Search Results

Search found 30884 results on 1236 pages for 'javascript module'.

Page 678/1236 | < Previous Page | 674 675 676 677 678 679 680 681 682 683 684 685  | Next Page >

  • How to create a div with jQuery accordion

    - by skdnewbie
    Im using this: <script> $(function() { $( "#accordion" ).accordion(); }); </script> To get the effect of expand/collapse. (If you know a better plugin or method, pls notice me) I have this div: <div id ="accordion"></div> And this code to create a button inside that div. (dont worry about the content of button) $('#button_submit').click(function() { $("#accordion").append( $("<button id=saved"+j+">").click(function() { drawChart.apply(null, myArray); }).html("<b>Start date:</b>"+""+myArray[0]+"\n<b>End date:</b>"+myArray[1]+"\n<b>Chart type:</b>"+myArray[2]+"") ); My question is, how to create/format div accordion to have this effect accordion effect jquery . being that the <button id=saved"+j+"> should appear inside the sections. Cheers

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • jQuery center multiple dynamic images in different sized containers

    - by JVK Design
    So I've found similar questions but none that answer all the questions I have and I know there must be a simple jQuery answer to this. I've got multiple images that are being dynamically placed in their own containing div that have overflow:hidden, they need to fill their containing divs and be centered(horizontally and vertically) also. The containing divs will be different sizes as well. So in short: multiple different sized images fill and center in containing div. containing divs will be different sizes. will be used multiple times on a page. Hopefully this image helps explain what I'm after. Click here to view the image. HTML I'm using but can be changed <div class="imageHolder"> <div class="first SlideImage"> <img src="..." alt="..."/> </div> <div class="second SlideImage"> <img src="..." alt="..."/> </div> <div class="third SlideImage"> <img src="..." alt="..."/> </div> </div> And the CSS .imageHandler{ float:left; width:764px; height:70px; margin:1px 0px 0px; } .imageHolder .SlideImage{ float:left; position:relative; overflow:hidden; } .imageHolder .SlideImage img{ position:absolute; } .imageHolder .first.SlideImage{ width:381px; height:339px; margin-right:1px; } .imageHolder .second.SlideImage{margin-bottom:1px;} .imageHolder .second.SlideImage, .imageHolder .third.SlideImage { width: 382px; height: 169px; } Ask me anything if this doesn't make sense, thanks in advance

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • How to add visible menu item from php code (drupal)

    - by uta
    I have a content type with important "created" date field. And I have a menu link (in primary links) which is link to page that shows list of all nodes of my content type. (http://example.com/mycontenttype) I want to have menu links (visible in primary links) to each year when nodes of my content type are displayed (http://example.com/mycontenttype/2010). And I want to add these menu links from mymodule_nodeapi function, when the node is creating and only if it has a "created" date of new year. I know that I can create a pathes in mymodule_menu function, but it doesn't create a visible menu item. (Maybe I can somehow set parent_link_id or something else to do it?)

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • Call a function every hour

    - by user2961971
    I am trying to update information from a weather service on my page. The info should be updated every hour on the hour. How exactly do I go about calling a function on the hour every hour? I kind of had an idea but im not sure of how to actually refine it so it works... What I had in mind was something like creating an if statement, such as: (pseudo code) //get the mins of the current time var mins = datetime.mins(); if(mins == "00"){ function(); }

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

< Previous Page | 674 675 676 677 678 679 680 681 682 683 684 685  | Next Page >