Search Results

Search found 26912 results on 1077 pages for 'default programs'.

Page 703/1077 | < Previous Page | 699 700 701 702 703 704 705 706 707 708 709 710  | Next Page >

  • Iteration speed of int vs long

    - by jqno
    I have the following two programs: long startTime = System.currentTimeMillis(); for (int i = 0; i < N; i++); long endTime = System.currentTimeMillis(); System.out.println("Elapsed time: " + (endTime - startTime) + " msecs"); and long startTime = System.currentTimeMillis(); for (long i = 0; i < N; i++); long endTime = System.currentTimeMillis(); System.out.println("Elapsed time: " + (endTime - startTime) + " msecs"); Note: the only difference is the type of the loop variable (int and long). When I run this, the first program consistently prints between 0 and 16 msecs, regardless of the value of N. The second takes a lot longer. For N == Integer.MAX_VALUE, it runs in about 1800 msecs on my machine. The run time appears to be more or less linear in N. So why is this? I suppose the JIT-compiler optimizes the int loop to death. And for good reason, because obviously it doesn't do anything. But why doesn't it do so for the long loop as well? A colleague thought we might be measuring the JIT compiler doing its work in the long loop, but since the run time seems to be linear in N, this probably isn't the case.

    Read the article

  • Scapy Installed, when i use it as module Its full of errors ???

    - by Rami Jarrar
    I installed scapy 2.xx (after get some missed modules to make it install),, then i'm trying to use it as module in my python programs,, but i cant it give me alot of errors, I download and installed some missed modules and finally i'm depressed, because this error, after hard work i got this Traceback (most recent call last): File "<pyshell#0>", line 1, in <module> from scapy.all import * File "C:\Python26\scapy\all.py", line 43, in <module> from crypto.cert import * File "C:\Python26\scapy\crypto\cert.py", line 15, in <module> from Crypto.PublicKey import * File "C:\Python26\lib\Crypto\PublicKey\RSA.py", line 34, in <module> from Crypto import Random File "C:\Python26\lib\Crypto\Random\__init__.py", line 29, in <module> import _UserFriendlyRNG File "C:\Python26\lib\Crypto\Random\_UserFriendlyRNG.py", line 36, in <module> from Crypto.Random.Fortuna import FortunaAccumulator File "C:\Python26\lib\Crypto\Random\Fortuna\FortunaAccumulator.py", line 36, in <module> import FortunaGenerator File "C:\Python26\lib\Crypto\Random\Fortuna\FortunaGenerator.py", line 32, in <module> from Crypto.Util import Counter File "C:\Python26\lib\Crypto\Util\Counter.py", line 27, in <module> import _counter ImportError: No module named _counter by do the following code: from scapy.all import * p=sr1(IP(dst=ip_dst)/ICMP()) if p: p.show() so what should i do,, is there a solution for this ???

    Read the article

  • General website publishing questions involving domain forwarding issue

    - by Gorgeousyousuf
    Even though I have been having a certain level of knowledge and experience about web development I have never interested in obtaining a domain and publishing a website from my own server. Since today I have been struggling with getting my own domain and configuring it utilizing web sources. I started with learning the outline of web publishing process including web server installation, deploying a website for testing purpose,router port forwarding, getting a domain and forwarding domain to my router which will also forward http requests to my web server I am confused about some parts and so far could not get the web site accessed from outside of the network. All I try to do is just for learning purpose so I do not pay much attention to security issues for now. I have Server 2008 and IIS 7.5 installed. I use a laptop and have access to the modem over wireless and my modem is Zoom x6 5590. Well I will continue explaining what I have done so far and what I think will be after each action I did, I have successfully had access to my website on any local computer entering the internal ip address and port pair of the host machine in a browser. Next, I forwarded port 80 of my host machine creating a virtual server like 10.0.0.x(internal ip(static) of the host) - tcp - start port : 80 - end port : 80 in router options. Now I suppose every request that will come to the public Ip on port 80 will be forwarded to my host machine(10.0.0.x) over port 80. So If everyhing went as desired, the website listening on port 80 will accept the request and process the issue and finally respond bla bla bla... I suppose to access my website from outside of the network by entering http://MyPublicIp:80 in a browser but I couldn't accomplish this task by now despite using godady's domain forwarding tool,I see a small view of my website when I click the "preview" button that checks whether the address(http://publicip/Index.aspx) I entered where my domain will be forwarded is available or not. I am sure that configuring domain does not play a role in solving such a problem since using public ip and port matching does not help. So here is the first question, What is the fact that I face this problem? After that, I have couple of question regarding domain forwarding using godaddy tool. Can I forward my domain to a any port for example port 8080 other than default http port 80? Additionally, can I use a sub-domain to forward to a different port of the host? What I want to design is if the client enters www.mydomain.com, website1 will respond over a specified port and after when a client enters info.mydomain.com, another website which listens on different port will respond. I tried to add a sub-domain and forward it to a address like http://www.mydomain.com:8080/Index.aspx with no success. Can I really do that? Finally, what if I have a ftp site listening on the default port 21 and I create a domain like ftp.mydomain.com that will forward to that ftp site address. Is it possible to use sub-domains for ftp site access? I know I am more than confused but no matter whatever and however you reply to me, you will help me have a more clear view on this subject. Thank you very much from now.

    Read the article

  • Using Groovy as a scripting language...

    - by Zombies
    I prefer to use scripting languages for short tasks, anything such as a really simple http bot, bulk importing/exporting data to/from somewhere, etc etc... Basic throw-away scripts and simple stuff. The point being, that a scripting language is just an efficient tool to write quick programs with. As for my understanding of Groovy at this point... If you were to program in Groovy, and you wan't to write a quick script, wouldn't you be forced to going back to regular java syntax (and we know how that can be convoluted compared to a scripting language) in order to do anything more complicated? For example, if I want to do some http scripting, wouldn't I just be right back at using java syntax to invoke Commons HttpClient? To me, the point of a scripting language is for quickly typed and less forced constructs. And here is another thing, it doesn't seem that there is any incentive for groovy based libraries to be developed when there are already so many good java one's out there, thus making groovy appear to be a Java dependent language with minor scripting features. So right now I am wondering if I could switch to Groovy as a scripting language or continue to use a more common scripting language such as Perl, Python or Ruby.

    Read the article

  • TableViewCell autorelease error

    - by iAm
    OK, for two days now i have been trying to solve an error i have inside the cellForRowAtIndex method, let start by saying that i have tracked down the bug to this method, the error is [CFDictionary image] or [Not a Type image] message sent to deallocated instance. I know about the debug flags, NSZombie, MallocStack, and others, they helped me narrow it down to this method and why, but I do not know how to solve besides a redesign of the app UI. SO what am i trying to do, well for this block of code, displays a purchase detail, which contains items, the items are in there own section, now when in edit mode, there appears a cell at the bottom of the items section with a label of "Add new Item", and this button will present a modal view of the add item controller, item is added and the view returns to the purchase detail screen, with the just added item in the section just above the "add new Item" cell, the problem happens when i scroll the item section off screen and back into view the app crashes with EXC_BAD_ACCESS, or even if i don't scroll and instead hit the back button on the navBar, still the same error. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { UITableViewCell *cell = nil; switch (indexPath.section) { case PURCHASE_SECTION: { static NSString *cellID = @"GenericCell"; cell = [tableView dequeueReusableCellWithIdentifier:cellID]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleValue2 reuseIdentifier:cellID] autorelease]; cell.accessoryType = UITableViewCellAccessoryDisclosureIndicator; } switch (indexPath.row) { case CATEGORY_ROW: cell.textLabel.text = @"Category:"; cell.detailTextLabel.text = [self.purchase.category valueForKey:@"name"]; cell.accessoryType = UITableViewCellAccessoryNone; cell.editingAccessoryType = UITableViewCellAccessoryDisclosureIndicator; break; case TYPE_ROW: cell.textLabel.text = @"Type:"; cell.detailTextLabel.text = [self.purchase.type valueForKey:@"name"]; cell.accessoryType = UITableViewCellAccessoryNone; cell.editingAccessoryType = UITableViewCellAccessoryDisclosureIndicator; break; case VENDOR_ROW: cell.textLabel.text = @"Payment:"; cell.detailTextLabel.text = [self.purchase.vendor valueForKey:@"name"]; cell.accessoryType = UITableViewCellAccessoryNone; cell.editingAccessoryType = UITableViewCellAccessoryDisclosureIndicator; break; case NOTES_ROW: cell.textLabel.text = @"Notes"; cell.editingAccessoryType = UITableViewCellAccessoryNone; break; default: break; } break; } case ITEMS_SECTION: { NSUInteger itemsCount = [items count]; if (indexPath.row < itemsCount) { static NSString *itemsCellID = @"ItemsCell"; cell = [tableView dequeueReusableCellWithIdentifier:itemsCellID]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:itemsCellID] autorelease]; cell.accessoryType = UITableViewCellAccessoryNone; } singleItem = [self.items objectAtIndex:indexPath.row]; cell.textLabel.text = singleItem.name; cell.detailTextLabel.text = [singleItem.amount formattedDataDisplay]; cell.imageView.image = [singleItem.image image]; } else { static NSString *AddItemCellID = @"AddItemCell"; cell = [tableView dequeueReusableCellWithIdentifier:AddItemCellID]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:AddItemCellID] autorelease]; cell.accessoryType = UITableViewCellAccessoryDisclosureIndicator; } cell.textLabel.text = @"Add Item"; } break; } case LOCATION_SECTION: { static NSString *localID = @"LocationCell"; cell = [tableView dequeueReusableCellWithIdentifier:localID]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:localID] autorelease]; cell.accessoryType = UITableViewCellAccessoryNone; } cell.textLabel.text = @"Purchase Location"; cell.accessoryType = UITableViewCellAccessoryDisclosureIndicator; cell.editingAccessoryType = UITableViewCellAccessoryNone; break; } default: break; } return cell; } the singleItem is of Modal Type PurchaseItem for core data now that i know what is causing the error, how do i solve it, I have tried everything that i know and some of what i dont know but still, no progress, please any suggestions as to how to solve this without redesign is my goal, perhaps there is an error i am doing that I cannot see, but if it's the nature of autorelease, than i will redesign.

    Read the article

  • Hadoop streaming with Python and python subprocess

    - by Ganesh
    I have established a basic hadoop master slave cluster setup and able to run mapreduce programs (including python) on the cluster. Now I am trying to run a python code which accesses a C binary and so I am using the subprocess module. I am able to use the hadoop streaming for a normal python code but when I include the subprocess module to access a binary, the job is getting failed. As you can see in the below logs, the hello executable is recognised to be used for the packaging, but still not able to run the code. . . packageJobJar: [/tmp/hello/hello, /app/hadoop/tmp/hadoop-unjar5030080067721998885/] [] /tmp/streamjob7446402517274720868.jar tmpDir=null JarBuilder.addNamedStream hello . . 12/03/07 22:31:32 INFO mapred.FileInputFormat: Total input paths to process : 1 12/03/07 22:31:32 INFO streaming.StreamJob: getLocalDirs(): [/app/hadoop/tmp/mapred/local] 12/03/07 22:31:32 INFO streaming.StreamJob: Running job: job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:31:32 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:31:33 INFO streaming.StreamJob: map 0% reduce 0% 12/03/07 22:32:05 INFO streaming.StreamJob: map 100% reduce 100% 12/03/07 22:32:05 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:32:05 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:32:05 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:32:05 ERROR streaming.StreamJob: Job not Successful! 12/03/07 22:32:05 INFO streaming.StreamJob: killJob... Streaming Job Failed! Command I am trying is : hadoop jar contrib/streaming/hadoop-*streaming*.jar -mapper /home/hduser/MARS.py -reducer /home/hduser/MARS_red.py -input /user/hduser/mars_inputt -output /user/hduser/mars-output -file /tmp/hello/hello -verbose where hello is the C executable. It is a simple helloworld program which I am using to check the basic functioning. My Python code is : #!/usr/bin/env python import subprocess subprocess.call(["./hello"]) Any help with how to get the executable run with Python in hadoop streaming or help with debugging this will get me forward in this. Thanks, Ganesh

    Read the article

  • What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

    - by Jason S
    I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

    Read the article

  • How can I effectively test against the Windows API?

    - by Billy ONeal
    I'm still having issues justifying TDD to myself. As I have mentioned in other questions, 90% of the code I write does absolutely nothing but Call some Windows API functions and Print out the data returned from said functions. The time spent coming up with the fake data that the code needs to process under TDD is incredible -- I literally spend 5 times as much time coming up with the example data as I would spend just writing application code. Part of this problem is that often I'm programming against APIs with which I have little experience, which forces me to write small applications that show me how the real API behaves so that I can write effective fakes/mocks on top of that API. Writing implementation first is the opposite of TDD, but in this case it is unavoidable: I do not know how the real API behaves, so how on earth am I going to be able to create a fake implementation of the API without playing with it? I have read several books on the subject, including Kent Beck's Test Driven Development, By Example, and Michael Feathers' Working Effectively with Legacy Code, which seem to be gospel for TDD fanatics. Feathers' book comes close in the way it describes breaking out dependencies, but even then, the examples provided have one thing in common: The program under test obtains input from other parts of the program under test. My programs do not follow that pattern. Instead, the only input to the program itself is the system upon which it runs. How can one effectively employ TDD on such a project?

    Read the article

  • Upgrade to Delphi 2010, or stick with Delphi 7 "forever"?

    - by tim11g
    I am an individual user of Delphi, starting back in the early Turbo Pascal days. I have quite a bit of code developed over the years, but I have never sold software commercially or used it for business. Historically, Borland supported the non-professional users with lower cost versions, but Embarcadero does not. As I consider upgrading to Delphi 2010, I am put off by the high price. Embarcadero is also trying to "encourage" upgrading by threatening to charge "new user" prices for upgrades after Dec 31st. I have several questions for the community to help me decide whether to upgrade. 1) I have read about difficulties updating existing code to support the unicode string types. I have no need for unicode strings, and I am happy with the string support in D7. Will I have to modify existing code and components just to re-compile under D2010? Or are there compiler options to allow backward compatibility if new string types are not required? 2) The main reason I'm considering upgrading is for IDE improvements, and to get access to new APIs added to Windows since 2002. Are there any Windows 7 APIs or capabilities that would be impossible to support from my programs compiled using using Delphi 7 (assuming appropriate JEDI API libraries, for example)? 3) Is there anything else about Delphi 2010 that is really compelling for someone who is primarily interested in Win32 apps, and not working with databases? I have read that D2010 is slow to load, and other versions between D7 and D2010 have had stability issues, and the help system was "broken". What is the biggest benefit to D2010?

    Read the article

  • Java: How do you really force a GC using JVMTI's ForceGargabeCollection?

    - by WizardOfOdds
    I'm not looking for the usual "you can only hint the GC in Java using System.gc()" answers, this is not at all what this question is about. My questions is not subjective and is based on a reality: GC can be forced in Java for a fact. A lot of programs that we use daily do it: IntelliJ IDEA, NetBeans, VisualVM. They all can force GC to happen. How is it done? I take it they're all using JVMTI and more specifically the ForceGarbabeCollection (notice the "Force") but how can I try it for myself? http://java.sun.com/javase/6/docs/platform/jvmti/jvmti.html#ForceGarbageCollection Also note that this question is not about "why" I'd want to do this: the "why" may be "curiosity" or "we're writing a program similar to VisualVM", etc. The question is really "how do you force a GC using JVMTI's ForceGarbageCollection"? Does the JVM needs to be launched with any special parameters? Is any JNI required? If so, what code exactly? Does it only work on Sun VMs? Any complete and compilable example would be most welcome.

    Read the article

  • WPF: Focus in a Window and UserControl

    - by Echilon
    I'm trying to get a UserControl to tab properly and am baffled. The logical tree looks like this. |-Window -Grid -TabControl -TabItem -StackPanel -MyUserControl |-StackPanel -GroupBox -Grid -ComboBox -Textbox1 -Textbox2 Everything works fine, except when the visibility converter for the ComboBox returns Visibility.Collapsed (don't allow user to change database mode), then when textbox1 is selected, instead of being able to tab through the controls in the UserControl, the focus shifts to a button declared at the bottom of the window. Nothing else apart from the controls displayed has TabIndex or FocusManager properties set. I'm banging my head against a brick wall and I must be missing something. I've tried IsFocusScope=True/False, played with FocusedElement and nothing works if that ComboBox is invisible (Visibility.Collapsed). <Window x:Class="MyNamespace.Client.WinInstaller" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" FocusManager.FocusedElement="{Binding ElementName=tabWizard}"> <Window.Resources> <props:Settings x:Key="settings" /> </Window.Resources> <Grid Grid.IsSharedSizeScope="True"> <!-- row and column definitions omitted --> <loc:SmallHeader Grid.Row="0" x:Name="headerBranding" HeaderText="Setup" /> <TabControl x:Name="tabWizard" DataContext="{StaticResource settings}" SelectedIndex="0" FocusManager.IsFocusScope="True"> <TabItem x:Name="tbStart" Height="0"> <StackPanel> <TextBlock Text="Database Mode"/> <loc:DatabaseSelector x:Name="dbSelector" AllowChangeMode="False" TabIndex="1" AvailableDatabaseModes="SQLServer" IsPortRequired="False" DatabaseMode="{Binding Default.DbMode,Mode=TwoWay,UpdateSourceTrigger=PropertyChanged}" DatabasePath="{Binding Default.DatabasePath,Mode=TwoWay,UpdateSourceTrigger=PropertyChanged}"/> </StackPanel> </TabItem> ... The top of the user control is below: <UserControl x:Class="MyNamespace.Client.DatabaseSelector" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Name="root" FocusManager.IsFocusScope="True" FocusManager.FocusedElement="{Binding ElementName=cboDbMode}"> <UserControl.Resources> <conv:DatabaseModeIsFileBased x:Key="DatabaseModeIsFileBased"/> <BooleanToVisibilityConverter x:Key="BooleanToVisibilityConverter"/> </UserControl.Resources> <StackPanel DataContext="{Binding}"> <GroupBox> <Grid> <!-- row and column definitions omitted --> <Label Content="Database Mode"/> <ComboBox x:Name="cboDbMode" SelectedValue="{Binding ElementName=root,Path=DatabaseMode,Mode=TwoWay,UpdateSourceTrigger=PropertyChanged}" DisplayMemberPath="Value" SelectedValuePath="Key" TabIndex="1" Visibility="{Binding AllowChangeMode,ElementName=root,Converter={StaticResource BooleanToVisibilityConverter}}" /> <!-- AllowChangeMode is a DependencyProperty on the UserControl --> <Grid><!-- row and column definitions omitted --> <Label "Host"/> <TextBox x:Name="txtDBHost" Text="{Binding ElementName=root,Path=DatabaseHost,Mode=TwoWay,UpdateSourceTrigger=PropertyChanged}" TabIndex="2" /> <TextBox x:Name="txtDBPort" Text="{Binding ElementName=root,Path=DatabasePortString,Mode=TwoWay,UpdateSourceTrigger=PropertyChanged}" TabIndex="3" />

    Read the article

  • How to create an SaaS Application?

    - by Andrew
    I don't know how else to say it so I'm just going to explain my ideal scenario and hopefully you can explain to me how to implement it... I'm creating an application with the Zend Framework that will be hosted with DreamHost. The application will be hosted on its own domain (i.e. example-app.com). Basically, a user should be able to sign up, get their own domain sampleuser.example-app.com or example-app.com/sampleuser which points to, what looks like their own instance of the app, which is really a single instance serving up different content based on the url. Eventually, I want my users to be able to create their own domain (like foobar.com) that points to sampleuser.example-app.com, such that visitors to foobar.com don't notice that the site is really being served up from example-app.com. I don't know how to do most of that stuff. How does this process work? Do I need to do some funky stuff with Apache or can this be done with a third party host, like DreamHost? Update: Thanks for the advice! I've decided to bite the bullet and upgrade my hosting plan to utilize wildcard subdomains. It's cheaper than I was expecting! I also found out about domain reseller programs, like opensrs.com, that have their own API. I think using one of these APIs will be the solution to my domain registration issue.

    Read the article

  • Boost.MultiIndex: Are there way to share object between two processes?

    - by Arman
    Hello, I have a Boost.MultiIndex big array about 10Gb. In order to reduce the reading I thought there should be a way to keep the data in the memory and another client programs will be able to read and analyse it. What is the proper way to organize it? The array looks like: struct particleID { int ID;// real ID for particle from Gadget2 file "ID" block unsigned int IDf;// postition in the file particleID(int id,const unsigned int idf):ID(id),IDf(idf){} bool operator<(const particleID& p)const { return ID<p.ID;} unsigned int getByGID()const {return (ID&0x0FFF);}; }; struct ID{}; struct IDf{}; struct IDg{}; typedef multi_index_container< particleID, indexed_by< ordered_unique< tag<IDf>, BOOST_MULTI_INDEX_MEMBER(particleID,unsigned int,IDf)>, ordered_non_unique< tag<ID>,BOOST_MULTI_INDEX_MEMBER(particleID,int,ID)>, ordered_non_unique< tag<IDg>,BOOST_MULTI_INDEX_CONST_MEM_FUN(particleID,unsigned int,getByGID)> > > particlesID_set; Any ideas are welcome. kind regards Arman.

    Read the article

  • Android: Get the X and Y coordinates of a TextView?

    - by Jep Knopz
    I am working now on a project. I have 2 draggable textView in a circle. I want to add those value inside the circle when the circle is drag over the other circle. the first option that I have is to get the X and Y of the circle, but I get it. Can anyone fix my code? Here is the Code: MainActivity public class MainActivity extends Activity { int windowwidth; int windowheight; TextView bola; TextView bola2; private float x; private float y; private android.widget.RelativeLayout.LayoutParams layoutParams; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); windowwidth = getWindowManager().getDefaultDisplay().getWidth(); windowheight = getWindowManager().getDefaultDisplay().getHeight(); bola = (TextView) findViewById(R.id.ball); bola2 = (TextView) findViewById(R.id.ball2); bola2.setOnTouchListener(new View.OnTouchListener() { @Override public boolean onTouch(View v, MotionEvent event) { // TODO Auto-generated method stub layoutParams = (RelativeLayout.LayoutParams) bola2 .getLayoutParams(); switch (event.getActionMasked()) { case MotionEvent.ACTION_DOWN: break; case MotionEvent.ACTION_MOVE: int x_cord = (int) event.getRawX(); int y_cord = (int) event.getRawY(); if (x_cord > windowwidth) { x_cord = windowwidth; } if (y_cord > windowheight) { y_cord = windowheight; } layoutParams.leftMargin = x_cord - 25; layoutParams.topMargin = y_cord - 75; bola2.setLayoutParams(layoutParams); break; default: break; } return true; } }); bola.setOnTouchListener(new View.OnTouchListener() { @Override public boolean onTouch(View v, MotionEvent event) { layoutParams = (RelativeLayout.LayoutParams) bola .getLayoutParams(); switch (event.getActionMasked()) { case MotionEvent.ACTION_DOWN: break; case MotionEvent.ACTION_MOVE: int x_cord = (int) event.getRawX(); int y_cord = (int) event.getRawY(); if (x_cord > windowwidth) { x_cord = windowwidth; } if (y_cord > windowheight) { y_cord = windowheight; } layoutParams.leftMargin = x_cord - 25; layoutParams.topMargin = y_cord - 75; bola.setLayoutParams(layoutParams); break; default: break; } // TODO Auto-generated method stub return true; } }); } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.activity_main, menu); return true; }} Activity_main.xml <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:layout_width="match_parent" android:layout_height="match_parent" > <TextView android:id= "@+id/ball" android:background="@drawable/bgshape" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="1" tools:context=".MainActivity" /> <TextView android:id= "@+id/ball2" android:background="@drawable/bgshape" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="2" tools:context=".MainActivity" android:layout_x="60dp" android:layout_y="20dp" /> The bgshape.xml(for the circle) <?xml version="1.0" encoding="utf-8"?> <shape xmlns:android="http://schemas.android.com/apk/res/android" > <padding android:bottom="20dp" android:left="25dp" android:right="25dp" android:top="20dp" /> <stroke android:width="2dp" android:color="#000000" /> <solid android:color="#ffffff" /> <corners android:bottomLeftRadius="30dp" android:bottomRightRadius="30dp" android:topLeftRadius="30dp" android:topRightRadius="30dp" /> This code works well. Could anyone fix this so that I can add the value inside the circle when they hit each other?

    Read the article

  • VB.NET - Object reference not set to an instance of an object

    - by Daniel
    I need some help with my program. I get this error when I run my VB.NET program with a custom DayView control. ***** Exception Text ******* System.NullReferenceException: Object reference not set to an instance of an object. at SeaCow.Main.DayView1_ResolveAppointments(Object sender, ResolveAppointmentsEventArgs args) in C:\Users\Daniel\My Programs\Visual Basic\SeaCow\SeaCow\SeaCow\Main.vb:line 120 at Calendar.DayView.OnResolveAppointments(ResolveAppointmentsEventArgs args) at Calendar.DayView.OnPaint(PaintEventArgs e) at System.Windows.Forms.Control.PaintWithErrorHandling(PaintEventArgs e, Int16 layer) at System.Windows.Forms.Control.WmPaint(Message& m) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) According to the error code, the 'for each' loop below is causing the NullReferenceException error. At default, the 'appointments' list is assigned to nothing and I can't find where the ResolveAppointments function is being called at. Private Sub DayView1_ResolveAppointments(ByVal sender As Object, ByVal args As Calendar.ResolveAppointmentsEventArgs) Handles DayView1.ResolveAppointments Dim m_Apps As New List(Of Calendar.Appointment) For Each m_App As Calendar.Appointment In appointments If (m_App.StartDate >= args.StartDate) AndAlso (m_App.StartDate <= args.EndDate) Then m_Apps.Add(m_App) End If Next args.Appointments = m_Apps End Sub Anyone have any suggestions?

    Read the article

  • How do I use connect to DB2 with DBI and mod_perl?

    - by Matthew
    I'm having issues with getting DBI's IBM DB2 driver to work with mod_perl. My test script is: #!/usr/bin/perl use strict; use CGI; use Data::Dumper; use DBI; { my $q; my $dsn; my $username; my $password; my $sth; my $dbc; my $row; $q = CGI->new; print $q->header; print $q->start_html(); $dsn = "DBI:DB2:SAMPLE"; $username = "username"; $password = "password"; print "<pre>".$q->escapeHTML(Dumper(\%ENV))."</pre>"; $dbc = DBI->connect($dsn, $username, $password); $sth = $dbc->prepare("SELECT * FROM SOME_TABLE WHERE FIELD='SOMETHING'"); $sth->execute(); $row = $sth->fetchrow_hashref(); print "<pre>".$q->escapeHTML(Dumper($row))."</pre>"; print $q->end_html; } This script works as CGI but not under mod_perl. I get this error in apache's error log: DBD::DB2::dr connect warning: [unixODBC][Driver Manager]Data source name not found, and no default driver specified at /usr/lib/perl5/site_perl/5.8.8/Apache/DBI.pm line 190. DBI connect('SAMPLE','username',...) failed: [unixODBC][Driver Manager]Data source name not found, and no default driver specified at /data/www/perl/test.pl line 15 First of all, why is it using ODBC? The native DB2 driver is installed (hence it works as CGI). Running Apache 2.2.3, mod_perl 2.0.4 under RHEL5. This guy had the same problem as me: http://www.mail-archive.com/[email protected]/msg22909.html But I have no idea how he fixed it. What does mod_php4 have to do with mod_perl? Any help would be greatly appreciated, I'm having no luck with google. Update: As james2vegas pointed out, the problem has something to do with PHP: I disable PHP all together I get the a different error: Total Environment allocation failure! Did you set up your DB2 client environment? I believe this error is to do with environment variables not being set up correctly, namely DB2INSTANCE. However, I'm not able to turn off PHP to resolve this problem (I need it for some legacy applications). So I now have 2 questions: How can I fix the original issue without disabling PHP all together? How can I fix the environment issue? I've set DB2INSTANCE, DB2_PATH and SQLLIB variables correctly using SetEnv and PerlSetEnv in httpd.conf, but with no luck. Note: I've edited the code to determine if the problem was to do with Global Variable Persistence.

    Read the article

  • Create a VPN with Python

    - by user213060
    I want to make a device "tunnel box" that you plug an input ethernet line, and an output ethernet line, and all the traffic that goes through it gets modified in a special way. This is similar to how a firewall, IDS, VPN, or similar boxes are connected inline in a network. I think you can just assume that I am writing a custom VPN in Python for the purpose of this question: LAN computer <--\ LAN computer <---> [LAN switch] <--> ["tunnel box"] <--> [internet modem] <--> LAN computer <--/ My question is, what is a good way to program this "tunnel box" from python? My application needs to see TCP flows at the network layer, not as individual ethernet frames. Non-TCP/IP traffic such as ICPM and other types should just be passed through. Example Twisted-like Code for my "tunnel box" tunnel appliance: from my_code import special_data_conversion_function class StreamInterceptor(twisted.Protocol): def dataReceived(self,data): data=special_data_conversion_function(data) self.outbound_connection.send(data) My initial guesses: TUN/TAP with twisted.pair.tuntap.py - Problem: This seems to only work at the ethernet frame level, not like my example? Socks proxy - Problem: Not transparent as in my diagram. Programs have to be specifically setup for it. Thanks!

    Read the article

  • How to launch multiple Internet Explorer windows/tabs from batch file?

    - by TheZenker
    I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • How can I get the output of a command terminated by a alarm() call in Perl?

    - by rockyurock
    Case 1 If I run below command i.e iperf in UL only, then i am able to capture the o/p in txt file @output = readpipe("iperf.exe -u -c 127.0.0.1 -p 5001 -b 3600k -t 10 -i 1"); open FILE, ">Misplay_DL.txt" or die $!; print FILE @output; close FILE; Case 2 When I run iperf in DL mode , as we know server will start listening in cont. mode like below even after getting data from client (Here i am using server and client on LAN) @output = system("iperf.exe -u -s -p 5001 -i 1"); on server side: D:\_IOT_SESSION_RELATED\SEEM_ELEMESNTS_AT_COMM_PORT_CONF\Tput_Related_Tools\AUTO MATION_APP_\AUTOMATION_UTILITYiperf.exe -u -s -p 5001 ------------------------------------------------------------ Server listening on UDP port 5001 Receiving 1470 byte datagrams UDP buffer size: 8.00 KByte (default) ------------------------------------------------------------ [1896] local 192.168.5.101 port 5001 connected with 192.168.5.101 port 4878 [ ID] Interval Transfer Bandwidth Jitter Lost/Total Datagrams [1896] 0.0- 2.0 sec 881 KBytes 3.58 Mbits/sec 0.000 ms 0/ 614 (0%) command prompt does not appear , process is contd... on client side: D:\_IOT_SESSION_RELATED\SEEM_ELEMESNTS_AT_COMM_PORT_CONF\Tput_Related_Tools\AUTO MATION_APP_\AUTOMATION_UTILITYiperf.exe -u -c 192.168.5.101 -p 5001 -b 3600k -t 2 -i 1 ------------------------------------------------------------ Client connecting to 192.168.5.101, UDP port 5001 Sending 1470 byte datagrams UDP buffer size: 8.00 KByte (default) ------------------------------------------------------------ [1880] local 192.168.5.101 port 4878 connected with 192.168.5.101 port 5001 [ ID] Interval Transfer Bandwidth [1880] 0.0- 1.0 sec 441 KBytes 3.61 Mbits/sec [1880] 1.0- 2.0 sec 439 KBytes 3.60 Mbits/sec [1880] 0.0- 2.0 sec 881 KBytes 3.58 Mbits/sec [1880] Server Report: [1880] 0.0- 2.0 sec 881 KBytes 3.58 Mbits/sec 0.000 ms 0/ 614 (0%) [1880] Sent 614 datagrams D:\_IOT_SESSION_RELATED\SEEM_ELEMESNTS_AT_COMM_PORT_CONF\Tput_Related_Tools\AUTO MATION_APP_\AUTOMATION_UTILITY so with this as server is cont. listening and never terminates so can't take output of server side to a txt file as it is going to the next command itself to create a txt file so i adopted the alarm() function to terminate the server side (iperf.exe -u -s -p 5001) commands after it received all data from the client. could anybody suggest me the way.. Here is my code: #! /usr/bin/perl -w my $command = "iperf.exe -u -s -p 5001"; my @output; eval { local $SIG{ALRM} = sub { die "Timeout\n" }; alarm 20; #@output = `$command`; #my @output = readpipe("iperf.exe -u -s -p 5001"); #my @output = exec("iperf.exe -u -s -p 5001"); my @output = system("iperf.exe -u -s -p 5001"); alarm 0; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", @output; } open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; i know that with system command i cannot capture the o/p to a txt file but i tried with readpipe() and exec() calls also but in vain... could some one please take a look and let me know why the iperf.exe -u -s -p 5001 is not terminating even after the alarm call and to take the out put to a txt file

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • call/cc in Lua - Possible?

    - by Pessimist
    The Wikipedia article on Continuation says: "In any language which supports closures, it is possible to write programs in continuation passing style and manually implement call/cc." Either that is true and I need to know how to do it or it is not true and that statement needs to be corrected. If this is true, please show me how to implement call/cc in Lua because I can't see how. I think I'd be able to implement call/cc manually if Lua had the coroutine.clone function as explained here. If closures are not enough to implement call/cc then what else is needed? The text below is optional reading. P.S.: Lua has one-shot continuations with its coroutine table. A coroutine.clone function would allow me to clone it to call it multiple times, thus effectively making call/cc possible (unless I misunderstand call/cc). However that cloning function doesn't exist in Lua. Someone on the Lua IRC channel suggested that I use the Pluto library (it implements serialization) to marshal a coroutine, copy it and then unmarshal it and use it again. While that would probably work, I am more interested in the theoretical implementation of call/cc and in finding what is the actual minimum set of features that a language needs to have in order to allow for its manual implementation.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • What programming languages do the top tier Universities teach?

    - by Simucal
    I'm constantly being inundated with articles and people talking about how most of today's Universities are nothing more than Java vocational schools churning out mediocre programmer after mediocre programmer. Our very own Joel Spolsky has his famous article, "The Perils of Java Schools." Similarly, Alan Kay, a famous Computer Scientist (and SO member) has said this in the past: "I fear — as far as I can tell — that most undergraduate degrees in computer science these days are basically Java vocational training." - Alan Kay (link) If the languages being taught by the schools are considered such a contributing factor to the quality of the school's program then I'm curious what languages do the "top-tier" computer science schools teach (MIT, Carnegie Mellon, Stanford, etc)? If the average school is performing so poorly due in large part the languages (or lack of) that they teach then what languages do the supposed "good" cs programs teach that differentiate them? If you can, provide the name of the school you attended, followed by a list of the languages they use throughout their coursework. Edit: Shog-9 asks why I don't get this information directly from the schools websites themselves. I would, but many schools websites don't discuss the languages they use in their class descriptions. Quite a few will say, "using high-level languages we will...", without elaborating on which languages they use. So, we should be able to get a pretty accurate list of languages taught at various well known institutions from the various SO members who have attended at them.

    Read the article

< Previous Page | 699 700 701 702 703 704 705 706 707 708 709 710  | Next Page >