Search Results

Search found 19975 results on 799 pages for 'disk queue length'.

Page 670/799 | < Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >

  • Custom Validation Attribute with Custom Model Binder in MVC 2

    - by griegs
    I apologise for the amount of code I have included. I've tried to keep it to a minimum. I'm trying to have a Custom Validator Attribute on my model as well as a Custom Model binder. The Attribute and the Binder work great seperately but if I have both, then the Validation Attribute no longer works. Here is my code snipped for readability. If I leave out the code in global.asax the custom validation fires but not if I have the custom binder enabled. Validation Attribute; public class IsPhoneNumberAttribute : ValidationAttribute { public override bool IsValid(object value) { //do some checking on 'value' here return true; } } Useage of the attribute in my model; [Required(ErrorMessage = "Please provide a contact number")] [IsPhoneNumberAttribute(ErrorMessage = "Not a valid phone number")] public string Phone { get; set; } Custom Model Binder; public class CustomContactUsBinder : DefaultModelBinder { protected override void OnModelUpdated(ControllerContext controllerContext, ModelBindingContext bindingContext) { ContactFormViewModel contactFormViewModel = bindingContext.Model as ContactFormViewModel; if (!String.IsNullOrEmpty(contactFormViewModel.Phone)) if (contactFormViewModel.Phone.Length > 10) bindingContext.ModelState.AddModelError("Phone", "Phone is too long."); } } Global asax; System.Web.Mvc.ModelBinders.Binders[typeof(ContactFormViewModel)] = new CustomContactUsBinder();

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • What are some funny loading statements to keep users amused?

    - by Oli
    Nobody likes waiting but unfortunately in the Ajax application I'm working on at the moment, there is one fair-sized pause (1-2 seconds a go) that users have to undergo each and every time they want to load up a chunk of data. I've tried to make the load as interactive as possible. There's an animated GIF alongside a very plain, very dull "Loading..." message. So I thought it might be quite fun to come up with a batch of 50-or-so funny-looking messages and pick from them randomly so the user never knows what they're going to see. The time they would have spent growing impatient is fruitfully used. Here's what I've come up with so far, just to give you an idea. var randomLoadingMessage = function() { var lines = new Array( "Locating the required gigapixels to render...", "Spinning up the hamster...", "Shovelling coal into the server...", "Programming the flux capacitor" ); return lines[Math.round(Math.random()*(lines.length-1))]; } (Yes -- I know some of those are pretty lame -- That's why I'm here :) The funniest I see today will get the prestigious "Accepted Answer" award. Others get votes for participation. Enjoy!!

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • JQUERY, AutoSuggest that doesn't kill the Server on ever keyup

    - by nobosh
    I'm working to build a JQUERY enabled AutoSuggest plugin, inspired by Apple's spotlight. Here is the general code: $(document).ready(function() { $('#q').bind('keyup', function() { if( $(this).val().length == 0) { // Hide the q-suggestions box $('#q-suggestions').fadeOut(); } else { // Show the AJAX Spinner $("#q").css("background-image","url(/images/ajax-loader.gif)"); $.ajax({ url: '/search/spotlight/', data: {"q": $(this).val()}, success: function(data) { $('#q-suggestions').fadeIn(); // Show the q-suggestions box $('#q-suggestions').html(data); // Fill the q-suggestions box // Hide the AJAX Spinner $("#q").css("background-image","url(/images/icon-search.gif)"); } }); } }); The issue I want to solve well & elegantly, is not killing the sever. Right now the code above hits the server every time you type a key and does not wait for you to essentially finish typing. What's the best way to solve this? A. Kill previous AJAX request? B. Some type of AJAX caching? C. Adding some type of delay to only submit .AJAX() when the person has stopped typing for 300ms or so? Thanks

    Read the article

  • Retrieve Flash file post in ASP.NET

    - by Quandary
    Question: In ASP.NET, I retrieve a JPEG-file as Flash post data like this Sub ProcessRequest(ByVal context As HttpContext) Implements IHttpHandler.ProcessRequest context.Response.ContentType = "text/plain" ' Retrieve a bytearray from the post buffer Dim myBuffer As Byte() = context.Request.BinaryRead(Convert.ToInt32(context.Request.InputStream.Length)) System.IO.File.WriteAllBytes("c:\temp\test.jpg", myBuffer) End Sub In Flash, I send it to an asp.net handler like this var jpgSource:BitmapData = cPrint.TakeSnapshot(MovieClip(cGlobals.ccPlanZoomView)); var bmpThisBitmap:Bitmap = new Bitmap(jpgSource); var nQuality:Number = 100; var jpgEncoder:JPGEncoder = new JPGEncoder(nQuality); var jpgStream:ByteArray = jpgEncoder.encode(jpgSource); var header:URLRequestHeader = new URLRequestHeader ("Content-type", "application/octet-stream"); // Make sure to use the correct path to jpg_encoder_download.php var strFileName:String="test.jpg"; var jpgURLRequest:URLRequest = new URLRequest("http://localhost/raumplaner_new/raumplaner_new/cgi-bin/SavePDF.ashx"); //var scriptVars:URLVariables = new URLVariables(); //scriptVars.fn = strFileName; //var myarr:Array= new Array(); //myarr.push(jpgStream); //scriptVars.Files = myarr; jpgURLRequest.requestHeaders.push(header); jpgURLRequest.method = URLRequestMethod.POST; //jpgURLRequest.data = scriptVars; jpgURLRequest.data = jpgStream; var loader:URLLoader = new URLLoader(); loader.dataFormat = URLLoaderDataFormat.BINARY; loader.load(jpgURLRequest); It works but I want to send a few additional variables along, via scriptVars (commented out here). How do I retrieve the JPEG file in that case ? Because if I use parameters, there is no more BinaryRead... Aspecially, how would I read an array of jpeg files (several files) ?

    Read the article

  • Using both chunked transfer encoding and gzip

    - by RadiantHeart
    I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

    Read the article

  • Silverlight: how to use a scroll viewer to wrap a list view without specifying height?

    - by John Nicholas
    I have a control that has a list that varies in length greatly. This control appears in various places meaning that i cannot calculate its position and desired height easily. Moreover all I want is for the scrollviewer to simply size itself according to its parent. currently it insists on sizing itself according to the content. currently when i have a list that exceeds the height of the screen the whole control extends off the bottom and the scrollviewer shows no bar (because it has stretched to the heigth of the contents and so thinks it is not required). I've not included code as the object graph is fairly deep. What i am looking for is a set of conditions that would cause the scrollviewer to resize itself according to its content rather than its parent. I have it working in a similar situation involving grids and datagrids, the unique part of this control is that there is a list containing controls. Any ideas? I would prefer solutions that don't require use of code behind - but im really not in a position to be choosey.

    Read the article

  • Websql to google maps markers

    - by Roy van Neden
    I am busy with my web application for a school project. It has has two pages. The first page uploads the location(latitude and longitude), price, date and kind of fuel. It works and i saved it with websql.(see screenshot) Now i want to get everything out of the web database and put it as a marker on my google maps card. I have my own location already. But i dont know how to get everything from the database to the map as a marker. I'm using jquery mobile/html5/css/javascript only. Code to put it in a array or something else that will work. db.transaction(function(tx){ tx.executeSql('SELECT brandstofsoort, literprijs, datum, latitude, longitude FROM brandstofstatus', [], function (tx, results) { var lengte = results.rows.length, i; for(var i = 0; i< lengte; i++){ var locations = [ [ ], [ ], [ ], [ ], [ ] ]; } // / for loop });// /tx.executeSql });// /db.transaction Thanks in advance!

    Read the article

  • What am I doing wrong with HttpResponse content and headers when downloading a file?

    - by Slauma
    I want to download a PDF file from a SQL Server database which is stored in a binary column. There is a LinkButton on an aspx page. The event handler of this button looks like this: protected void LinkButtonDownload(object sender, EventArgs e) { ... byte[] aByteArray; // Read binary data from database into this ByteArray // aByteArray has the size: 55406 byte Response.ClearHeaders(); Response.ClearContent(); Response.BufferOutput = true; Response.AddHeader("Content-Disposition", "attachment; filename=" + "12345.pdf"); Response.ContentType = "application/pdf"; using (BinaryWriter aWriter = new BinaryWriter(Response.OutputStream)) { aWriter.Write(aByteArray, 0, aByteArray.Length); } } A "File Open/Save dialog" is offered in my browser. When I store this file "12345.pdf" to disk, the file has a size of 71523 Byte. The additional 16kB at the end of the PDF file are the HTML code of my page (as I can see when I view the file in an editor). I am confused because I was believing that ClearContent and ClearHeaders would ensure that the page content is not sent together with the file content. What am I doing wrong here? Thanks for help!

    Read the article

  • How do I DRY up my CouchDB views?

    - by James A. Rosen
    What can I do to share code among views in CouchDB? Example 1 -- utility methods Jesse Hallett has some good utility methods, including function dot(attr) { return function(obj) { return obj[attr]; } } Array.prototype.map = function(func) { var i, r = [], for (i = 0; i < this.length; i += 1) { r[i] = func(this[i]); } return r; }; ... Where can I put this code so every view can access it? Example 2 -- constants Similarly for constants I use in my application. Where do I put MyApp = { A_CONSTANT = "..."; ANOTHER_CONSTANT = "..."; }; Example 3 -- filter of a filter: What if I want a one view that filters by "is this a rich person?": function(doc) { if (doc.type == 'person' && doc.net_worth > 1000000) { emit(doc.id, doc); } } and another that indexes by last name: function(doc) { if (doc.last_name) { emit(doc.last_name, doc); } } How can I combine them into a "rich people by last name" view? I sort of want the equivalent of the Ruby my_array.select { |x| x.person? }.select { |x| x.net_worth > 1,000,000 }.map { |x| [x.last_name, x] } How can I be DRYer?

    Read the article

  • Java: volatile guarantees and out-of-order execution

    - by WizardOfOdds
    Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • How to mmap the stack for the clone() system call on linux?

    - by Joseph Garvin
    The clone() system call on Linux takes a parameter pointing to the stack for the new created thread to use. The obvious way to do this is to simply malloc some space and pass that, but then you have to be sure you've malloc'd as much stack space as that thread will ever use (hard to predict). I remembered that when using pthreads I didn't have to do this, so I was curious what it did instead. I came across this site which explains, "The best solution, used by the Linux pthreads implementation, is to use mmap to allocate memory, with flags specifying a region of memory which is allocated as it is used. This way, memory is allocated for the stack as it is needed, and a segmentation violation will occur if the system is unable to allocate additional memory." The only context I've ever heard mmap used in is for mapping files into memory, and indeed reading the mmap man page it takes a file descriptor. How can this be used for allocating a stack of dynamic length to give to clone()? Is that site just crazy? ;) In either case, doesn't the kernel need to know how to find a free bunch of memory for a new stack anyway, since that's something it has to do all the time as the user launches new processes? Why does a stack pointer even need to be specified in the first place if the kernel can already figure this out?

    Read the article

  • Opengl-es draw an .obj file, but how?

    - by lacas
    I d like to parse an .obj file. My parser is working good, but my displaying is not good. Obj file is here my code is: public ObjModelParser parse() { long startTime = System.currentTimeMillis(); InputStream fileIn = resources.openRawResource(resourceID); BufferedReader buffer = new BufferedReader(new InputStreamReader(fileIn)); String line=""; Log.e("model loader", "Start parsing object " + resourceID); try { while ((line = buffer.readLine()) != null) { StringTokenizer parts = new StringTokenizer(line, " "); int numTokens = parts.countTokens(); if (numTokens == 0) continue; String part = parts.nextToken(); if (part.equals(VERTEX)) { Log.e("v ", line); vertices.add(Float.parseFloat(parts.nextToken())); vertices.add(Float.parseFloat(parts.nextToken())); vertices.add(Float.parseFloat(parts.nextToken())); .... and my displaying code is: draw that model with TRIANGLE_STRIP and gl.glDrawArrays(rendermode, 0, coords.length/dimension); What is the mistake here? edited: file here to show what is my good coords from my program for a cube, and what is from .obj file, that never show Thanks, Leslie

    Read the article

  • Paypal sandbox account in dotnet: "IPN Response invalid"

    - by Sam
    I am integrating Paypal with my website. I use a sandbox account, one buyer account and one seller account. I downloaded the code below from Paypal: string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } When I add this snippet in my pageload event of my success page, I show the IPN response as INVALID, but amount is paid successfully. Why is this? Paypal's docs are not clear.

    Read the article

  • change custom mapping - sharp architecture/ fluent nhibernate

    - by csetzkorn
    I am using the sharp architecture which also deploys FNH. The db schema sql code is generated during the testing like this: [TestFixture] [Category("DB Tests")] public class MappingIntegrationTests { [SetUp] public virtual void SetUp() { string[] mappingAssemblies = RepositoryTestsHelper.GetMappingAssemblies(); configuration = NHibernateSession.Init( new SimpleSessionStorage(), mappingAssemblies, new AutoPersistenceModelGenerator().Generate(), "../../../../app/XXX.Web/NHibernate.config"); } [TearDown] public virtual void TearDown() { NHibernateSession.CloseAllSessions(); NHibernateSession.Reset(); } [Test] public void CanConfirmDatabaseMatchesMappings() { var allClassMetadata = NHibernateSession.GetDefaultSessionFactory().GetAllClassMetadata(); foreach (var entry in allClassMetadata) { NHibernateSession.Current.CreateCriteria(entry.Value.GetMappedClass(EntityMode.Poco)) .SetMaxResults(0).List(); } } /// <summary> /// Generates and outputs the database schema SQL to the console /// </summary> [Test] public void CanGenerateDatabaseSchema() { System.IO.TextWriter writeFile = new StreamWriter(@"d:/XXXSqlCreate.sql"); var session = NHibernateSession.GetDefaultSessionFactory().OpenSession(); new SchemaExport(configuration).Execute(true, false, false, session.Connection, writeFile); } private Configuration configuration; } I am trying to use: using FluentNHibernate.Automapping; using xxx.Core; using SharpArch.Data.NHibernate.FluentNHibernate; using FluentNHibernate.Automapping.Alterations; namespace xxx.Data.NHibernateMaps { public class x : IAutoMappingOverride<x> { public void Override(AutoMapping<Tx> mapping) { mapping.Map(x => x.text, "text").CustomSqlType("varchar(max)"); mapping.Map(x => x.url, "url").CustomSqlType("varchar(max)"); } } } To change the standard mapping of strings from NVARCHAR(255) to varchar(max). This is not picked up during the sql schema generation. I also tried: mapping.Map(x = x.text, "text").Length(100000); Any ideas? Thanks. Christian

    Read the article

  • Deserializing a FileStream on Client using WCF

    - by Grandpappy
    I'm very new to WCF, so I apologize in advance if I misstate something. This is using .NET 4.0 RC1. Using WCF, I am trying to deserialize a response from the server. The base response has a Stream as its only MessageBodyMember. public abstract class StreamedResponse { [MessageBodyMember] public Stream Stream { get; set; } public StreamedResponse() { this.Stream = Stream.Null; } } The derived versions of this class are actually what's serialized, but they don't have a MessageBodyMember attribute (they have other base types such as int, string, etc listed as MessageHeader values). [MessageContract] public class ChildResponse : StreamedResponse { [DataMember] [MessageHeader] public Guid ID { get; set; } [DataMember] [MessageHeader] public string FileName { get; set; } [DataMember] [MessageHeader] public long FileSize { get; set; } public ChildResponse() : base() { } } The Stream is always a FileStream, in my specific case (but may not always be). At first, WCF said FileStream was not a known type, so I added it to the list of known types and now it serializes. It also appears, at first glance, to deserialize it on the client's side (it's the FileStream type). The problem is that it doesn't seem to be usable. All the CanRead, CanWrite, etc are false, and the Length, Position, etc properties throw exceptions when being used. Same with ReadByte(). What am I missing that would keep me from getting a valid FileStream?

    Read the article

  • Using jQuery to parse an RSS feed, having trouble in firefox and chrome.

    - by sjmarshy
    I used a jQuery library called jFeed to parse and display my blogs rss feed on my personal website. It worked perfectly well at first, but upon checking later it simply displays nothing, except in Internet Explorer, where it seems to work fine. After checking the javascript console using Firebug in Firefox, it shows an error in the 'XML' tab as follows: XML Parsing Error: no element found Location: moz-nullprincipal:{3f8a0c62-32b4-4f63-b69c- 9ef402b40b64} Line Number 1, Column 1: ^ Though I have no idea what to do with this information. Here is the code I used to get the rss feed and display it (it is almost exactly the same as the example provided by the jFeed website): jQuery.getFeed({ url: 'http://sammarshalldesign.co.uk/blog/wordpress/?feed=rss2', success: function(feed) { var html = ''; for(var i = 0; i < feed.items.length && i < 5; i++) { var item = feed.items[i]; html += '<h3>' + '<a href="' + item.link + '">' + item.title + '</a>' + '</h3>'; html += '<div>' + item.description + '</div>'; }//end for jQuery('#feed').append(html); }//end feed function });//end getfeed Any help would be really appreciated.

    Read the article

  • changing background on JLabel shifts components

    - by Aly
    Hi, The code I am using is: public class Test extends JFrame implements ActionListener{ private static final Color TRANSP_WHITE = new Color(new Float(1), new Float(1), new Float(1), new Float(0.5)); private static final Color TRANSP_RED = new Color(new Float(1), new Float(0), new Float(0), new Float(0.1)); private static final Color[] COLORS = new Color[]{ TRANSP_RED, TRANSP_WHITE}; private int index = 0; private JLabel label; private JButton button; public Test(){ super(); setLayout(new BoxLayout(getContentPane(), BoxLayout.Y_AXIS)); label = new JLabel("hello world"); label.setOpaque(true); label.setBackground(TRANSP_WHITE); getContentPane().add(label); button = new JButton("Click Me"); button.addActionListener(this); getContentPane().add(button); pack(); setVisible(true); } @Override public void actionPerformed(ActionEvent e) { if(e.getSource().equals(button)){ label.setBackground(COLORS[index % (COLORS.length )]); index ++; } } public static void main(String[] args) { new Test(); } } When I click the button to change the labales color the GUI looks like this: Before: After: Any ideas why?

    Read the article

  • How to convert CMYK to RGB programmatically in indesign.

    - by BBDeveloper
    Hi, I have a CMYK colorspace in indesign, i want to convert that as RGB color space, I got some codes, but I am getting incorrect data. Some of the codes which I tried are given below double cyan = 35.0; double magenta = 29.0; double yellow = 0.0; double black = 16.0; cyan = Math.min(255, cyan + black); //black is from K magenta = Math.min(255, magenta + black); yellow = Math.min(255, yellow + black); l_res[0] = 255 - cyan; l_res[1] = 255 - magenta; l_res[2] = 255 - yellow; @Override public float[] toRGB(float[] p_colorvalue) { float[] l_res = {0,0,0}; if (p_colorvalue.length >= 4) { float l_black = (float)1.0 - p_colorvalue[3]; l_res[0] = l_black * ((float)1.0 - p_colorvalue[0]); l_res[1] = l_black * ((float)1.0 - p_colorvalue[1]); l_res[2] = l_black * ((float)1.0 - p_colorvalue[2]); } return (l_res); } The values are C=35, M = 29, Y = 0, K = 16 in CMYK color space and the correct RGB values are R = 142, G = 148, B = 186. In adobe indesign, using swatches we can change the mode to CMYK or to RGB. But I want to do that programmatically, Can I get any algorithm to convert CMYK to RGB which will give the correct RGB values. And one more question, if the alpha value for RGB is 1 then what will be the alpha value for CMYK? Can anyone help me to solve these issues... Thanks in advance.

    Read the article

  • VB.net Saving an MetaFile / EMF as a bitmap ( .tiff)

    - by pehaada
    Currently I have a third party control that generates a Metafile. I can save the .wmf file to disk with out issue. The problem is how do I render the Metafile as a Tiff file. Currently I have the following code to get my metafile and save it. Dim mf As Metafile = page.GetImage(TXTextControl.Page.PageContent.All) Dim enhMetafileHandle As IntPtr = mf.GetHenhmetafile() Dim h As IntPtr Dim bufferSize As UInteger = GetEnhMetaFileBits(enhMetafileHandle, 0, h) Dim buffer(CInt(bufferSize)) As Byte GetEnhMetaFileBits(enhMetafileHandle, bufferSize, buffer) Dim msMetafileStream As New MemoryStream msMetafileStream.Write(buffer, 0, CInt(bufferSize)) Dim baMetafileData() As Byte baMetafileData = msMetafileStream.ToArray Dim g As Graphics = Graphics.FromImage(mf) mf.Dispose() File.WriteAllBytes("c:\a.wmf", baMetafileData) end sub _ Public Shared Function GetEnhMetaFileBits( ByVal hEMF As System.IntPtr, ByVal nSize As UInteger, ByVal lpData As IntPtr) As UInteger End Function <System.Runtime.InteropServices.DllImportAttribute("gdi32.dll", EntryPoint:="GetEnhMetaFileBits")> _ Public Shared Function GetEnhMetaFileBits(<System.Runtime.InteropServices.InAttribute()> ByVal hEMF As System.IntPtr, ByVal nSize As UInteger, ByVal lpData() As Byte) As UInteger End Function I've tried all sort of IMAGE and Graphic calls and just can't save the meta file as a .tiff. Any suggestions would be great. I even tried to create a new bitmap and draw the metafile onto it. I always end up with a GDI exception being thrown.

    Read the article

  • Get a JQuery function to execute after and independently of onLoad

    - by lewicki
    Is is possible to execute a JQuery function by injecting it into the page? IT CAN'T be attached to the .ready function. The reason is that the user will be uploading an image via iframe. I need JCrop to execute after I display the uploaded image. echo "<script>$('#pictures_step1_right_bottom1', window.parent.document).html('<img id=\"cropbox\" src=\"../../box/" . 'THM' . $filenameAlt . '.jpg' . "\">');</script>"; echo "<script>jQuery(function(){jQuery('#cropbox').Jcrop();});</script>"; This is executed in the iframe that is processing the image. it then sends it to the main page. This does not work however. EDIT: Ended up running a timer: function checkPic() { if($('#cropbox1').length != 0) { jQuery(function() { jQuery('#cropbox1').Jcrop(); }); } timer(); // Check size again after 1 second } function timer(){ var myTimer = setTimeout('checkPic()', 3000); // Check size every 1 second}

    Read the article

  • Why am I getting 'Heap Corruption'?

    - by fneep
    Please don't crucify me for this one. I decided it might be good to use a char* because the string I intended to build was of a known size. I am also aware that if timeinfo-tm_hour returns something other than 2 digits, things are going to go badly wrong. That said, when this function returns VIsual Studio goes ape at me about HEAP CORRUPTION. What's going wrong? (Also, should I just use a stringbuilder?) void cLogger::_writelogmessage(std::string Message) { time_t rawtime; struct tm* timeinfo = 0; time(&rawtime); timeinfo = localtime(&rawtime); char* MessageBuffer = new char[Message.length()+11]; char* msgptr = MessageBuffer; _itoa(timeinfo->tm_hour, msgptr, 10); msgptr+=2; strcpy(msgptr, "::"); msgptr+=2; _itoa(timeinfo->tm_min, msgptr, 10); msgptr+=2; strcpy(msgptr, "::"); msgptr+=2; _itoa(timeinfo->tm_sec, msgptr, 10); msgptr+=2; strcpy(msgptr, " "); msgptr+=1; strcpy(msgptr, Message.c_str()); _file << MessageBuffer; delete[] MessageBuffer; }

    Read the article

  • can't write to physical drive in win 7??

    - by matt
    I wrote a disk utility that allowed you to erase whole physical drives. it uses the windows file api, calling : destFile = CreateFile("\\.\PhysicalDrive1", GENERIC_WRITE, FILE_SHARE_READ | FILE_SHARE_WRITE, NULL, OPEN_EXISTING,createflags, NULL); and then just calling WriteFile, and making sure you write in multiples of sectors, i.e. 512 bytes. this worked fine in the past, on XP, and even on the Win7 RC, all you have to do is make sure you are running it as an administrator. but now I have retail Win7 professional, it doesn't work anymore! the drives still open fine for writing, but calling WriteFile on the successfully opened Drive now fails! does anyone know why this might be? could it have something to do with opening it with shared flags? this is always what I have done before, and its worked. could it be that something is now sharing the drive? blocking the writes? is there some way to properly "unmount" A drive, or atleast the partitions on it so that I would have exclusive access to it? some other tools that used to work don't any more either, but some do, like the WD Diagnostic's erase functionality. and after it has erased the drive, my tool then works on it too! leading me to belive there is some "unmount" process I need to be doing to the drive first, to free up permission to write to it. Any ideas?

    Read the article

< Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >