Search Results

Search found 18146 results on 726 pages for 'jquery calculation'.

Page 683/726 | < Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >

• String.Format in javascript?

  - by chobo2

  Hi this is driving me nuts. I believe I asked this exact same question but I can't find it anymore(I used stackoverflow search, google search, manually searched my posts, searched my code). I wanted something that would be like the C# String.Format where you could do something like string format = String.Format("Hi {0}",name); just for javascript of course and one person gave me a simple answer it was not like a jquery plugin or anything but I think you made some json thing or something and it worked and was simple to use. I for the life of me can't find this post.

  Read the article

• What is the easiest way to send a Javascript array via JSON to PHP?

  - by dscher

  I have a few arrays that I want to send to process with PHP. Using json2.js I will stringify the arrays like so: var JSONlinks = JSON.stringify(link_array); var JSONnotes = JSON.stringify(note_array); but then I'm confused. Do I need to use a XMLHttpRequest object? Is there another way? If that is the simplest way, could someone please just share the most basic instance of the code needed in order to send to PHP where I can then use JSON decode? I think it might help others in the future really. I'm currently using Jquery and I know there are many options out there for frameworks and each one may or may not make this process any easier. If you're using a framework in your reply please mention why you'd choose that framework rather than just javascript.

  Read the article

• Unneded number combination after replacing a number in a string.

  - by ne5tebiu

  I get an unneeded number combination. 3, 4, 5, 6, 7, 8, 901234567890123456789, 30 Should be: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12... (till) 30 Why that happens? The code: <? ob_start(); $id=$_GET['id']; if (!empty($id)){ $id=str_replace('a9_','', $id); $value=$_COOKIE['NaudingasURL']; $exp = explode(", ", $value); if(in_array($id, $exp)){ $value2=str_replace(', '.$id,"", ', '.$value); $value2=substr($value2, 2, strlen($value2)); echo'r'; } else{ $value2=$value.', '.$id; echo'a'; } setcookie("NaudingasURL", $value2); } ob_end_flush(); ?> I'm calling it with Jquery ajax, but I don't thinks that's the problem.

  Read the article

• Drag and drop an image from desktop to a web text editor (implementation in javascript)

  - by fatmatto

  I tried to write reasonably short title but i failed i guess.. Hi everybody here's what i'm trying to do: I want to implement a web text editor able to recognize when the user drag a image file over it's editing surface and it automa(gically) starts the upload and insert the image near the cursor position. In other words i don't want the user to do the usual "insert-image-browse-ok". Atm i am not very good at javascript ... i know JQuery but i have not a clear idea about how to implement this... i don't know if there's an event handler able to help me in this situation... if not then there should be i think or web apps would miss some kind of interactivity. I've heard miracles about HTML5 could it help me? I've seen such things in Google Wave but that surface doesn't seem to be a form field... google lab's black magic i guess.... Thank you in advance.

  Read the article

• Tomcat JSP(2.0) Document how to stop automaticly closing empty body tags with /> instead of </tagnam

  - by JOKe

  The question is. If I use JSP Documents (or JSP 2.0) and If I put a TAG without a BODY it is automaticly closed I dont want that. so If I have <div id=....> </div> it is automaticly converted to <div id=.../> How I can stop this ? I am using tomcat is there any configuration about that ? P.S. the reason to want to stop it is because it simple "fuckes" the JQuery stuffs that the designer company are using.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Javascript form validation - multiple form fields larger than 0

  - by calebface

  function negativeValues(){ var myTextField = document.getElementById('digit'); if(myTextField.value < 0) { alert("Unable to submit as one field has a negative value"); return false; } } Above is a Javascript piece of code where every time a field id 'digit' has a value that's less than 0, than an alert box appears either onsubmit or onclick in the submit button. There are about 50 fields in the form that should be considered 'digit' fields where they shouldn't be anything less than 0. What should I change with this Javascript to ensure that all 'digit' like fields have this alert box pop up? I cannot use jquery/mootools for validation - it has to be flat Javascript. Thanks.

  Read the article

• Help with method logic in Java, hw

  - by Crystal

  I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

  Read the article

• Backbone.js - Getting JSON back from url

  - by Brian

  While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

  Read the article

• Visual Studio 2008 Unresponsive When Opening JavaScript Files

  - by lush

  I'm starting a new ASP.NET project that I'm trying to use some jQuery with, but whenever I try to open .js file (blank or containing a few lines of javascript) in Visual Studio, it often hangs; showing the .js filename in a new tab, but the actual text editor window showing whatever was drawn to the screen before opening the .js file. Eventually, after closing and re-opening, it will open in the text editor, but the font is always something like 10pt Arial. Even after changing this in VS options, the next re-launch of Visual Studio yields the same results. Has anyone else experienced hang, unresponsiveness, wonkiness from Visual Studio with JavaScript files?

  Read the article

• drupal: so many js and css files ?

  - by Patrick

  hi, I've realized I'm loading a lot of resources (24 css and 17 js files) using Drupal. I've several modules installed and they all come with a css and js file. For my website I'm only using 1 additional js plugin (all the other 16 come with Drupal modules). I've not installed useless modules. They are all necessary, and they require js such as swfobject, ajax_views, jquery.media, spamspan, lightbox (modal, video and default js files), etc Same thing with css files: ckeditor, filefield, lightbox, tagadelic, uploadfield, fieldgroup, vews, taxonomy_super_select, html-element, tabs, messages... etc For my website, I only use my theme css zen.css of course. So.. is this normal ? Or I should remove all this stuff? Are drupal websites normally heavy ? thanks

  Read the article

• JS dynamic img change and SEO

  - by Gusepo

  Hi all, I've built a web site using jquery to make nice transitions between content. The code works this way: there are 2 imgs (body and footer) when I click on a link (instead of going to another page) I fade out the 2 imgs and change the src attribute of the 2. When the new imgs are loaded I fade them back in. I'm using SWFaddress to allow user go directly to internal content. Now I'd like to make my content indexed by google and other Search engines, all the text content is inside the imgs, So I've got the text in ALT attribute. My question is: if a dinamically change the imgs ALT attribute using JS, will spiders be able to read it properly? consider that I'm using SWFaddress to create a sitemap.. Thanks

  Read the article

• CMS + Blog engines for personal website

  - by Shawn Mclean

  I want to create a personal website where I show off my work, write blog posts, etc. I dont want to create my own, but I'm seeking one flexible enough for me to write my own codes for it if needed. For eg, I'd like to create a page with jquery functionality and backend code. Features I'm looking for: Blog engine similiar to wordpress OpenId login (comments, etc) Exporting content in an event I want to switch engines. I have alot of knowledge in .net and small amount in php, so any of these frameworks can work for me.

  Read the article

• django form ModelChoiceField loads all state names while needed states which are mapped with current selected country

  - by Sonu

  I am using modelChoiceField to display country and state into address form class StateSelectionwidget(forms.Select): """ custom widget to state selection""" class Media: js = ('media/javascript/public/jquery-1.5.2.min.js', 'media/javascript/public/countrystateselection.js', ) class AddressForm(forms.Form): name = forms.CharField(max_length=30) country = forms.ModelChoiceField(queryset=[]) state = forms.ModelChoiceField(CountryState.objects, widget=StateSelectionwidget) def __init__(self, *args, **kwargs): super(AddressForm, self).__init__(*args, **kwargs) self.fields['country'].queryset = Country.objects.all() Country model is used to store country names. CountryState model is used to store all states which is foreign key to Country model At the time of form loading i am getting all state names in dropdown while i want field to be blank by default. If name field is empty at the time of form save i am getting error that name can not be empty but also getting all states into dropdown list while i want only the states which are mapped with current selected country.

  Read the article

• What is the preferred way of loading browser-specific CSS files?

  - by Yuval A

  What is the best way to handle browser-specific CSS file loading? Assume you are running in the context of a proper MVC framework. Here are some options, you are free to discuss the pros and cons of these options as well as any other methods you know of, and prefer: Server-side solution: use the controller (e.g. servlet) to analyze the user-agent header in the request and return the proper CSS file in the view. Use browser specific hacks to load files, such as: <!--[if IE]> ... <![endif]--> Load CSS files asynchronously in client side by inspecting user-agent and adding respective files Use a client side framework to handle browser-specifics (such as jQuery browser-specific css rules)

  Read the article

• Advanced search functionality

  - by Chris

  I have a website with a jQuery based autocomplete search functionality which works great. Currently though I have just one search box for all categories, what I want is for someone to be able to type in, say for example, dorian gray dvd (in any order) which will search for dorian gray within the dvd category. What this will require then is a bit of magic on the server side to figure out if any of the words are category keywords, and then limit the search by that. What is the best (and quickest) way to do this in PHP / MySQL? I currently have a few trains of thought Search the category table for matches and perhaps order the results by that. Or split up the search terms into an array and separately search the categories for that for a match. Another thought I just had is to concat the category title to the dvd title in the database and match against that, or something similar... but this sounds computationally expensive? Any advice?

  Read the article

• How to make a cross browser, W3C valid, semantic, non-javascript ROUND corner?

  - by jitendra

  I want to make a cross-browser (FF3, IE6, Safari, Opera), W3C valid (HTML and CSS both), stretchable (horizontally vertically), without JavaScript and with Semantic and lesser HTML markup Round CORNER. Images can be used for IE6. I've tried and tested many techniques available on community. But everything has one of the problems mentioned above . If anyone knows what I want please share with me? Remember I want to make it without any type of JavaScript, jquery or any type of js.

  Read the article

• Ruby on Rails - Send JavaScript to view

  - by Eef

  Hey, I am creating a website in Ruby on Rails. I have a controller action that renders a view like so: def show time_left = Time.now.to_i - 3.hours.to_i @character = current_user.characters.find(params[:id]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @character } end end This is fine as it renders the show.html.erb as I like. I would like however to somehow pass time_left to the view as a Javascript variable as this value is use by a countdown JQuery plugin. I could put a javascript block on the page in the HTML and print a instance variable out like so: <script type="javascript"> $('#countdown').countdown('<%= @time_left =>')</script> But I would like to keep all my JS in a external file and off the page could anyone give some advice on how to implement this? Cheers Eef

  Read the article

• Fading transition slideshow

  - by Simon Carlson

  I've got a JavaScript that produces a slideshow. It loads the pictures before starting the actual slideshow. Code below. var image1=new Image() image1.src="filename1.jpg" var image2=new Image() image2.src="filename2.jpg" var image3=new Image() image3.src="filename3.jpg" var step=1 function slideit(){ if (!document.images) return document.images.slide.src=eval("image"+step+".src") if (step<3) step++ else step=1 setTimeout("slideit()",1000) } And this is the required HTML for it to work: <img src="filename1.jpg" name="slide" /> Now, if I want to have fading transitions instead of just having new pictures popping up, how do I approach this? By fading I mean either have the old picture fade out, the new fade in or possibly and most likely both fade in/out. Can this be achieved with pure JavaScript and no jQuery or Ajax?

  Read the article

• Ajax basic email code without reloading page

  - by Camran

  I have in a previous Q found out that I need an ajax-function to send an email (submit a contact form) without reloading the page. This is for my classifieds website, where when users are viewing a classified they have the option to "tip a friend" by entering their friends email-adress and submitting the form. But I don't want to reload the page, that would be frustrating and not so clever. The only input in the form is a text input which will contain the email-adress to send to, and another hidden input which contains the classified_id nr, to identify which classified it is. The website is php based btw... Does anybody have a simple script for this? I have no experience in Ajax at all... And would really appreciate it. Thanks PS: Would prefer no Jquery, due to clients own reasons...

  Read the article

• Problem with referencing CSS and Javascript fiels relativ

  - by Markus

  I have an IIS web site. This web site contains other web sites so the structure is like that. \ MainWebSite\ App1\ App2\ All sites are Asp.net MVC Webapplications. In the MasterPage of App1 i reference the Script-files like that <script type="text/javascript" src="../../Scripts/jquery-ui-1.8.custom.min.js"></script> The Problem is that he now tries to find the File at http:\server\MainWebSite\Scripts.... how can i workaround that? should i put all my Scripts and CSS files into the root directory is that a preferred solution?

  Read the article

• insert a date in mysql database

  - by kawtousse

  I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

  Read the article

• Alter Regular Expression to Return 2 Values Instead of 3 from userAgent String

  - by Jay

  I've taken a regular expression from jQuery to detect if a browser's engine is WebKit and gets it's version number, it returns 3 values extracted from the userAgent string: webkit/….…, webkit and ….… [“….…” being the version number]. I would like the regular expression to return just 2 values: webkit and ….…. I'm rubbish at regular expressions, so please can you give an explanation of the expression with your answer. The regular expression I'm currently working with and wish to improve is: /(webkit)[\/]([\w.]+)/. I appreciate all your help, thanks in advance!

  Read the article

• angularjs model view update through angular directive

  - by Relicset

  I am trying to update my view using model in angular directive here is the directive I have created app.directive('aboutOptions', [function() { return { restrict: 'C', scope: { testing: '=' }, transclude: true, link: function(scope, elem, attr) { scope.$watch(attr.ngModel, function() { console.log(scope.$eval(attr.ngModel)); scope.testing = scope.$eval(attr.ngModel); }); } } }]); here is html model and file name is ab.html <input type="text" class="about-options" ng-model="testing" /> Here is the view to be updated and file name is show.html <h2 class="about-options">{{testing}}</h2> ab.html file will be loaded as a template inside jquery ui dialog and my show.html file is in main page If I remove scope: { testing: '=' }, Console is showing what I am typing Update - 1 Tried with the following changes testing: '=test' And in html <input type="text" class="about-options" ng-model="testing" /> <h2 class="about-options">{{test}}</h2>

  Read the article

• date picker in partial views asp.net mvc

  - by Renu123

  i used basic date picker in asp.net mvc and it works fine but now i converted my views in partial views at this time date is not working at all means nothing is displyed when i clicked in text box of date picker. the code that i have used is <script src="../Scripts/jquery-1.3.2.js" type="text/javascript"></script> <script src="../Scripts/ui.core.js" type="text/javascript"></script> <script src="../Scripts/ui.datepicker.js" type="text/javascript"></script> and the method used for it is <script type="text/javascript"> $(document).ready(function() { $("#txtTransationDate").datepicker(); }); </script> <input id="txtTransationDate" name="txtTransationDate" type="text" /> can you tell me how to display date picker in partial views. thanks.......

  Read the article

< Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >