Search Results

Search found 18146 results on 726 pages for 'jquery calculation'.

Page 683/726 | < Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >

  • Google Translate set default language

    - by tdurham
    Maybe this has an obvious solution that I'm overlooking, but I can't seem to find the correct parameter to put in to make this happen. Using the Google Translate widget on a site, I need to set the default language that the user sees when entering the site, even though the site is english. function googleTranslateElementInit() { new google.translate.TranslateElement({ pageLanguage: 'en' }, 'google_translate_element'); } I've tried adding: defaultLanguage: 'fr' and tried: targetLanguage: 'fr' I did find some nice jQuery solutions, but didn't want to bypass this if it was an easy fix. Thanks in advance.

    Read the article

  • update element in knockout template which was changed by 3td party library

    - by yakov
    I have 'div' element (recaptchaDiv) in knockout template which is not bound to any observable field: <div id="recaptchaDiv"></div> On the other hand, I update this 'div' by 3rd party library. In particular, this is google recaptcha. This is my code: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); And it doesn't work (I see nothing). What I know: trying on FF console: $("#recaptchaDiv").html() - it shows the expected html code, I just can't see it in the browser What I tried: to move recaptchaDiv outside of the template and it works: I can see the captcha in the browser to bind recaptchaDiv on html property: in the template: <div id="recaptchaDiv" data-bind="html: recaptcha"></div> in the model: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); recaptcha($("#recaptchaDiv").html()); and it doesn't work (replacing jquery on document.getElementById doesn't help) Any help will be very much appreciated!!! Thank you in advance.

    Read the article

  • Visual Studio 2008 Unresponsive When Opening JavaScript Files

    - by lush
    I'm starting a new ASP.NET project that I'm trying to use some jQuery with, but whenever I try to open .js file (blank or containing a few lines of javascript) in Visual Studio, it often hangs; showing the .js filename in a new tab, but the actual text editor window showing whatever was drawn to the screen before opening the .js file. Eventually, after closing and re-opening, it will open in the text editor, but the font is always something like 10pt Arial. Even after changing this in VS options, the next re-launch of Visual Studio yields the same results. Has anyone else experienced hang, unresponsiveness, wonkiness from Visual Studio with JavaScript files?

    Read the article

  • Ruby on Rails - Send JavaScript to view

    - by Eef
    Hey, I am creating a website in Ruby on Rails. I have a controller action that renders a view like so: def show time_left = Time.now.to_i - 3.hours.to_i @character = current_user.characters.find(params[:id]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @character } end end This is fine as it renders the show.html.erb as I like. I would like however to somehow pass time_left to the view as a Javascript variable as this value is use by a countdown JQuery plugin. I could put a javascript block on the page in the HTML and print a instance variable out like so: <script type="javascript"> $('#countdown').countdown('<%= @time_left =>')</script> But I would like to keep all my JS in a external file and off the page could anyone give some advice on how to implement this? Cheers Eef

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Javascript form validation - multiple form fields larger than 0

    - by calebface
    function negativeValues(){ var myTextField = document.getElementById('digit'); if(myTextField.value < 0) { alert("Unable to submit as one field has a negative value"); return false; } } Above is a Javascript piece of code where every time a field id 'digit' has a value that's less than 0, than an alert box appears either onsubmit or onclick in the submit button. There are about 50 fields in the form that should be considered 'digit' fields where they shouldn't be anything less than 0. What should I change with this Javascript to ensure that all 'digit' like fields have this alert box pop up? I cannot use jquery/mootools for validation - it has to be flat Javascript. Thanks.

    Read the article

  • Ajax basic email code without reloading page

    - by Camran
    I have in a previous Q found out that I need an ajax-function to send an email (submit a contact form) without reloading the page. This is for my classifieds website, where when users are viewing a classified they have the option to "tip a friend" by entering their friends email-adress and submitting the form. But I don't want to reload the page, that would be frustrating and not so clever. The only input in the form is a text input which will contain the email-adress to send to, and another hidden input which contains the classified_id nr, to identify which classified it is. The website is php based btw... Does anybody have a simple script for this? I have no experience in Ajax at all... And would really appreciate it. Thanks PS: Would prefer no Jquery, due to clients own reasons...

    Read the article

  • Help with method logic in Java, hw

    - by Crystal
    I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

    Read the article

  • Fading transition slideshow

    - by Simon Carlson
    I've got a JavaScript that produces a slideshow. It loads the pictures before starting the actual slideshow. Code below. var image1=new Image() image1.src="filename1.jpg" var image2=new Image() image2.src="filename2.jpg" var image3=new Image() image3.src="filename3.jpg" var step=1 function slideit(){ if (!document.images) return document.images.slide.src=eval("image"+step+".src") if (step<3) step++ else step=1 setTimeout("slideit()",1000) } And this is the required HTML for it to work: <img src="filename1.jpg" name="slide" /> Now, if I want to have fading transitions instead of just having new pictures popping up, how do I approach this? By fading I mean either have the old picture fade out, the new fade in or possibly and most likely both fade in/out. Can this be achieved with pure JavaScript and no jQuery or Ajax?

    Read the article

  • CMS + Blog engines for personal website

    - by Shawn Mclean
    I want to create a personal website where I show off my work, write blog posts, etc. I dont want to create my own, but I'm seeking one flexible enough for me to write my own codes for it if needed. For eg, I'd like to create a page with jquery functionality and backend code. Features I'm looking for: Blog engine similiar to wordpress OpenId login (comments, etc) Exporting content in an event I want to switch engines. I have alot of knowledge in .net and small amount in php, so any of these frameworks can work for me.

    Read the article

  • Unneded number combination after replacing a number in a string.

    - by ne5tebiu
    I get an unneeded number combination. 3, 4, 5, 6, 7, 8, 901234567890123456789, 30 Should be: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12... (till) 30 Why that happens? The code: <? ob_start(); $id=$_GET['id']; if (!empty($id)){ $id=str_replace('a9_','', $id); $value=$_COOKIE['NaudingasURL']; $exp = explode(", ", $value); if(in_array($id, $exp)){ $value2=str_replace(', '.$id,"", ', '.$value); $value2=substr($value2, 2, strlen($value2)); echo'r'; } else{ $value2=$value.', '.$id; echo'a'; } setcookie("NaudingasURL", $value2); } ob_end_flush(); ?> I'm calling it with Jquery ajax, but I don't thinks that's the problem.

    Read the article

  • JS dynamic img change and SEO

    - by Gusepo
    Hi all, I've built a web site using jquery to make nice transitions between content. The code works this way: there are 2 imgs (body and footer) when I click on a link (instead of going to another page) I fade out the 2 imgs and change the src attribute of the 2. When the new imgs are loaded I fade them back in. I'm using SWFaddress to allow user go directly to internal content. Now I'd like to make my content indexed by google and other Search engines, all the text content is inside the imgs, So I've got the text in ALT attribute. My question is: if a dinamically change the imgs ALT attribute using JS, will spiders be able to read it properly? consider that I'm using SWFaddress to create a sitemap.. Thanks

    Read the article

  • ASP.NET MVC submitting json array to controller as regular post request (nonajax)

    - by j3ko
    All the examples of json I can find online only show how to submit json arrays w/ the jquery command $.ajax(). I'm submitting some data from a custom user control as a json array. I was wondering if it's possible to submit a json array as a regular post request to the server (like a normal form) so the browser renders the page returned. Controller: [JsonFilter(Param = "record", JsonDataType = typeof(TitleViewModel))] public ActionResult SaveTitle(TitleViewModel record) { // save the title. return RedirectToAction("Index", new { titleId = tid }); } Javascript: function SaveTitle() { var titledata = GetData(); $.ajax({ url: "/Listing/SaveTitle", type: "POST", data: titledata, contentType: "application/json; charset=utf-8", }); } Which is called from a save button. Everything works fine but the browser stays on the page after submitting. I was thinking of returning some kind of custom xml from the server and do javascript redirect but it seems like a very hacky way of doing things. Any help would be greatly appreciated.

    Read the article

  • drupal: so many js and css files ?

    - by Patrick
    hi, I've realized I'm loading a lot of resources (24 css and 17 js files) using Drupal. I've several modules installed and they all come with a css and js file. For my website I'm only using 1 additional js plugin (all the other 16 come with Drupal modules). I've not installed useless modules. They are all necessary, and they require js such as swfobject, ajax_views, jquery.media, spamspan, lightbox (modal, video and default js files), etc Same thing with css files: ckeditor, filefield, lightbox, tagadelic, uploadfield, fieldgroup, vews, taxonomy_super_select, html-element, tabs, messages... etc For my website, I only use my theme css zen.css of course. So.. is this normal ? Or I should remove all this stuff? Are drupal websites normally heavy ? thanks

    Read the article

  • [Zend Framework] Is there any way to use more than 1 bootstrap class?

    - by rasouza
    It should sound workaround or something like, but I'll tell you what: I chose to have a separated "project" with every library I could use. It's like a global library which I included Zend library, Doctrine ORM, JQuery, Blueprint CSS, etc. Then I set the include path. Nothing wrong. The problem is: I'd like to have also a global bootstrap class inside the library folder and an individual bootstrap class on each project I create for individual use. I don't know how to set more than 1 bootstrap class. Is it possible?

    Read the article

  • Advanced search functionality

    - by Chris
    I have a website with a jQuery based autocomplete search functionality which works great. Currently though I have just one search box for all categories, what I want is for someone to be able to type in, say for example, dorian gray dvd (in any order) which will search for dorian gray within the dvd category. What this will require then is a bit of magic on the server side to figure out if any of the words are category keywords, and then limit the search by that. What is the best (and quickest) way to do this in PHP / MySQL? I currently have a few trains of thought Search the category table for matches and perhaps order the results by that. Or split up the search terms into an array and separately search the categories for that for a match. Another thought I just had is to concat the category title to the dvd title in the database and match against that, or something similar... but this sounds computationally expensive? Any advice?

    Read the article

  • Json to treeview (<ul>)

    - by Pieter
    Hi I get the following data back from my WCF Data Service (I cut out the metadata) { "d" : [ {"CodeId": 6, "Title": "A Child Sub Item", "Parent":}, {"CodeId": 5, "Title": "Another Root Item", "Parent": -1}, {"CodeId": 4, "Title": "Child Item", "Parent": 2}, {"CodeId": 2, "Title": "Root Item", "Parent": -1} ] } I am trying to get this into a <ul> style tree with Parent = -1 as root and then the rest as sub items of their parent id's. Can anyone help me please, preferably in jQuery? I will use this in jstree if someone knows of a better way to do this. Thanks

    Read the article

  • The pros and cons of use JSON for WCF service

    - by brz dot net
    What are the pros and cons of the following 2 cases: Case I: Traditional way: Add service reference in project. Create object and Get data from service on server side and bind to asp.net grid. Case II: Update Service for JSON behavior. Add service reference in project. Call service from javascript to get data. Bind data to jquery grid. Which one is the best approach and why?(Not developer point of view) If there is another approach which is more optimized, please explain it.

    Read the article

  • Problem with referencing CSS and Javascript fiels relativ

    - by Markus
    I have an IIS web site. This web site contains other web sites so the structure is like that. \ MainWebSite\ App1\ App2\ All sites are Asp.net MVC Webapplications. In the MasterPage of App1 i reference the Script-files like that <script type="text/javascript" src="../../Scripts/jquery-ui-1.8.custom.min.js"></script> The Problem is that he now tries to find the File at http:\server\MainWebSite\Scripts.... how can i workaround that? should i put all my Scripts and CSS files into the root directory is that a preferred solution?

    Read the article

  • How do I learn Flash Game Development?

    - by grokker
    I'm currently a PHP programmer and one of my childhood dreams is to create a game. The problem is I don't know Flash. I'm not great at drawing stuff or even artistic. I could program a little with JavaScript and I could consider myself intermediate with JQuery. Question How do I get started with Flash Game development? What books do I read first? The type of game is a side scroller about an Indiana Jones type of character and the setting is on the jungle with trees and snakes and a lot of animals.

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

  • Where would I use a bitwise operator in JavaScript?

    - by J-P
    I've read this (http://stackoverflow.com/quest...), so I know what bitwise operators are but I'm still not clear on how one might use them... Can anyone offer any real-world examples of where a bitwise operator would be useful in JavaScript? Thanks. Edit: Just digging into the jQuery source I've found a couple of places where bitwise operators are used, for example: (only the & operator) // Line 2756: event.which = (event.button & 1 ? 1 : ( event.button & 2 ? 3 : ( event.button & 4 ? 2 : 0 ) )); // Line 2101 var ret = a.compareDocumentPosition(b) & 4 ? -1 : a === b ? 0 : 1;

    Read the article

  • Multiple Post Requests Occuring in Quick Succession

    - by Samuel
    This is a bit of an open ended question but we have a problem with a web application that on the final step of completing an order, multiple post requests are being made, sometimes up to 10 and all within a couple of seconds to the page. Theirs nothing unusual about the page, the user fills out a form which is then validated using the jQuery form validation plugin. We've seen this behavior exhibited over a couple of different browser types, notably IE6 but also IE8. We've also managed to trigger the bug ourselves but nothing out of the ordinary seems to occur on the browsers end, everything progresses as normal. Apache logs show that multiple post requests where made at the same time and the Rails logs show that multiple posts requests were also received by the application, leading me to think it's a problem with the browser. I've exhausted all avenues that I can think of for debugging so I'm throwing this out there to see if anyone has some ideas of what we could try or look for next.

    Read the article

  • how much time it will take to learn action script 3 in flash

    - by Mirage
    I know php mysql , javascript , jquery very well. I have never touced flash. Now have to do website in complete flash with action scripting. Keeping flash animation and scripting separate. How much time it will take for me to build e,g 1)Simple page with 1 column layout like , header , navigation bar , content. 2)The navigation items will be loaded from database using xml and flash 3)The content will also load from database depending upon navigation item clicked HOw much time forinserting flash objects and how much time for scripting. Thanks

    Read the article

  • Best Technologies for AJAX Web Development

    - by floatingfrisbee
    Hey Everyone, I have some experience in AJAX development, mostly on .NET and MooTools. However, I want to learn more and see what others out there thought about the various other options available. I am looking more for advise about the front end. The back end, I will most probably be coding up in .NET using c# and WCF services. Please feel free to provide me as much information as you can. Also I would appreciate any links to resources. List of Options (feel free to add) Write my own Javascript Use a frame work like MooTools, JQuery etc. Which one is better? Use Google Web Toolkit. Am I tying myself to limitations of GWT? Or are there not limitations? ASP.NET AJAX WPF (Will this run on non IE browsers?) Flash (it'll be a pain to learn action script) Thanks Jaspreet

    Read the article

< Previous Page | 679 680 681 682 683 684 685 686 687 688 689 690  | Next Page >