Search Results

Search found 25727 results on 1030 pages for 'solution'.

Page 735/1030 | < Previous Page | 731 732 733 734 735 736 737 738 739 740 741 742  | Next Page >

• How to find the largest power of 2 less than the given number

  - by nazar_art

  I need to find the largest power of 2 less than the given number. And I stuck and can't find any solution. Code: public class MathPow { public int largestPowerOf2 (int n) { int res = 2; while (res < n) { res =(int)Math.pow(res, 2); } return res; } } This doesn't work correctly. Testing output: Arguments Actual Expected ------------------------- 9 16 8 100 256 64 1000 65536 512 64 256 32 How to solve this issue?

  Read the article

• Password Protected Android App

  - by Caution Continues

  I wana make a security app and in case of stolen or lost my app must not be uninstalled without taking password. yes It is possible to make such an app that can take password before getting uninstall.. My friend Aditya Nikhade has made this app :) .But he is not giving me this secrete recipe:( Install this app Findroid from google Play. In this app first you need to unlock your app then only u can uninstall it. So please help me how to crack this technique.. I searched and got some incomplete answer in that we can declare a receiver of type PACKAGED_REMOVED but i want to know how can I stop if my app is being uninstalled. I am little close to solution of it. I am working/studying on Device Administrator. Please paste code snippet if anyone have. Thanks a Ton in advanced....!!!

  Read the article

• using i18n characters in url of image tag does not display the image

  - by user363171

  I am using the image tag as the path /data/image/image.txt does exists. and it displays the image also. but when i introduce some i18n characters in the path lets say it says 404 error image not found, but the path /data/image??/image.txt does exists, please help me to find the solution for this? I used the firebug also to see whether the characters are decoded properly or not, in firebug I am able to see the correct characters they are not changed, still it is not able to pick the image. thanks a lot in advance. Note: I am using tag because it was not allowing me to write the img tab in the post, and i have changed the jif ext to txt. please consider this.

  Read the article

• XmlResolver Class' GetEntity function

  - by Pok

  I wrote a custom resolver class. It works OK for resolving SYSTEM DTDs, but not for resolving PUBLIC DTDs. When the class has to resolve PUBLIC DTDs instead of the URI of the resource, the function receives the public identifier through the absoluteUri parameter of the GetEntity function. Is there a solution to this. In examples: if I have a DTD declaration like <!DOCTYPE document SYSTEM "document.dtd"> then the custom resolver correctly receives the string "document.dtd" through the absoluteUri parameter of the GetEntity function. if I have a DTD declaration like <!DOCTYPE document PUBLIC "-//Organization//DTD Document 1.0//EN" "http://localhost/document.dtd"> then the custom resolver incorrectly receives the string "-//Organization//DTD Document 1.0//EN" instead of "scheme://host/document.dtd".

  Read the article

• Dropdown menu getting hidden by images

  - by Bob

  I have a set of dropdown menus across the top of a web page. Below is text and some images. When I hover over the top of each menu the menu then expands below as expected but while it overlaps any text on the page it is hidden behind any images. I set the z-index to 9999 and the position is set to absolute. I found if I lower the opacity of the images to say 0.6 then the menu will overlap it. So one solution would be to detect when the menu is being hovered over and then in JavaScript or JQuery temporarily reduce the opacity of the rest of the page until the cursor moves off the menu. If so I'm not sure how to do that but is that the best approach?

  Read the article

• Contents of a node in Nokogiri

  - by Styggentorsken

  Is there a way to select all the contents of a node in Nokogiri? <root> <element>this is <hi>the content</hi> of my æøå element</element> </root> The result of getting the content of /root/element should be this is <hi>the content</hi> of my æøå element Edit: It seems like the solution is simply to use myElement.inner_html(). The problem I had was in fact that I was relying on an old version of libxml2, which escaped all the special characters.

  Read the article

• How can I determine new & previous cell value on SheetChange event in Excel?

  - by Falco Foxburr

  I have some special cells in my Excel workbooks which are managed by my Excel Add-in. I want to prevent users from changing content of those cells, but I also want to know, what value users wanted to enter to those cells. On the SheetChange event I can check what users entered to my special cells, but how do I determine the PREVIOUS value in those cells and REVERT user changes? It is not a solution for me. If I lock cell in Excel, it becomes read-only - user can not even try to enter anything to this cell - Excel popups warning dialog in this case. My problem is that I want to catch what user entered to my cell, do something with this value, and then revert cell content to original value.

  Read the article

• INSERT INTO othertbl SELECT * tbl

  - by Harry

  Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

  Read the article

• Wordpress Custom Type permalink containing Taxonomy slug

  - by treznik

  I'm trying to create a permalink pattern for a Custom Type, that includes one of its taxonomies. The taxonomy name is known from the start (so I'm not trying to add or mix all of its taxonomies, just a specific one), but the value will by dynamic, of course. Normally, the Custom Type permalink is built using the rewrite arg with the slug param, but I don't see how I could add a dynamic variable in there. http://codex.wordpress.org/Function_Reference/register_post_type I'm guessing a custom solution is required, but I'm not sure what the best unintrusive approach would be. Is there a known practice for this or has anyone built something similar recently? I'm using WP 3.2.1 btw.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Waiting for DialogActivity to return before continuing executing of the main thread

  - by jax

  How would I force the current thread to wait until another has finished before continuing. In my program the user selects a MODE from an AlertDialog, I want to halt executing of the program before continuing as the mode holds important configuration for the gameplay. new AlertDialog.Builder(this) .setItems(R.array.game_modes, new DialogInterface.OnClickListener() { public void onClick(DialogInterface dialog, int which) { switch (which) { case 0: setMode(TRAINING_MODE); case 1: setMode(QUIZ_MODE); default: setMode(TRAINING_MODE); break; } //continue loading the rest of onCreate(); contineOnCreate(); } }) .create().show(); If this is impossible can anyone give a possible solution?

  Read the article

• How should 4 decimals places behave, being simple yet powerful

  - by vener

  I have a UI question that troubled me on the best method to handle 4 decimal places for prices. In an table already cramped full of data, I would want to simplified the interface to make it not so cluttered. The actual current UI is shown below. http://i41.tinypic.com/bg5tub.jpg The problem is, for a unit price/units/D.Price and Dis.(Discount) to have 4 decimal places ($0.3459) is quite rare but it still happens (5 in 100 entries). This will result a lot of junk decimal places, cluttering up the interface. What is the best solution to this problem? In short, I want to declutter it yet maintain the precision. Note: This is web app

  Read the article

• PhotobucketNet photo upload

  - by n1tr0

  I have a problem with PhotobucketNet user login(I need user to login so I can upload a picture from HDD to his Photobucket account). Photobucket photobucket = new Photobucket("myapikey", "myapisecret"); photobucket.LaunchUserLogin(); // the problem happens here photobucket.RequestUserToken(); If I call RequestUserToken() it will happen immediately, so I'll get a crash cause user didn't logged in, and there is no event that's been raised after user logs in. Is there some variable(bool or something else) that I can check to see if user logged in - maybe to put it in a loop with timer? Also is their a way to know if user canceled logging in? I know that timer isn't a good solution, so if anyone has anything better as an idea, I'm open for any suggestions...

  Read the article

• Using Silverlight with Existing Application

  - by Silverlight_noob

  This seems like a very basic question but I couldn't find any help on web. If you could provide some link or steps to do this. I have created few basic Silverlight applications which are working fine standalone. I also have a basic ASP.NET application with a solution with around 10 Class Library Projects and 1 website. I want to create a small popup which will have some funtionality using Silverlight. How should I go about creating this application and how to integrate it with my existing application for it to show as a link. I would not want that link to open another application/site. Thanks.

  Read the article

• WMI instrinsic events. Resources

  - by Nickolodeon

  Hi. I subscribe to usb inserted event like this select * FROM __INSTANCECREATIONEVENT WITHIN 3 WHERE TARGETINSTANCE ISA Win32_DiskDrive After inserting usb flash it blinks every 3 seconds. This is polling interval and intrinsic events work by polling object that's in query. Now, we know these types of events may be resource expensive. (Putting value greater then 3 sometimes chokes these events and client program doesn't get notified). Are there other ways to do that, so that usb doesn't get scanned all the time? May be there some extrinsic events available? Right now the only solution I see is to unsubscribe from event above once it trigerred and resubscribe to it in __INSTANCEDELETIONEVENT handler. Hm, althought deletionevent will also poll diskdrive controllers(

  Read the article

• Restricting IFRAME access in PHP

  - by m0j0

  I am creating a small web page using PHP that will be accessed as an IFRAME from a couple of sites. I'm wanting to restrict access to this site to work ONLY within the "approved" sites, and not other sites or accessed directly. Does anyone have any suggestions? Is this even possible? The PHP site will be Apache, and the sites iframing the content will probably be .NET. Just to clarify, any site can view the page, as long as it's iframe'd within an approved site. I want to block people from accessing it directly. I'm thinking cookies might be a solution, but I'm not sure.

  Read the article

• Deprecated: Function eregi() is deprecated, how to solve this error ?

  - by Jitendra Vyas

  I'm using this php code. but it's giving error Deprecated: Function eregi() is deprecated in C:\xampp\htdocs\fuel\emailcheck.php on line 7 <? include_once("mastersecure.php"); $emailcheck=$_POST["member_name"]; function isValidEmail($email){ $pattern = "^[_a-z0-9-]+(\.[_a-z0-9-]+)*@[a-z0-9-]+(\.[a-z0-9-]+)*(\.[a-z]{2,3})$"; if (eregi($pattern, $email)){ return true; } else { return false; } } if (!isValidEmail($_POST['member_name'])){ echo "The email is invalid!"; } else { $query="select email from fuel where email='$_POST[member_name]'"; $res=mysql_query($query); $rowcount=mysql_num_rows($res); if($rowcount!=0) { echo "This mail is already exits"; } } ?> Any solution for this?

  Read the article

• Interesting XSL Dilemma

  - by bobber205

  I've got this issue. A template called "checkbox" that's called from while inside a table HTML element and also outside of it. To solve an issue, I've added tags to "checkbox" input control. Here's what I'd like to do to but I'm not sure if it's possible or not. When I hit my "row" (part of the custom table markup) template, I would set some variable or pass some parameter, that for each template applied afterwards, would know it was in a "row" and do something special based on this information. I know I can't add parameters to apply-templates. I may be able to add a row "mode" but I can't make changes to each template and have one copy with the mod parameter and one without. Thanks for any suggestions. I know the ideal solution would to be to make changes to the XML but I'm not sure if I can do that as this point. That's a "content" issue. :P Thanks!

  Read the article

• How to arrange labels in a flowlayout manner?

  - by Tim Büthe

  How do I arrange some UILabels and/or UIButtons of a variable length? I just want to add them to a UITableViewCell and they should arrange in a left-to-right flow, much like lines of text in a paragraph. I only found possibilities to create lables with a fixed size and position using "initWithFrame:...". Same seems to be true for Interface Builder, as far as I can tell. Any solution is appreciated no matter if it's done in code or using a custom cell XIB-file.

  Read the article

• Is there a %in% operator accros multiple columns

  - by RobinLovelace

  Imagine you have two data frames df1 <- data.frame(V1 = c(1, 2, 3), v2 = c("a", "b", "c")) df2 <- data.frame(V1 = c(1, 2, 2), v2 = c("b", "b", "c")) Here's what they look like, side by side: > cbind(df1, df2) V1 v2 V1 v2 1 1 a 1 b 2 2 b 2 b 3 3 c 2 c You want to know which observations are duplicates, across all variables. This can be done by pasting the cols together and then using %in%: df1Vec <- apply(df1, 1, paste, collapse= "") df2Vec <- apply(df2, 1, paste, collapse= "") df2Vec %in% df1Vec [1] FALSE TRUE FALSE The second observation is thus the only one in df2 and also in df1. Is there no faster way of generating this output - something like %IN%, which is %in% across multiple variables, or should we just be content with the apply(paste) solution?

  Read the article

• download authentication?

  - by Sahat

  Hi I am sorry if this question has been asked before but I am looking for some sort of download authentication. In other words if I am going to give the user a link to a file, I want to make sure only that person will get it, and get it only once! Is there a simple solution without setting up the whole database. Even better if it's possible to have an ecrypted web link that will let you download a file from my FTP server just once, after that the link becomes invalid. Thanks.

  Read the article

• The right way to setup VisualStudio 2010 for OpenCL

  - by LonliLokli

  what is the right way to setup VisualStuio 2010 for working with *.cl files? I have added *.cl under Tool/Text editor/File extensions and copied usertype.dat into the common7/ide folder, but VS underlines keywords like float4 or cross. Is it necessary to add some key in registry or can somebody propose a tutorial? Thanks in advance. PS i have already asked similar question old one question, but now i am looking explicit for a solution with vs2010. It is not bad, but really nerves and deflects me from programming tasks.

  Read the article

• Is it possible (and how) to remove unutilized widgets from Ext JS library?

  - by Kabeer

  Hello. Ext JS base and widgets together offer me the solution I've been looking for. The Ext JS library is somewhat heavy w.r.t. conventional standards. There are several widgets in the library that I am not using. So I want to know if it is possible to remove the corresponding code (of widgets not being used) from the ext-all.js ? To put it in other words, is it possible to compose a master Java Script of Ext JS that comprises of only the widgets of my interest? If there is a way I'd love to know.

  Read the article

• Why only random-access-iterator implements operator+ in C++?

  - by xopht

  I'd like get far next value for STL list iterator but it doesn't implement operator+, vector has it though. Why and how can I get the value where I want? I think I can do that if I call operator++ several times, but isn't that a little bit dirty? What I want to do is the following: list<int> l; ...omitted... list<int>::iterator itr = l.begin() + 3; // but, list iterator does not have // operator+ What is the best solution for what I want?

  Read the article

• Algorithm for finding all paths in a NxN grid

  - by Periastron

  Imagine a robot sitting on the upper left hand corner of an NxN grid. The robot can only move in two directions: right and down. How many possible paths are there for the robot? I could find solution to this problem on Google, but I am not very clear with the explanations. I am trying to clearly understand the logic on how to solve this and implement in Java. Any help is appreciated. Update: This is an interview question. For now, I am trying to reach the bottom-right end and print the possible paths.

  Read the article

< Previous Page | 731 732 733 734 735 736 737 738 739 740 741 742  | Next Page >