Search Results

Search found 29575 results on 1183 pages for 'dynamic javascript'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 686/1183 | < Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Pulling .live() functionality out of jQuery

    - by Daniel
    I am writing a Firefox Add-On that currently is depending on jQuery for the following things: Selectors Animations A special .live("focus") hail-mary event-catching maneuver that happens to work with jQuery 1.4.2 (but not 1.4.4) jQuery isn't well suited for functioning inside XUL, and it's a miracle we've gotten this far with it. We're trying to remove the jQuery requirements, the first two are easy (animations are simple, and we can use .querySelector() instead of jQuery), but the .live has proven impossible to do on our own. I've tried reading the source code, but I haven't been able to piece it apart. What is the jQuery .live function doing? There's clearly a lot more going on than document.addEventListener("focus"/"focusin",function_to_pick_apart_events). What else is going on here?

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Prevent initial array from sorting

    - by George
    I have an array where the order of the objects is important for when I finally output the array in a document. However, I'm also sorting the array in a function to find the highest value. The problem is that I after I run the function to find the highest value, I can't get the original sort order of the array back. // html document var data = [75,300,150,500,200]; createGraph(data); // js document function createGraph(data) { var maxRange = getDataRange(data); // simpleEncode() = google encoding function for graph var dataSet = simpleEncode(data,maxRange); } function getDataRange(dataArray) { var num = dataArray.sort(sortNumber); return num[0]; } I've also tried setting data to dataA and dataB and using dataB in the getDataRange function and dataA in the simpleEncode function. Either way, data always end up being sorted from highest to lowest.

    Read the article

  • jQuery plugins: How can I stop divs from overlapping?

    - by anir
    I'm using Masonry and Embedly plugin to display embedded content, I've put together an example in jsfiddle.net/anir/pBtbb/3/ It appears the Masonry plugin loads first and it causes the overlapping problem (they only show correctly when you resize the result window) I've read that I could use callback functions or retrigger Masonry once embedly has finished rendering content, but I don't know how to do it. Can you help me? Is there any other solution to fix this?

    Read the article

  • jQuery - Why doesn't combining has() and gt() work in some cases?

    - by KatieK
    I wanted to select any ul which contains more than 3 lis. This code worked with the 1.2.6 jQuery library: $("ul:has(li:gt(2))") .each( function() { $(this).css("border", "solid red 1px"); }); But not 1.3.2 or 1.4.2. This code worked with the 1.4.2 jQuery library: $('ul').has('li:nth-child(3)').css('border', 'solid red 1px'); But not v1.2.6. Why does each version work with one library version, but not the other? Am I encountering some kind of bug, or am I doing something wrong? Any help understanding , or differences to be aware of between different versions of the jQuery libraries, would be much appreciated. Thanks!

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • css to replace characters in paragraph tag

    - by Thariama
    Already checked exisitng questions for this, but didn't find an exact match. My aim is to replace characters (like spaces) on a webpage with a small image using css. Example: <p><span>This is a text</span></p> becomes: <p><span>ThisIMGisIMGaIMGtext</span></p> (where IMG stands for a visible image (middot-pic for a space f.e.)) I cannot think of a suitable css selector. But myabe one of you guys (or girls) know a solution. Is this possible at all?

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Highlighting search words like Chrome with jQuery

    - by ilkin
    I have recently done a very simple highlighting with jQuery and a highlight plugin. It looks like this: $('myButton').click(function() { $('body').highlight($('#myInputText').val()); }); But I wonder how can I do the Chrome like highlighting, I mean highlight the letters whenever I type in some letter in textbox without submitting. I think maybe use a keyup event... Any ideas?

    Read the article

  • My HTML5 web app crashes and I have no clue how to debug

    - by Shouvik
    Hi All, I have written a word game using HTML5 canvas tag and a little bit of audio. I developed the application on the chrome web browser on a linux system. Recently during the testing phase it was tried on safari 5.0.3 on Mac and the webpage froze. Not just the canvas element, but interactive element on the page froze. I have at some times experienced this problem on google chrome when I was developing but since the console did not throw any error before this happened, I did not give it much credence. Now as per requirements I am supposed to support both chrome and safari but this dismal performance on safari has left me shocked and I cannot see what error can be thrown which might lead to such a situation. Worse yet the CPU usage on using this application peaks to 70-80percent on my 2yr old macbook running ubuntu... I can only but pity the person who uses mac to operate this app, which undoubtedly is a heavier OS. Could someone help me out with a place I can start with to find out what exactly is causing this issue. I have run profiles on this webapp on google chromes console and noticed that in the heap spanshot value increases steadily with the playing of the game, specifically (root) value which jumps up by 900 counts. Any help would be very appreciated! Thanks EDIT: I don't know if this helps, but I have noticed that even on refreshing the page after the app becomes unresponsive the page reloads and I am still not able to interact with the page elements but the tab scroll bar continues to work and I can see my application window completely. So to summaries the tab stops accepting any sort of user interaction inside the page. Edit2: Nop. It doesn't work still... The app crashes on double click on the canvas element. The console is not throwing any errors either! =/ I have noticed this problem is isolated only to safari!

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • nextSibling issue, should be simple

    - by SoLoGHoST
    Ok, I'm trying to come to grips with this nextSibling function in JS. Here's my issue within the following code... var fromRow = document.getElementById("row_1"); while(fromRow.nodeType == 1 && fromRow.nextSibling != null) { var fRowId = fromRow.id; if (!fRowId) continue; // THIS ONLY gets done once and alerts "row_1" ONLY :( alert(fRowId); fromRow = fromRow.nextSibling; } Ok can someone please tell me what is wrong with this code? There are siblings next to this document.getElementById("row_1"); element for sure as I can see them, and they all have id attributes, so why is it not getting the id attributes of the siblings?? I don't get it. row_1 is a TR element, and I need to get the TR elements next to it within this table, but for some reason, it only gets the 1 element that I can already get using document.getElementById, arggg. Thanks guys :)

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • Cannot submit form when disabling JSF page

    - by Steve
    Simple submit button. <h:commandButton actionListener="#{regBean.findReg}" action="#{regBean.navigate}" value="Search" /> The form tag is displayed like so: <h:form onsubmit="this.disabled=true;busyProcess();return true;"> This is so if the submit button is pressed, the page shows a "busy" icon until request is processed. The problem is, the request is never submitted and it never reaches the backend. However, if I instead take out the "disabled" call like so: <h:form onsubmit="busyProcess();return true;"> Everything works. Any ideas?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 682 683 684 685 686 687 688 689 690 691 692 693  | Next Page >