, as if the program did not know how to display it. When I debug into that particular string being read from disk, the debugger reports that character as a square block as well. So where is the failure? I think it could be in a few places: 1) Notepad may not be unicode aware, so the ñ displayed there is not the same as what vs2008 expects, and so the program interprets the character as a square (EDIT: notepad shows the same characters as vs; ie, they both show the ñ. In the same place.). 2) vs2008 can't handle ñ. I find that very, very hard to believe. 3) The text is read in properly, but the default font for vs2008 can't display it, which is why the debugger shows a square. 4) The text is not read in properly, and I should use something other than a regular StreamReader to get strings. 5) The text is read in properly, but the default String class in C# doesn't handle ñ well. I find that very, very hard to believe. 6) The version of Arial Unicode MS I have doesn't have ñ, despite it being listed as one of the 50k characters by http://www.fileinfo.info. Anything else I could have left out? Thanks for any help!

    Read the article

  • Force creation of query execution plan

    - by Marc
    I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

    Read the article

  • What are some funny loading statements to keep users amused?

    - by Oli
    Nobody likes waiting but unfortunately in the Ajax application I'm working on at the moment, there is one fair-sized pause (1-2 seconds a go) that users have to undergo each and every time they want to load up a chunk of data. I've tried to make the load as interactive as possible. There's an animated GIF alongside a very plain, very dull "Loading..." message. So I thought it might be quite fun to come up with a batch of 50-or-so funny-looking messages and pick from them randomly so the user never knows what they're going to see. The time they would have spent growing impatient is fruitfully used. Here's what I've come up with so far, just to give you an idea. var randomLoadingMessage = function() { var lines = new Array( "Locating the required gigapixels to render...", "Spinning up the hamster...", "Shovelling coal into the server...", "Programming the flux capacitor" ); return lines[Math.round(Math.random()*(lines.length-1))]; } (Yes -- I know some of those are pretty lame -- That's why I'm here :) The funniest I see today will get the prestigious "Accepted Answer" award. Others get votes for participation. Enjoy!!

    Read the article

  • Fck editor problem

    - by Josemalive
    Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

    Read the article

  • Unable to load images into each MC?

    - by Hwang
    The images only loads into the last MC, how to make it load into each MC? private function imageHandler():void { imageBox=new MovieClip(); imageBox.graphics.lineStyle(5, 0xFFFFFF); imageBox.graphics.beginFill(0xFF0000); imageBox.graphics.drawRect(0,0,150,225); imageBox.graphics.endFill(); allImage.addChild(imageBox); } private function getPhoto():void { for (i=0; i<myXMLList.length(); i++) { placePhoto(); imageHandler(); imagesArray.push(imageBox); imagesArray[i].x=20+(200*i); } addChild(allImage); allImage.x=-(allImage.width+20); allImage.y=-(allImage.height+50); } private function placePhoto():void { loadedPic=myXMLList[i].@PIC; galleryLoader = new Loader(); galleryLoader.load(new URLRequest(loadedPic)); galleryLoader.contentLoaderInfo.addEventListener(Event.COMPLETE,picLoaded); } private function picLoaded(event:Event):void { bmp=new Bitmap(event.target.content.bitmapData); bmp.smoothing=true; imageBox.addChild(bmp); }

    Read the article

  • Problems with jQuery load and getJSON only when using Chrome

    - by leftend
    I'm having an issue with two jQuery calls. The first is a "load" that retrieves HTML and displays it on the page (it does include some Javascript and CSS in the code that is returned). The second is a "getJSON" that returns JSON - the JSON returned is valid. Everything works fine in every other browser I've tried - except Chrome for either Windows or Mac. The page in question is here: http://urbanistguide.com/category/Contemporary.aspx When you click on a Restaurant name in IE/FF, you should see that item expand with more info - and a map displayed to the right. However, if you do this in Chrome all you get is the JSON data printed to the screen. The first problem spot is when the "load" function is called here: var fulllisting = top.find(".listingfull"); fulllisting.load(href2, function() { fulllisting.append("<div style=\"width:99%;margin-top:10px;text-align:right;\"><a href=\"#\" class=\"" + obj.attr("id") + "\">X</a>"); itemId = fulllisting.find("a.listinglink").attr("id"); ... In the above code, the callback function doesn't seem to get invoked. The second problem spot is when the "getJSON" function is called: $.getJSON(href, function(data) { if (data.error.length > 0) { //display error message } else { ... } In this case - it just seems to follow the link instead of performing the callback... and yes, I am doing a "return false;" at the end of all of this to prevent the link from executing. All of the rest of the code is inline on that page if you want to view the source code. Any ideas?? Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to make Processes Run Parallel in Erlang?

    - by Ankit S
    Hello, startTrains() -> TotalDist = 100, Trains = [trainA,trainB ], PID = spawn(fun() -> train(1,length(Trains)) end), [ PID ! {self(),TrainData,TotalDist} || TrainData <- Trains], receive {_From, Mesg} -> error_logger:info_msg("~n Mesg ~p ~n",[Mesg]) after 10500 -> refresh end. so, I created Two Processes named trainA, trainB. I want to increment these process by 5 till it gets 100. I made different processes to make each of the train (process) increments its position parallely. But I was surprised to get the output sequentially i.e process trainA ends then process trainB starts. But I want to increment themselves at simultaneously. I want to run processes like this trainA 10 trainB 0 trainA 15 trainB 5 .... trainA 100 trainB 100 but I m getting trainA 0 .... trainA 90 trainA 95 trainA 100 trainA ends trainB 0 trainB 5 trainB 10 ..... trainB 100 How to make the processes run parallel/simultaneously? Hope you get my Q's. Please help me.

    Read the article

  • Can this method to convert a name to proper case be improved?

    - by Kelsey
    I am writing a basic function to convert millions of names (one time batch process) from their current form, which is all upper case, to a proper mixed case. I came up with the following so far: public string ConvertToProperNameCase(string input) { TextInfo textInfo = new CultureInfo("en-US", false).TextInfo; char[] chars = textInfo.ToTitleCase(input.ToLower()).ToCharArray(); for (int i = 0; i + 1 < chars.Length; i++) { if ((chars[i].Equals('\'')) || (chars[i].Equals('-'))) { chars[i + 1] = Char.ToUpper(chars[i + 1]); } } return new string(chars);; } It works in most cases such as: JOHN SMITH - John Smith SMITH, JOHN T - Smith, John T JOHN O'BRIAN - John O'Brian JOHN DOE-SMITH - John Doe-Smith There are some edge cases that do no work like: JASON MCDONALD - Jason Mcdonald (Correct: Jason McDonald) OSCAR DE LA HOYA - Oscar De La Hoya (Correct: Oscar de la Hoya) MARIE DIFRANCO - Marie Difranco (Correct: Marie DiFranco) These are not captured and I am not sure if I can handle all these odd edge cases. Can anyone think of anything I could change or add to capture more edge case? I am sure there are tons of edge cases I am not even thinking of as well. All casing should following North American conventions too meaning that if certain countries expect a specific capitalization format, and that differs from the North American format, then the North American format takes precedence.

    Read the article

  • Why are my attempts to open a file using open for writing failing? Ada 95

    - by mat_geek
    When I attempt to open a file to write to I get an Ada.IO_Exceptions.Name_Error. The procedure call is Ada.Text_IO.Open The file name is "C:\CC_TEST_LOG.TXT". This file does not exist. This is on Windows XP on an NTFS partition. The user has permissions to create and write to the directory. The filename is well under the WIN32 max path length. name_2 : String := "C:\CC_TEST_LOG.TXT" if name_2'last > name_2'first then begin Ada.Text_IO.Open(file, Ada.Text_IO.Out_File, name_2); Ada.Text_IO.Put_Line( "CC_Test_Utils: LogFile: ERROR: Open, File " & name_2); return; exception when The_Error : others => Ada.Text_IO.Put_Line( "CC_Test_Utils: LogFile: ERROR: Open Failed; " & Ada.Exceptions.Exception_Name(The_Error) & ", File " & name_2); end; end if;

    Read the article

  • Scalaz: request for use case for Cokleisli composition

    - by oxbow_lakes
    This question isn't meant as flame-bait! As it might be apparent, I've been looking at Scalaz recently. I'm trying to understand why I need some of the functionality that the library provides. Here's something: import scalaz._ import Scalaz._ type NEL[A] = NonEmptyList[A] val NEL = NonEmptyList I put some println statements in my functions to see what was going on (aside: what would I have done if I was trying to avoid side effects like that?). My functions are: val f: NEL[Int] => String = (l: NEL[Int]) => {println("f: " + l); l.toString |+| "X" } val g: NEL[String] => BigInt = (l: NEL[String]) => {println("g: " + l); BigInt(l.map(_.length).sum) } Then I combine them via a cokleisli and pass in a NEL[Int] val k = cokleisli(f) =>= cokleisli(g) println("RES: " + k( NEL(1, 2, 3) )) What does this print? f: NonEmptyList(1, 2, 3) f: NonEmptyList(2, 3) f: NonEmptyList(3) g: NonEmptyList(NonEmptyList(1, 2, 3)X, NonEmptyList(2, 3)X, NonEmptyList(3)X) RES: 57 The RES value is the character count of the (String) elements in the final NEL. Two things occur to me: How could I have known that my NEL was going to be reduced in this manner from the method signatures involved? (I wasn't expecting the result at all) What is the point of this? Can a reasonably simple and easy-to-follow use case be distilled for me? This question is a thinly-veiled plea for some lovely person like retronym to explain how this powerful library actually works.

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • Java: volatile guarantees and out-of-order execution

    - by WizardOfOdds
    Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

    Read the article

  • funny behavior of jquery code

    - by user253530
    Funny thing is that if i delete the comment for alert(data[i].id) the code works. As it is in the example, the string is not concatenated thus i have no options in the select box. Hints? Help? var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(data){ for(var i = 0; i < data.length; i++){ //alert( data[i].id); bookmarkingSites += '<option value = \"' + data[i].id + '\">' + data[i].title + '</option>'; } }); <some more code> -------> toAppend += '<td><select name="sb2" id="sb2">'+ '<option value="'+ data.results[i].bookmark +'">' + data.results[i].bookmark +'</option>' + bookmarkingSites + '</select></td>'; <some more code>

    Read the article

  • Custom Validation Attribute with Custom Model Binder in MVC 2

    - by griegs
    I apologise for the amount of code I have included. I've tried to keep it to a minimum. I'm trying to have a Custom Validator Attribute on my model as well as a Custom Model binder. The Attribute and the Binder work great seperately but if I have both, then the Validation Attribute no longer works. Here is my code snipped for readability. If I leave out the code in global.asax the custom validation fires but not if I have the custom binder enabled. Validation Attribute; public class IsPhoneNumberAttribute : ValidationAttribute { public override bool IsValid(object value) { //do some checking on 'value' here return true; } } Useage of the attribute in my model; [Required(ErrorMessage = "Please provide a contact number")] [IsPhoneNumberAttribute(ErrorMessage = "Not a valid phone number")] public string Phone { get; set; } Custom Model Binder; public class CustomContactUsBinder : DefaultModelBinder { protected override void OnModelUpdated(ControllerContext controllerContext, ModelBindingContext bindingContext) { ContactFormViewModel contactFormViewModel = bindingContext.Model as ContactFormViewModel; if (!String.IsNullOrEmpty(contactFormViewModel.Phone)) if (contactFormViewModel.Phone.Length > 10) bindingContext.ModelState.AddModelError("Phone", "Phone is too long."); } } Global asax; System.Web.Mvc.ModelBinders.Binders[typeof(ContactFormViewModel)] = new CustomContactUsBinder();

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • OpenCV to JNI how to make it work?

    - by user293252
    I am tring to use opencv and java for face detection, and in that pursit i found this "JNI2OPENCV" file....but i am confused on how to make it work, can anyone help me? http://img519.imageshack.us/img519/4803/askaj.jpg and the following is the FaceDetection.java class JNIOpenCV { static { System.loadLibrary("JNI2OpenCV"); } public native int[] detectFace(int minFaceWidth, int minFaceHeight, String cascade, String filename); } public class FaceDetection { private JNIOpenCV myJNIOpenCV; private FaceDetection myFaceDetection; public FaceDetection() { myJNIOpenCV = new JNIOpenCV(); String filename = "lena.jpg"; String cascade = "haarcascade_frontalface_alt.xml"; int[] detectedFaces = myJNIOpenCV.detectFace(40, 40, cascade, filename); int numFaces = detectedFaces.length / 4; System.out.println("numFaces = " + numFaces); for (int i = 0; i < numFaces; i++) { System.out.println("Face " + i + ": " + detectedFaces[4 * i + 0] + " " + detectedFaces[4 * i + 1] + " " + detectedFaces[4 * i + 2] + " " + detectedFaces[4 * i + 3]); } } public static void main(String args[]) { FaceDetection myFaceDetection = new FaceDetection(); } } CAn anyone tell me how can i make this work on Netbeans?? I tried Google but help on this particular topic is very meger. I have added the whole folder as Llibrary in netbeans project and whe i try to run the file i get the followig wrroes. Exception in thread "main" java.lang.UnsatisfiedLinkError: FaceDetection.JNIOpenCV.detectFace(IILjava/lang/String;Ljava/lang/String;)[I at FaceDetection.JNIOpenCV.detectFace(Native Method) at FaceDetection.FaceDetection.<init>(FaceDetection.java:19) at FaceDetection.FaceDetection.main(FaceDetection.java:29) Java Result: 1 BUILD SUCCESSFUL (total time: 2 seconds) CAn anyone tell me the exact way to work with this? like what all i have to do?

    Read the article

  • JQUERY, AutoSuggest that doesn't kill the Server on ever keyup

    - by nobosh
    I'm working to build a JQUERY enabled AutoSuggest plugin, inspired by Apple's spotlight. Here is the general code: $(document).ready(function() { $('#q').bind('keyup', function() { if( $(this).val().length == 0) { // Hide the q-suggestions box $('#q-suggestions').fadeOut(); } else { // Show the AJAX Spinner $("#q").css("background-image","url(/images/ajax-loader.gif)"); $.ajax({ url: '/search/spotlight/', data: {"q": $(this).val()}, success: function(data) { $('#q-suggestions').fadeIn(); // Show the q-suggestions box $('#q-suggestions').html(data); // Fill the q-suggestions box // Hide the AJAX Spinner $("#q").css("background-image","url(/images/icon-search.gif)"); } }); } }); The issue I want to solve well & elegantly, is not killing the sever. Right now the code above hits the server every time you type a key and does not wait for you to essentially finish typing. What's the best way to solve this? A. Kill previous AJAX request? B. Some type of AJAX caching? C. Adding some type of delay to only submit .AJAX() when the person has stopped typing for 300ms or so? Thanks

    Read the article

  • System.OutOfMemoryException was thrown. at Go60505(RegexRunner ) at System.Text.RegularExpressions.C

    - by Deanvr
    Hi All, I am a c# dev working on some code for a website in vb.net. We use a lot of caching on a 32bit iss 6 win 2003 box and in some cases run into OutOfMemoryException exceptions. This is the code I trace it back to and would like to know if anyone else has has this... Public Sub CreateQueryStringNodes() 'Check for nonstandard characters' Dim key As String Dim keyReplaceSpaces As String Dim r As New Regex("^[-a-zA-Z0-9_]+$", RegexOptions.Compiled) For Each key In HttpContext.Current.Request.Form If Not IsNothing(key) Then keyReplaceSpaces = key.Replace(" ", "_") If r.IsMatch(keyReplaceSpaces) Then CreateNode(keyReplaceSpaces, HttpContext.Current.Request(key)) End If End If Next For Each key In HttpContext.Current.Request.QueryString If Not IsNothing(key) Then keyReplaceSpaces = key.Replace(" ", "_") If r.IsMatch(keyReplaceSpaces) Then CreateNode(keyReplaceSpaces, HttpContext.Current.Request(key).Replace("--", "-")) End If End If Next End Sub .NET Framework Version:2.0.50727.3053; ASP.NET Version:2.0.50727.3053 error: Exception of type 'System.OutOfMemoryException' was thrown. at Go60505(RegexRunner ) at System.Text.RegularExpressions.CompiledRegexRunner.Go() at System.Text.RegularExpressions.RegexRunner.Scan(Regex regex, String text, Int32 textbeg, Int32 textend, Int32 textstart, Int32 prevlen, Boolean quick) at System.Text.RegularExpressions.Regex.Run(Boolean quick, Int32 prevlen, String input, Int32 beginning, Int32 length, Int32 startat) at System.Text.RegularExpressions.Regex.IsMatch(String input) at Xcite.Core.XML.Write.CreateQueryStringNodes() at Xcite.Core.XML.Write..ctor(String IncludeSessionAndPostedData) at mysite._Default.Page_Load(Object sender, EventArgs e) at System.Web.UI.Control.OnLoad(EventArgs e) at System.Web.UI.Control.LoadRecursive() at thanks

    Read the article

< Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >