Search Results

Search found 18146 results on 726 pages for 'jquery calculation'.

Page 682/726 | < Previous Page | 678 679 680 681 682 683 684 685 686 687 688 689  | Next Page >

  • Problems crossing the boundary between protected greasemonkey execution space and the unsafeWindow l

    - by Chilly
    Hi guys. Here is my problem: I've registered some callbacks into a Yahoo event driven webpage (betfair.com market views) and am trapping the betsPlaced events with a handler. So far so simple. Next stage is to get the event back into greasemonkey land, and while I know that from greasemoney space you can call unsafeWindow.stuff, there is no reverse operation (by design). So if I want to send the contents of the event over, say, a cometd queue, my carefully set up jquery, greasemonkey, YUI2, betfair environment fails by telling me that unsafeWindow processes cant call GM_ajax stuff. This is obviously safe and sane, but it basically stops me doing what I want to do. Has anyone tried doing this (ignore the cometd stuff, just general ajax calls) and succeeded? I've had a look at pages like this: http://wiki.greasespot.net/0.7.20080121.0%2B_compatibility but it doesnt appear to work for all the calls.

    Read the article

  • Setting up a "to-many" relationship value dependency for a transient Core Data attribute

    - by Greg Combs
    I've got a relatively complicated Core Data relationship structure and I'm trying to figure out how to set up value dependencies (or observations) across various to-many relationships. Let me start out with some basic info. I've got a classroom with students, assignments, and grades (students X assignments). For simplicity's sake, we don't really have to focus much on the assignments yet. StudentObj <--->> ScoreObj <<---> AssignmentObj Each ScoreObj has a to-one relation with the StudentObj and the AssignmentObj. ScoreObj has real attributes for the numerical grade, the turnInDate, and notes. AssignmentObj.scores is the set of Score objects for that assignment (N = all students). AssignmentObj has real attributes for name, dueDate, curveFunction, gradeWeight, and maxPoints. StudentObj.scores is the set of Score objects for that student (N = all assignments). StudentObj also has real attributes like name, studentID, email, etc. StudentObj has a transient (calculated, not stored) attribute called gradeTotal. This last item, gradeTotal, is the real pickle. it calculates the student's overall semester grade using the scores (ScoreObj) from all their assignments, their associated assignment gradeWeights, curves, and maxPoints, and various other things. This gradeTotal value is displayed in a table column, along with all the students and their individual assignment grades. Determining the value of gradeTotal is a relatively expensive operation, particularly with a large class, therefore I want to run it only when necessary. For simplicity's sake, I'm not storing that gradeTotal value in the core data model. I don't mind caching it somewhere, but I'm having a bitch of a time determining where and how to best update that cache. I need to run that calculation for each student whenever any value changes that affects their gradeTotal. If this were a simple to-one relationship, I know I could use something like keyPathsForValuesAffectingGradeTotal ... but it's more like a many-to-one-to-many relationship. Does anyone know of an elegant (and KVC correct) solution? I guess I could tear through all those score and assignment objects and tell them to register their students as observers. But this seems like a blunt force approach.

    Read the article

  • database design suggesion

    - by Bharanikumar
    Hi , am going to start new travel site, I want some advise from guru's regarding database design , Things coming to picture are, Book taxi online , This is the core idea, So i like to implement lot of jquery,ajax stuff in my site , Main thing site must run veryt fast,safe,security, In mysql , which typw shall i use, MYISAM OR INNODB Which is best type for ajax works, fast,safe ,secure ,performance view . This is my demo site, Just look this site, i implemented some ajax stuff here, my-url In this site please choose the postcode in the taxifrom tab, It ask you value please enter, just enter nw7 , See How long it will take for response,some time no response and system goes to hang or idle mode, Also please look the diversion , select No diversion, There you will list of textbox, enter the nw3 then hit the search icon , See after 80seconds only , you will get response from DB, See this too bad response ... This is DB , my Database type if myisam ,no idexing , no fulltext and nothing...no constraints, So please advise me , which database type i choose, Myisam or innodb, Thanks Bharanikumar

    Read the article

  • javascript table - update on data request

    - by flyingcrab
    Hi, I am trying to update a table based on a json request. The first update / draw works fine - but any subsequent changes to the variables (the start and end date) do not show up - even though the json pulled from the server seems to be correct (according to firebug). AFAIK the code below should re-initialize everything - no sure what is going on (I'm using the Google vizulization api)? function handleQueryResponse(response) { if (response.isError()) { //alert('Error in query: ' + response.getMessage() + ' ' + response.getDetailedMessage()); return; } visualization = new google.visualization.Table(document.getElementById('visualization')); visualization.draw(response.getDataTable(), null); } One more thing: I'm working on a page that displays textbased tables and currently trying to decide between the google table (viz api) and a jQuery alternative I came across jqGrid any good ones I am missing?

    Read the article

  • Safari javascript cookie issue

    - by Aaron Moodie
    I've hit a bit of a weird issue in Safari in regards to setting a js cookie. The cookie itself is just a rgb colour value, which gets set using .click(), and is working fine in Chrome and Firefox, yet in Safari the value of the cookie is incomplete, showing up as rgb(193 instead of rgb(193, 184, 76) as the other browsers do. The jQuery function I'm using to set the cookie is: $('.project_link a').click(function() { var link_colour = $(this).css("color"); document.cookie = "colour="+link_colour+";expires=;path=/"; });

    Read the article

  • get data from asp page

    - by sam
    I am wondering if there is anyway to grab the html that is generated from an ASP page. I am trying to pull a table from the page, and I foolishly used a static html page so I would not have to be constantly querying the server where this page resides while I tested out my code. The javascript code I wrote to grab to unlabeled table from the page works. Then when I put it into practice with the real page and found that the ASP page does not generate a viewable page with a jquery .get request on the URL. Is there any way to query the page for the table I need so that the ASP page returns a valid page on request? (I am also limited to using javascript and perl for this, the server where this will reside will not run php and I have no desire to learn ASP.NET to solve this by adding to the issue of proprietary software)

    Read the article

  • Dynamically added script causes problems

    - by Derk
    I'm loading an html snippet via ajax to append to a div (I use jquery). A part of the html loaded with ajax looks like this: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false"></script> <script type="text/javascript"> var options = { mapTypeId : google.maps.MapTypeId.TERRAIN } alert('test'); var map = new google.maps.Map(document.getElementById('map-canvas'), options); </script> Then this is appended with contentBox.append(data); The problem is that this causes a black page in Firefox which keeps loading. In other browsers it seems that the code is not executed at all. Is there a solution for this?

    Read the article

  • PUT parameters not working in python / google app engine

    - by magegu
    hi, i'm working on a simple RESTful webservice with python with the webapp framework on the google app engine. Basically i'm sending all request via AJAX/jquery - for POST it works like a charm, but when I'm sending data with PUT, the parameters are empty / not processed. this is my PUT: $.ajax({ type: "PUT", url: "/boxes", data: { name: this.name, archived: this.archived }, success: function(msg){ } }); firebug saids i'm putting: Parameter application/x-www-form-urlencoded archived false name 123112323asdasd but using this python code: from google.appengine.ext import webapp from google.appengine.ext.webapp import util, template from google.appengine.ext import db from google.appengine.api.datastore_types import * from django.utils import simplejson as json import cgi import datetime class BoxHandler(webapp.RequestHandler): def post(self): #working print "test" self.response.out.write(self.request.get("name")) def put(self): print "test" #not working self.response.out.write(self.request.get("name")) will just return test Status: 200 OK Content-Type: text/html; charset=utf-8 Cache-Control: no-cache Expires: Fri, 01 Jan 1990 00:00:00 GMT Content-Length: 0 so .. hm, is there anything i'm missing here? cheers, Martin

    Read the article

  • GZipping CSS and JS files

    - by Ryan Giglio
    I'm using YSlow to improve the speed of my site, and I'm having trouble with the "compress components with gzip" grade. I have this in my .htaccess file: SetOutputFilter DEFLATE AddOutputFilterByType DEFLATE text/html text/plain text/xml text/css application/x-javascript But YSlow is saying There are 4 plain text components that should be sent compressed * http://crewinyourcode.com/css/reset.css * http://crewinyourcode.com/css/inner-pages/index.css * http://crewinyourcode.com/script/css/jquery-ui-1.8.custom.css * http://crewinyourcode.com/js/inner-pages/index.js How can I gzip the css and js files? Also...I don't have access to the httpd.conf file.

    Read the article

  • How to make a form using ajax, onchange event, reload to SAME page

    - by user1348220
    I've been studying this for a while and I'm not sure if I'm going about this the right way because every form I setup according to examples, it doesn't do what I need. I need to setup a form that will: set session when you select from dropdown menu not reload/refresh page (i've read that using AJAX solves this) submit and stay on SAME page (confused because most AJAX examples send it to different process.php page which is supposedly "invisible" but it doesn't "stay" on the same page, it redirects. Basically, client selects quantity of 1 to 10. If they select "2"... it does NOT reload the page.. but it DOES set a session[quantity]=2. Should be simple... but do I POST to same page as form? or POST to different page and it somehow redirects? Also, one test I did it kept pasting my "echo session[quantity]" down the page like 7, 2, 3, 5, etc. etc. each time instead of replacing it. I would paste code but it's all over the place and I'm hoping for direction on which methods to use. Feel I need to start all over again. Edit: trying to add code below but can't seem to paste it properly. <? ob_start();?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <?php session_start(); ?> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Submit Form with out refreshing page Tutorial</title> <!-- JavaScript --> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.0/jquery.min.js"></script> <script type="text/javascript" > $(function() { $(".submit").click(function() { var gender = $("#gender").val(); var dataString = '&gender=' + gender; if(gender=='') { $('.success').fadeOut(200).hide(); $('.error').fadeOut(200).show(); } else { $.ajax({ type: "POST", url: "join.php", data: dataString, success: function(){ $('.success').fadeIn(200).show(); $('.error').fadeOut(200).hide(); } }); } return false; }); }); </script> <style type="text/css"> body{ } .error{ color:#d12f19; font-size:12px; } .success{ color:#006600; font-size:12px; } </style> </head> <body id="public"> <div style="height:30px"></div> <div id="container"> <div style="height:30px"></div> <form method="post" name="form"> <select id="gender" name="gender"> <option value="">Gender</option> <option value="male">Male</option> <option value="female">Female</option> </select> <div> <input type="submit" value="Submit" class="submit"/> <span class="error" style="display:none"> Please Enter Valid Data</span> <span class="success" style="display:none"> Your gender is <?php echo $_SESSION['gender'];?></span> </div> </form> <div style="height:20px"></div> </div><!--container--> </body> </html> <? ob_flush(); ?> and here is my page where the POST goes called join.php (called that in example so I went with it for now) <?php session_start(); if($_POST) { $gender = $_POST['gender']; $_SESSION['gender'] = $gender; } else { } ?>

    Read the article

  • building a website

    - by Ant
    Not sure if this is the right place to post this, or if it should be under programmers.stackexchange... Anywho, a couple of my friends run a business and they asked me to build them a public website. It will only be used for information about the company with soe pictures. No transactions will be involved. Right now I work for a company where I build internal websites, and do alot of backend programming in C#. I understand html, css, jquery, etc. so I feel like I am completely capable of building a website for them. However, I do not know all the basic knowledge to building one. For example, where should we host the files, what type of security issues do I need to be aware of, what's the best software to use for developing websites (I use visual studio at work), where can I find some design techniques, etc. Any help is appreciated.

    Read the article

  • Google App Engine: lose CSS on deployment?

    - by Rosarch
    I have a Google App Engine app that works fine on the dev server. However, when I upload it, the CSS is gone. The scripts are still there, however. From app.yaml: - url: /scripts static_dir: Static/Scripts - url: /styles static_dir: Static/styles From the base template: <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1" /> <script type="text/javascript" src="./scripts/JQuery.js"></script> <script type="text/javascript" src="./scripts/sprintf.js"></script> <link rel="stylesheet" href="./styles/style.css" type="text/css" media="screen" /> </head> What could be causing this? Am I doing something wrong?

    Read the article

  • What CSS should I use to create a series of horizontal, non-wrapping blocks?

    - by JOhnC
    I have a set of dynamically generated content - anywhere between 1 and about 25 blocks (each of which I want to be about 250px wide. Clearly, this can run off-screen, but that's fine since my design allows for horizontal scrolling (using jQuery - I don't want the browser to do it with its own scroll bars). So what CSS - cross-browser - is the best approach? Floats seem to wrap unreliably, and the dynamic nature of the content which changes frequently through ajax calls - means that recalculating the container width is not very practical. Other CSS-based option?

    Read the article

  • Specify only the second parameter in a javascript function

    - by Ben McCormack
    The spec for the jQuery ajax.error function is: error(XMLHttpRequest, textStatus, errorThrown)Function I'm trying to catch the error and display the textStatus, but I can't figure out how to specify only the textStatus without having to put in a variable name for XMLHttpRequest and errorThrown. My code currently looks like this: $.ajax({ type: "POST", contentType: "application/json; charset=utf-8", url: hbAddressValidation.webServiceUrl, data: this.jsonRequest, dataType: "json", timeout: 5, success: function (msgd) { //... }, error: function (a,textStatus,b) { $("#txtAjaxError").val("There was an error in the AJAX call: " + textStatus); } }); You can see in my code that I'm putting variables a and b as placeholders for the first and last variables in the error function. I know that in my success function, I'm only providing one parameter and it works fine, but in that case data is the first parameter. In the case of error, textStatus is the second parameter, but that's the only one I want to specify. Is this possible?

    Read the article

  • Javascript Canvas Element - Array Of Images

    - by Ben Shelock
    I'm just learning JS, trying to do things without jQuery, and I want to make something similar to this however I want to use an array of images instead of just the one. My image array is formed like this var image_array = new Array() image_array[0] = "image1.jpg" image_array[1] = "image2.jpg" And the canvas element is written like this. (Pretty much entirely taken from the Mozilla site) function draw() { var ctx = document.getElementById('canvas').getContext('2d'); var img = new Image(); img.src = 'sample.png'; img.onload = function(){ for (i=0;i<5;i++){ for (j=0;j<9;j++){ ctx.drawImage(img,j*126,i*126,126,126); } } } } It uses the image "sample.png" in that code but I want to change it to display an image from the array. Displaying a different one each time it loops. Apoligies if I've not explained this well.

    Read the article

  • Tomcat JSP(2.0) Document how to stop automaticly closing empty body tags with /> instead of </tagnam

    - by JOKe
    The question is. If I use JSP Documents (or JSP 2.0) and If I put a TAG without a BODY it is automaticly closed I dont want that. so If I have <div id=....> </div> it is automaticly converted to <div id=.../> How I can stop this ? I am using tomcat is there any configuration about that ? P.S. the reason to want to stop it is because it simple "fuckes" the JQuery stuffs that the designer company are using.

    Read the article

  • ASP.net MVC: Getting a Partial View's HTML from inside of the controller

    - by Harry
    I have developed a simple mechanism for my mvc website to pull in html via jquery which then populates a specified div. All is well and it looks cool. My problem is that i'm now creating html markup inside of my controller (Which is very easy to do in VB.net btw) I'd rather not mix up the sepparation of concerns. Is it possible to use a custom 'MVC View User Control' to suit this need? Can I create an instance of a control, pass in the model data and render to html? It would then be a simple matter of rendering and passing back to the calling browser.

    Read the article

  • qmake -project command gives QFileInfo warning in Qt 4.6

    - by Pilgrim
    I've upgraded to Qt 4.6 on my Mac (OS 10.5). When I go to a project directory and run: qmake -project Qt returns this warning (although it doesn't say it's a warning, I assume it is since the .pro file gets created anyway): QFileInfo::absolutePath: Constructed with empty filename I did a completely new install thinking that the "upgrade" wasn't clean for whatever reason, it still does it. Any ideas as to why? Here is an example .pro that results from above command: ###################################################################### # Automatically generated by qmake (2.01a) Mon Apr 19 07:39:53 2010 ###################################################################### TEMPLATE = app TARGET = DEPENDPATH += . INCLUDEPATH += . # Input HEADERS += mainwindow.h SOURCES += main.cpp mainwindow.cpp RESOURCES += jquery.qrc

    Read the article

  • Drag and drop an image from desktop to a web text editor (implementation in javascript)

    - by fatmatto
    I tried to write reasonably short title but i failed i guess.. Hi everybody here's what i'm trying to do: I want to implement a web text editor able to recognize when the user drag a image file over it's editing surface and it automa(gically) starts the upload and insert the image near the cursor position. In other words i don't want the user to do the usual "insert-image-browse-ok". Atm i am not very good at javascript ... i know JQuery but i have not a clear idea about how to implement this... i don't know if there's an event handler able to help me in this situation... if not then there should be i think or web apps would miss some kind of interactivity. I've heard miracles about HTML5 could it help me? I've seen such things in Google Wave but that surface doesn't seem to be a form field... google lab's black magic i guess.... Thank you in advance.

    Read the article

  • Maintaining the query string in ASP.Net MVC

    - by Mantorok
    Hi all Just beginning my journey in ASP.Net MVC and I have a query about something before I dig myself in too deep. I have a table, which is paged, and I have 2 controls above the table: Dropdown that defines order of the results and apply button next to it Textbox that defines a filter and apply button next to it What I need to achieve is that if the user changes the order or adds a filter I fire of an AJAX call to my action like such: /Membership/Users?sort=value&filter=value&page=pagenumber. So my controller action is: // GET Membership/Users?sort=&filter=&page= public ActionResult Users(string sort, string filter, string page) So I have 3 questions: Is this the correct approach? What would be the best way to ensure that the query string is maintained, bearing in mind that the action will nearly always be called by Jquery/Ajax functions? If I wanted to link directly to this action passing the arguments would I need to hard-code the querystring? Thanks

    Read the article

  • Benefit of outputting JSON as opposed to plain HTML

    - by Franco
    Hey guys, Just wondering which is best here. I want to output data from a table in my DB then put a lot of this data into a html table on the fly on my page. Im working with Java on the server side. Basically I pull the results form the DB and have the raw data..just what next? There is a chance I may want to take data from multiple tables in order to combine it into one table for my site. I retrieve the results of the query from the DB, now do i create a text from it in the form of json which i can parse as json using jquery upon the return of the object to my browser?(kind of a sub question of this question: Is just using a stringbuilder the correct way to make a json object to output?) Or.. Should i build the HTML as a string and output that to the browser instead? Which is better and why? Thanks in advance!

    Read the article

  • replace values in form.data when form fails validation

    - by John
    Hi I have a form field which requires a json object as its value when it is rendered. When the form is submitted it returns a comma seperated string of ids as its value (not a json string). however if the form does not validate i want to turn this string of ids back into a json string so it will display properly (is uses jquery to render the json object correctly). how would i do this? I was thinking of overwriting the form.clean method but when I tried to change self.data['fieldname'] I got the error 'This QueryDict instance is immutable' and when i tried to change self.cleaned_data['fieldname'] it didn't make a difference to the value of the field. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • CMS + Blog engines for personal website

    - by Shawn Mclean
    I want to create a personal website where I show off my work, write blog posts, etc. I dont want to create my own, but I'm seeking one flexible enough for me to write my own codes for it if needed. For eg, I'd like to create a page with jquery functionality and backend code. Features I'm looking for: Blog engine similiar to wordpress OpenId login (comments, etc) Exporting content in an event I want to switch engines. I have alot of knowledge in .net and small amount in php, so any of these frameworks can work for me.

    Read the article

  • Visual Studio 2008 Unresponsive When Opening JavaScript Files

    - by lush
    I'm starting a new ASP.NET project that I'm trying to use some jQuery with, but whenever I try to open .js file (blank or containing a few lines of javascript) in Visual Studio, it often hangs; showing the .js filename in a new tab, but the actual text editor window showing whatever was drawn to the screen before opening the .js file. Eventually, after closing and re-opening, it will open in the text editor, but the font is always something like 10pt Arial. Even after changing this in VS options, the next re-launch of Visual Studio yields the same results. Has anyone else experienced hang, unresponsiveness, wonkiness from Visual Studio with JavaScript files?

    Read the article

< Previous Page | 678 679 680 681 682 683 684 685 686 687 688 689  | Next Page >