Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

Page 683/1183 | < Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >

  • How to set focus to a control inside frame

    - by Geetha
    Hi All, i am using two frames in a page. Mainframe have a page with text box to get input and gives the result url. Needs: I want to show this page in the topframe. I want to set focus to the text box control in the mainframe always. using the following code but giving null error. parent.frames['mainFrame'].document.getElementById('form1:txtbox').focus(); <frameset rows="550,0" cols="1008" frameborder="NO" border="0" framespacing="0"> <frame src="" id="topFrame" target="topFrame" runat="server" scrolling="no"></frame> <frame src="Search.aspx" runat="server" id="mainFrame"></frame> </frameset>

    Read the article

  • Is jQuery modular? How to trim it down?

    - by usr
    Uncompressed, jQuery is 160KB in size. I did not see a way to exclude seldomly used parts of it like with jQuery UI. How can I reduce the (compressed and minified) file size of jQuery? I am quite concerned because dial-up lines and slow machines/browsers are very common among users of my site.

    Read the article

  • jQuery trigger custom event synchronously?

    - by Miguel Angelo
    I am using the jQuery trigger method to call an event... but it behaves inconsistently. Sometimes it call the event, sometimes it does not. <a href="#" onclick=" $(this).trigger('custom-event'); window.location.href = 'url'; return false; ">text</a> The custom-event has lots of listeners added to it. It is as if the trigger method is not synchronous, allowing the window.location.href be changed before executing the events. And when window.location.href is changed a navigation occurs, interrupting everything. How can I trigger events synchronously? Using jQuery 1.8.1. Thanks! EDIT I have found that the event, when called has a stack trace like this: jQuery.fx.tick (jquery-1.8.1.js:9021) tick (jquery-1.8.1.js:8499) jQuery.Callbacks.self.fireWith (jquery-1.8.1.js:1082) jQuery.Callbacks.fire (jquery-1.8.1.js:974) jQuery.speed.opt.complete (jquery-1.8.1.js:8991) $.customEvent (myfile.js:28) This proves that jQuery trigger method is asynchronous. Oohhh my... =\

    Read the article

  • Facebook API - Detect if session is active OR NOT active

    - by Tom Doe
    I'm sure I'm simply overlooking something in the Facebook API docs. Basically, after I've loaded the FB Graph, I need to know if the session is active... I cannot simply assume they're logged out and simply re-render if they're logged in once the 'auth.statusChange' event is triggered. I need to know right off the bat. Below is the code that I've used. Most importantly the FB.getLoginStatus/getAuthResponse/getAccessToken don't work like I'd expect; essentially where it indicates, when invoked, whether they're logged in or out. (function(d) { // Create fb-root var fb_root = document.createElement('div'); fb_root.id = "fb-root"; document.getElementsByTagName('body')[0].appendChild( fb_root ); // Load FB Async var js, id = 'facebook-jssdk', ref = d.getElementsByTagName('script')[0]; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; ref.parentNode.insertBefore(js, ref); // App config-data var config = { appId : XXXX, cookie: true, status: true, frictionlessRequests: true }; window.fbAsyncInit = function() { // This won't work. // I can't assume they're logged out and rely on this to tell me they're logged in. FB.Event.subscribe('auth.statusChange', function(response) {}); // Init FB.init(config); // These do not inidicate if the user is logged out :( FB.getLoginStatus(function(response) { }); FB.getAuthResponse(function(response) { }); FB.getAccessToken(function(response) { }); }; }(document)); Any help is much appreciated. :)

    Read the article

  • Creating a page selector with JSP/JSTL

    - by zakSyed
    I am working on a project where I am required to build a page somewhat similar to the one you see when you visit a website like blockbuster. When you click on browse more you are taken to a page with a bar on top with different page numbers and a drop down to select the number of pages you want to view on that page. I want to include a feature like that on my page but I am not sure where to start. In my page I have list of 200 items which I want to display page by page. I was suggested to use custom tags, but is there a more simpler or efficient way to create that functionality. My web application uses Spring MVC framework and is coded entirely in Java. Any suggestions will be appreciated.

    Read the article

  • The SVG text node disappear after change its text content

    - by sureone
    svg: <text xml:space="preserve" y="228" x="349.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_b">cur_b</text> <text xml:space="preserve" y="222" x="103.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_a">cur_a</text> <text xml:space="preserve" y="229" x="590.0211" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_c">cur_c</text> NSString* theJS = @ "var theNode0 = document.getElementById('cur_a'); theNode0.textContent='200A'; theNode0.setAttribute('fill','#FF0000'); var theNode1 = document.getElementById('cur_c'); theNode1.textContent='200A'; theNode1.setAttribute('fill','#00FF00');" [self.webView stringByEvaluatingJavaScriptFromString:theJS]; The SVG text node value is changed but disappeared after about one second.

    Read the article

  • Any alternative to jQuery change() to detect when user selects new file via dialog box in IE8?

    - by ecu
    I am unable to detect when input type="file" changes its value after user selects file and the dialog box closes. $('.myInput').change(function(){ alert($(this).val()); }) Above jQuery code works perfectly in all browsers apart from IE. For some reason IE detects the change only after input field loses focus. Is there a way to detect the change immediately after dialog box closes? Or maybe to force input field to lose focus after dialog box closes so IE can detect it? I'm puzzled. Thanks for any help.

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • More compact way to do this?

    - by Macha
    I have a couple of functions that loop around the surrounding cells of a cell. The grid is contained inside an array. In my code, I have checks to make sure it's not one of the edge cells, as checking an undefined cell causes an error. As such, I have code like this: if(x > 0) { var firstX = x - 1; } else { var firstX = x; } if(x < 199) { var lastX = x + 1; } else { var lastX = x; } if(y > 0) { var firstY = y - 1; } else { var firstY = y; } if(y < 199) { var lastY = y + 1; } else { var lastY = y; } A lot of lines of code to do very little. Is there a more elegant way to do this?

    Read the article

  • Why ajax doesn't work unless I refresh or use location.href?

    - by Connor Tang
    I am working on a html project, which will eventually package by Phonegap. So I am trying to encode the data from html form to JSON format, then use ajax send to a php file resides on server, and receive the response to do something else. Now I use <a href='login.html'> in my index.html to open the login page. In my login page, I have this <script> $(document).ready(function(e) { $('#loginform').submit(function(){ var jData = { "email": $('#emailLogin').val(), "password": $('#Password').val()}; $.ajax({ url: 'PHP/login.php', type:'POST', data: jData, dataType: 'json', async: false, error: function(xhr,status){ //reload(); location.href='index.html'; alert('Wrong email and password'); }, success: function(data){ if(data[1] == 1){ var Id_user = data[0]; location.href='loginSuccess.html'; } } }); }); }); </script> to send my data to server. But I found that it won't work, it's still in the login page. I tried to enter data and submit again, it's still nothing happen. Until I refresh the login page and enter data again, it can give an error message or go to the loginsuccess page. However, when I use <script> function loadLogin(){ location.href='login.html'; } </script> to open the login page, everything works well. So what cause this? How can I modify this piece of code to make it better?

    Read the article

  • Checking for multiple images loaded

    - by Stanni
    Hi, I'm using the canvas feature of html5. I've got some images to draw on the canvas and I need to check that they have all loaded before I can use them. I have declared them inside an array, I need a way of checking if they have all loaded at the same time but I am not sure how to do this. Here is my code: var color = new Array(); color[0] = new Image(); color[0].src = "green.png"; color[1] = new Image(); color[1].src = "blue.png"; Currently to check if the images have loaded, I would have to do it one by one like so: color[0].onload = function(){ //code here } color[1].onload = function(){ //code here } If I had a lot more images, Which I will later in in development, This would be a really inefficient way of checking them all. How would I check them all at the same time?

    Read the article

  • Get backreferences values and modificate these values

    - by roasted
    Could you please explain why im not able to get values of backreferences from a matched regex result and apply it some modification before effective replacement? The expected result is replacing for example string ".coord('X','Y')" by "X * Y". But if X to some value, divide this value by 2 and then use this new value in replacement. Here the code im currently testing: See /*>>1<<*/ & /*>>2<<*/ & /*>>3<<*/, this is where im stuck! I would like to be able to apply modification on backrefrences before replacement depending of backreferences values. Difference between /*>>2<<*/ & /*>>3<<*/ is just the self call anonymous function param The method /*>>2<<*/ is the expected working solution as i can understand it. But strangely, the replacement is not working correctly, replacing by alias $1 * $2 and not by value...? You can test the jsfiddle //string to test ".coord('125','255')" //array of regex pattern and replacement //just one for the example //for this example, pattern matching alphanumerics is not necessary (only decimal in coord) but keep it as it var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { /*==>**1**/ //this one works as usual but dont let me get backreferences values $output.val(inputText.replace(regexes[i][0], regexes[i][2])); /*==>**2**/ //this one should works as i understand it $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][3]; })); /*==>**3**/ //this one is just a test by self call anonymous function $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][4]; }())); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); //HERE i should be able if lets say $1 > 200 divide it by 2 //then returning $1 value if($1 > 200) $1 = parseInt($1 / 2); return $1; }? Sure I'm missing something, but cannot get it! Thanks for your help, regards. EDIT WORKING METHOD: Finally get it, as mentionned by Eric: The key thing is that the function returns the literal text to substitute, not a string which is parsed for backreferences.?? JSFIDDLE So complete working code: (please note as pattern replacement will change for each matched pattern and optimisation of speed code is not an issue here, i will keep it like that) $('#btn').click(function() { testReg($('#input').val(), $('#output')); }); //array of regex pattern and replacement //just one for the example var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { var checkedValues = checkReplace(match, $1, $2, $3, $4); $1 = checkedValues[0]; $2 = checkedValues[1]; regexes[i][1] = regexes[i][1].replace('$1', $1).replace('$2', $2); return regexes[i][1]; })); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); if ($1 > 200) $1 = parseInt($1 / 2); if ($2 > 200) $2 = parseInt($2 / 2); return [$1,$2]; }

    Read the article

  • Checking for length of ul and removing an li element

    - by Legend
    I am trying to remove the last <li> element from a <ul> element only if it exceeds a particular length. For this, I am doing something like this: var selector = "#ulelement" if($(selector).children().length > threshold) { $(selector + " >:last").remove(); } I don't like the fact that I have to use the selector twice. Is there a shorter way to do this? Something like a "remove-if-length-greater-than-threshold" idea. I was thinking that maybe there is a way to do this using the live() function but I have no idea how.

    Read the article

  • jquery dialog popup window problem

    - by kumar
    I have this code $("#window").dialog({ resizable: true, height: 180, title: titles, width: 500, modal: false, buttons: { "OK": function () { $(this).dialog("close"); } } }); i am able to get the popup perfectly but the problem I am getting here is.. On the top of the Dialog box I have 'X' I am not able to see that X on dialog popup's but when I resize my window I can able to see.. what I am doing wrong in this? Thanks for your all help

    Read the article

  • Trouble with Perfect Scrollbar jQuery

    - by coolpup
    I'm using the Perfect Scrollbar jQuery app (http://www.yuiazu.net/perfect-scrollbar/) for this site: http://thehummingbirdplace.com/ The scrollbar shows up when you hover over the News section, but it won't scroll down to reveal the content. I've used this scrollbar before successfully, so I'm stumped as to what is different now. I haven't been able to replicate this on a simpler page, when I experiment on another page it either works or just vanishes, so I'm not sure why it is successfully showing up, yet not scrolling on the main page. Any help would be appreciated!!

    Read the article

  • Add a Click Event to elements added to the DOM

    - by E7AD
    var myOP = '<div>'; for (var i = 0; i < op.length; i++) { myOP += '<div>'; myOP += '<div id="myBTN-' + [i] + '">' + op[i]['Field1'] + '</div>'; myOP += '<div id="blah-' + [i] + '">' + op[i]['Field2'] + '</div>'; myOP += '</div>'; } myOP += '</div>'; $("#myBTN-" + i).click(function () { $('#blah-' + i).toggle("slow"); }); $('#container').html(myOP); I'm trying to get the click function to fire on the elements i'm created w/ the above for loop. Can anyone point me in the right direction?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • Jquery adding events

    - by JBone
    I want to add an event handler to some dynamically added elements. I simplified my problem into the basic code below. I am using the new JQuery 1.7 on feature to say "hey for all labels in the CancelSurvey id element call this notify function when they are clicked." function notify(event) { console.log(event.data.name); } $('#CancelSurvey').on('click', 'label', { name: $(this).attr("id") }, notify); I want to pass the id of the label as parameter "name". When I try to alert this it is undefined (they are defined in the html created). I believe that using the $(this) is not referencing the label selector in this case. It actually seems to be referencing the document itself. Any ideas on how to accomplish this?

    Read the article

< Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >