Search Results

Search found 18146 results on 726 pages for 'jquery calculation'.

Page 683/726 | < Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >

• replace values in form.data when form fails validation

  - by John

  Hi I have a form field which requires a json object as its value when it is rendered. When the form is submitted it returns a comma seperated string of ids as its value (not a json string). however if the form does not validate i want to turn this string of ids back into a json string so it will display properly (is uses jquery to render the json object correctly). how would i do this? I was thinking of overwriting the form.clean method but when I tried to change self.data['fieldname'] I got the error 'This QueryDict instance is immutable' and when i tried to change self.cleaned_data['fieldname'] it didn't make a difference to the value of the field. Thanks

  Read the article

• CMS + Blog engines for personal website

  - by Shawn Mclean

  I want to create a personal website where I show off my work, write blog posts, etc. I dont want to create my own, but I'm seeking one flexible enough for me to write my own codes for it if needed. For eg, I'd like to create a page with jquery functionality and backend code. Features I'm looking for: Blog engine similiar to wordpress OpenId login (comments, etc) Exporting content in an event I want to switch engines. I have alot of knowledge in .net and small amount in php, so any of these frameworks can work for me.

  Read the article

• Ajax basic email code without reloading page

  - by Camran

  I have in a previous Q found out that I need an ajax-function to send an email (submit a contact form) without reloading the page. This is for my classifieds website, where when users are viewing a classified they have the option to "tip a friend" by entering their friends email-adress and submitting the form. But I don't want to reload the page, that would be frustrating and not so clever. The only input in the form is a text input which will contain the email-adress to send to, and another hidden input which contains the classified_id nr, to identify which classified it is. The website is php based btw... Does anybody have a simple script for this? I have no experience in Ajax at all... And would really appreciate it. Thanks PS: Would prefer no Jquery, due to clients own reasons...

  Read the article

• String.Format in javascript?

  - by chobo2

  Hi this is driving me nuts. I believe I asked this exact same question but I can't find it anymore(I used stackoverflow search, google search, manually searched my posts, searched my code). I wanted something that would be like the C# String.Format where you could do something like string format = String.Format("Hi {0}",name); just for javascript of course and one person gave me a simple answer it was not like a jquery plugin or anything but I think you made some json thing or something and it worked and was simple to use. I for the life of me can't find this post.

  Read the article

• Multiple Post Requests Occuring in Quick Succession

  - by Samuel

  This is a bit of an open ended question but we have a problem with a web application that on the final step of completing an order, multiple post requests are being made, sometimes up to 10 and all within a couple of seconds to the page. Theirs nothing unusual about the page, the user fills out a form which is then validated using the jQuery form validation plugin. We've seen this behavior exhibited over a couple of different browser types, notably IE6 but also IE8. We've also managed to trigger the bug ourselves but nothing out of the ordinary seems to occur on the browsers end, everything progresses as normal. Apache logs show that multiple post requests where made at the same time and the Rails logs show that multiple posts requests were also received by the application, leading me to think it's a problem with the browser. I've exhausted all avenues that I can think of for debugging so I'm throwing this out there to see if anyone has some ideas of what we could try or look for next.

  Read the article

• Unneded number combination after replacing a number in a string.

  - by ne5tebiu

  I get an unneeded number combination. 3, 4, 5, 6, 7, 8, 901234567890123456789, 30 Should be: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12... (till) 30 Why that happens? The code: <? ob_start(); $id=$_GET['id']; if (!empty($id)){ $id=str_replace('a9_','', $id); $value=$_COOKIE['NaudingasURL']; $exp = explode(", ", $value); if(in_array($id, $exp)){ $value2=str_replace(', '.$id,"", ', '.$value); $value2=substr($value2, 2, strlen($value2)); echo'r'; } else{ $value2=$value.', '.$id; echo'a'; } setcookie("NaudingasURL", $value2); } ob_end_flush(); ?> I'm calling it with Jquery ajax, but I don't thinks that's the problem.

  Read the article

• Help with method logic in Java, hw

  - by Crystal

  I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

  Read the article

• Most valued skill set in web development industry/what should I be doing now? (Kinda random "career"

  - by Andrew

  I want to be a web programmer [when I grow up?] because it's what I like doing, and I really do thoroughly enjoy it (web development in general, actually). I have about 2 years experience with PHP, CSS, and HTML and a few months experiance with JS and jQuery. I've been wondering this for a while -- what languages should I be most familiar with if I want to try and make a career out of web development? I'm only 17, so I've got plenty of time, and I think I've got a decent headstart on things, but it doesn't hurt to ask. If I'm thinking in terms of being able to get hired as a web programmer, what is (or what are...?) the most useful thing I can do now to be able to have an upper hand when it comes to looking for a job. What languages, as a young programmer, should I really focus on? If you were looking to hire a developer, what would you be looking for?

  Read the article

• Rails - JSON object with an array?

  - by AnApprentice

  Hello, I'm able to create and send a JSON object like so: @mylist << { :id => item.id, :name => name.id } render :json => { :result => 'success', :mylist => @mylist } That works great. Problem I'm having now is that I need to include users with are 1 or more per item. @mylist << { :id => item.id, :name => name.id, :users => item.users } Where item.users contains a list of (user.id, user.name, user.desc). how do I include an array like users inside a json object? How to build in Rails and then how to parse it with jQuery? Thanks

  Read the article

• Ruby on Rails - Send JavaScript to view

  - by Eef

  Hey, I am creating a website in Ruby on Rails. I have a controller action that renders a view like so: def show time_left = Time.now.to_i - 3.hours.to_i @character = current_user.characters.find(params[:id]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @character } end end This is fine as it renders the show.html.erb as I like. I would like however to somehow pass time_left to the view as a Javascript variable as this value is use by a countdown JQuery plugin. I could put a javascript block on the page in the HTML and print a instance variable out like so: <script type="javascript"> $('#countdown').countdown('<%= @time_left =>')</script> But I would like to keep all my JS in a external file and off the page could anyone give some advice on how to implement this? Cheers Eef

  Read the article

• [Zend Framework] Is there any way to use more than 1 bootstrap class?

  - by rasouza

  It should sound workaround or something like, but I'll tell you what: I chose to have a separated "project" with every library I could use. It's like a global library which I included Zend library, Doctrine ORM, JQuery, Blueprint CSS, etc. Then I set the include path. Nothing wrong. The problem is: I'd like to have also a global bootstrap class inside the library folder and an individual bootstrap class on each project I create for individual use. I don't know how to set more than 1 bootstrap class. Is it possible?

  Read the article

• How do I learn Flash Game Development?

  - by grokker

  I'm currently a PHP programmer and one of my childhood dreams is to create a game. The problem is I don't know Flash. I'm not great at drawing stuff or even artistic. I could program a little with JavaScript and I could consider myself intermediate with JQuery. Question How do I get started with Flash Game development? What books do I read first? The type of game is a side scroller about an Indiana Jones type of character and the setting is on the jungle with trees and snakes and a lot of animals.

  Read the article

• Json to treeview (<ul>)

  - by Pieter

  Hi I get the following data back from my WCF Data Service (I cut out the metadata) { "d" : [ {"CodeId": 6, "Title": "A Child Sub Item", "Parent":}, {"CodeId": 5, "Title": "Another Root Item", "Parent": -1}, {"CodeId": 4, "Title": "Child Item", "Parent": 2}, {"CodeId": 2, "Title": "Root Item", "Parent": -1} ] } I am trying to get this into a <ul> style tree with Parent = -1 as root and then the rest as sub items of their parent id's. Can anyone help me please, preferably in jQuery? I will use this in jstree if someone knows of a better way to do this. Thanks

  Read the article

• Problem with referencing CSS and Javascript fiels relativ

  - by Markus

  I have an IIS web site. This web site contains other web sites so the structure is like that. \ MainWebSite\ App1\ App2\ All sites are Asp.net MVC Webapplications. In the MasterPage of App1 i reference the Script-files like that <script type="text/javascript" src="../../Scripts/jquery-ui-1.8.custom.min.js"></script> The Problem is that he now tries to find the File at http:\server\MainWebSite\Scripts.... how can i workaround that? should i put all my Scripts and CSS files into the root directory is that a preferred solution?

  Read the article

• How can I highlight the line of text that is closest to the mouse?

  - by Aaron Digulla

  I have a long text and I'd like to offer the user a reading help: The current line should be highlighted. To make it easier, I'll just use the Y coordinate of the mouse (this way, the mouse pointer isn't going to get in the way). I have a big DIV with the id content which fills the whole width and a small DIV with the class content for the text (see here for an example). I'm using jQuery 1.4. How can I highlight the line of text that is closest to the current mouse position?

  Read the article

• Best Technologies for AJAX Web Development

  - by floatingfrisbee

  Hey Everyone, I have some experience in AJAX development, mostly on .NET and MooTools. However, I want to learn more and see what others out there thought about the various other options available. I am looking more for advise about the front end. The back end, I will most probably be coding up in .NET using c# and WCF services. Please feel free to provide me as much information as you can. Also I would appreciate any links to resources. List of Options (feel free to add) Write my own Javascript Use a frame work like MooTools, JQuery etc. Which one is better? Use Google Web Toolkit. Am I tying myself to limitations of GWT? Or are there not limitations? ASP.NET AJAX WPF (Will this run on non IE browsers?) Flash (it'll be a pain to learn action script) Thanks Jaspreet

  Read the article

• how much time it will take to learn action script 3 in flash

  - by Mirage

  I know php mysql , javascript , jquery very well. I have never touced flash. Now have to do website in complete flash with action scripting. Keeping flash animation and scripting separate. How much time it will take for me to build e,g 1)Simple page with 1 column layout like , header , navigation bar , content. 2)The navigation items will be loaded from database using xml and flash 3)The content will also load from database depending upon navigation item clicked HOw much time forinserting flash objects and how much time for scripting. Thanks

  Read the article

• Javascript form validation - multiple form fields larger than 0

  - by calebface

  function negativeValues(){ var myTextField = document.getElementById('digit'); if(myTextField.value < 0) { alert("Unable to submit as one field has a negative value"); return false; } } Above is a Javascript piece of code where every time a field id 'digit' has a value that's less than 0, than an alert box appears either onsubmit or onclick in the submit button. There are about 50 fields in the form that should be considered 'digit' fields where they shouldn't be anything less than 0. What should I change with this Javascript to ensure that all 'digit' like fields have this alert box pop up? I cannot use jquery/mootools for validation - it has to be flat Javascript. Thanks.

  Read the article

• drupal: so many js and css files ?

  - by Patrick

  hi, I've realized I'm loading a lot of resources (24 css and 17 js files) using Drupal. I've several modules installed and they all come with a css and js file. For my website I'm only using 1 additional js plugin (all the other 16 come with Drupal modules). I've not installed useless modules. They are all necessary, and they require js such as swfobject, ajax_views, jquery.media, spamspan, lightbox (modal, video and default js files), etc Same thing with css files: ckeditor, filefield, lightbox, tagadelic, uploadfield, fieldgroup, vews, taxonomy_super_select, html-element, tabs, messages... etc For my website, I only use my theme css zen.css of course. So.. is this normal ? Or I should remove all this stuff? Are drupal websites normally heavy ? thanks

  Read the article

• update element in knockout template which was changed by 3td party library

  - by yakov

  I have 'div' element (recaptchaDiv) in knockout template which is not bound to any observable field: <div id="recaptchaDiv"></div> On the other hand, I update this 'div' by 3rd party library. In particular, this is google recaptcha. This is my code: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); And it doesn't work (I see nothing). What I know: trying on FF console: $("#recaptchaDiv").html() - it shows the expected html code, I just can't see it in the browser What I tried: to move recaptchaDiv outside of the template and it works: I can see the captcha in the browser to bind recaptchaDiv on html property: in the template: <div id="recaptchaDiv" data-bind="html: recaptcha"></div> in the model: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); recaptcha($("#recaptchaDiv").html()); and it doesn't work (replacing jquery on document.getElementById doesn't help) Any help will be very much appreciated!!! Thank you in advance.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• The pros and cons of use JSON for WCF service

  - by brz dot net

  What are the pros and cons of the following 2 cases: Case I: Traditional way: Add service reference in project. Create object and Get data from service on server side and bind to asp.net grid. Case II: Update Service for JSON behavior. Add service reference in project. Call service from javascript to get data. Bind data to jquery grid. Which one is the best approach and why?(Not developer point of view) If there is another approach which is more optimized, please explain it.

  Read the article

• Finding Line Beginning using Regular expression in Notepad++

  - by Michel Merlin

  Finding Line Beginning using Regular expression in Notepad++ (Sorry for this newbie question) I want to strip a 4000-line HTML file from all the jQuery "done" stuff, e.g.: <DIV class=menu done27="1" done26="0" done9="1" done8="0" done7="1" done6="0" done4="20"> should be replaced with: <DIV class=menu> In http://www.zytrax.com/tech/web/regex.htm#experiment I can do it with RE: [ ^]done[0-9]+="[0-9]+" but in Notepad++ 5.6.8 UNICODE Search Find, Search mode = Regular expression, putting this RE in the "Find what" field won't work (it will only find the 5 occurrences starting with a space, it will miss the 2 occurrences starting at the beginning of a line; IOW, the caret for line beginning, or the alternating it with a space, fails). How do I? TIA, Versailles, Wed 21 Apr 2010 10:18:20 +0200

  Read the article

• Finding Line Beginning using Regular expression in Notepad++

  - by Michel Merlin

  Finding Line Beginning using Regular expression in Notepad++ (Sorry if this is a newbie question) I want to strip a 4000-line HTML file from all the jQuery "done" stuff, e.g.: <DIV class=menu done27="1" done26="0" done9="1" done8="0" done7="1" done6="0" done4="20"> should be replaced with: <DIV class=menu> In http://www.zytrax.com/tech/web/regex.htm#experiment I can do it with RE: [ ^]done[0-9]+="[0-9]+" but in Notepad++ 5.6.8 UNICODE, in a .HTM file encoded in ANSI, Search Find, Search mode = Regular expression, putting this RE in the "Find what" field won't work (it will only find the 5 occurrences starting with a space, it will miss the 2 occurrences starting at the beginning of a line; IOW, the caret for line beginning, or the alternating it with a space, fails). How do I? TIA, Versailles, Wed 21 Apr 2010 10:42:20 +0200

  Read the article

• Bootstrap Modal & rails remote

  - by Kevin Brown

  Using this bootstrap modal extension and animate.css for fun, how can I take a make an easy ajax modal using :remote => true to fill in the modal box? Also, how would I use the bootstrap modal default "submit/cancel" buttons to interact with a form that's loaded? I'm looking for a more dynamic solution instead of hard-html-ing every modal into the page or using a bunch of jquery ajax calls for each dialog. I've done a few quick searches, but they've turned up nil for this particular solution.

  Read the article

< Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >