Search Results

Search found 25727 results on 1030 pages for 'solution'.

Page 736/1030 | < Previous Page | 732 733 734 735 736 737 738 739 740 741 742 743  | Next Page >

• Interesting XSL Dilemma

  - by bobber205

  I've got this issue. A template called "checkbox" that's called from while inside a table HTML element and also outside of it. To solve an issue, I've added tags to "checkbox" input control. Here's what I'd like to do to but I'm not sure if it's possible or not. When I hit my "row" (part of the custom table markup) template, I would set some variable or pass some parameter, that for each template applied afterwards, would know it was in a "row" and do something special based on this information. I know I can't add parameters to apply-templates. I may be able to add a row "mode" but I can't make changes to each template and have one copy with the mod parameter and one without. Thanks for any suggestions. I know the ideal solution would to be to make changes to the XML but I'm not sure if I can do that as this point. That's a "content" issue. :P Thanks!

  Read the article

• Directions and Opinions on Creating Update System for the Application.

  - by AlwaysBeCoding

  Hi people. I just try to figure out a good solution on designing the update process for a windows form application i created. I think of a button inside the app for manual checking of an update and checking when starting the app. Only I'm not familiar with technics. I though to have the update setup file in a FTP Server and checking the server for an update with a txt file in there with filename and version info. When app is finished downloading the update, closing and starting the update setup file. Any suggestions, opinions on the subject?

  Read the article

• While programming, what to do when facing with a seemingly unsolvable situation with a time limit?

  - by Ersan Tasan

  This is not a technical question, but rather a social and methodical one. I am a computer sciences student and I usually have really tough programming assignments. I don`t know if it is only happening to me but sometimes, particularly when deadline is approaching, i find myself in a harsh situation. I cannot find my mistake in the code or come up with a another great idea. Then boredom comes in and the problem begins to seem unsolvable. I know there are more-than-great professional coders here. I would like to learn their ideas to cope with this situation. Is it better to focus on something else for a while and try again or try harder and harder and look for the solution on the net etc...

  Read the article

• Access DB with SQL Server Front End

  - by uyuni99

  I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

  Read the article

• Best way to integrate searching with pagination

  - by Vijay Choudhary

  I have a web application build on cakephp 2.x. I have integrated pagination on my data. Now i want to implement searching on that data also, and pagination should work according to search result. Now my question is: Should i use a form to post my search string. If so, then which method should i use, GET or POST. OR, should i use javascript window.location method, and append the search string to it. If we use this method then search string can append more than once to url. Or any other best way to implement this. Can anybody give the best solution for this as it is a common task for each application to have.

  Read the article

• How to send mail using PHP?

  - by phpaddict

  I'm using Windows Vista OS. PHP, MySQL as the database and Apache web server. I want to send notification to those who want to join in my site. But the problem is when I click submit. It doesn't send anything to the email address of the user. What to do you think is the best solution for this? <?php $to = "[email protected]"; $subject = "Hi!"; $body = "Hi,\n\nHow are you?"; if (mail($to, $subject, $body)) { echo("<p>Message successfully sent!</p>"); } else { echo("<p>Message delivery failed...</p>"); } ?>

  Read the article

• Group Objects by Common Key

  - by Marshmellow1328

  I have a list of Customers. Each customer has an address and some customers may actually have the same address. My ultimate goal is to group customers based on their address. I figure I could either put the customers in some sort of list-based structure and sort on the addresses, or I could drop the objects into some sort of map that allows multiple values per key. I will now make a pretty picture: List: A1 - C1, A1 - C2, A2 - C3, A3 - C4, A3 - C5 Map: A1 A2 A3 C1 C3 C4 C2 C5 Which option (or any others) do you see as the best solution? Are there any existing classes that will make development easier?

  Read the article

• Row for each hour even if there is no record

  - by peku33

  I've got a trouble with creating mysql Query. My PHP script executes this query on each run: INSERT INTO Executes SET UserIp='%s' (%s is user IP) Executes table is: ExecuteId UNSIGNED BIGINT AI PRIMARY Date TIMESTAMP DEFAULT CURRENT_TIMESTAMP INDEX UserIp CHAR(24) ... | Some Columns I want to retrive number of Executes in each hour. The most obvious solution would be: SELECT COUNT(*) as ExecutesNum, DATE(Date) as D, HOUR(Date) as H GROUP BY D, H And it works, BUT it does not create rows for hours where there were no executes. What should I modify to get result like: 1 | 2012-09-01 | 14 **0 | 2012-09-01 | 15** 11 | 2012-09-01 | 16 1 | 2012-09-01 | 17

  Read the article

• Service Discovery in J2ME

  - by thiagolee

  Hello, I have an application to run on a cell phone equipped with Wi-Fi and an application on a desktop which I want to communicate with. The problem is that I want to find in a Local Area Network the IP and port of the machine who has my service running. I can guarantee that there will be at maximum only one machine running it. I searched a lot for a way to do this but I ended up with nothing. I read something about WebServices, but it didn't seen to be what I wanted, what I want is really simple. I actually found a solution for it, but it can't be ported to J2ME. Anyone can help? Thanks.

  Read the article

• best method in jquery for replacing rows in a table after server side processing such as mysql sorti

  - by Kevin J

  What is the 'best practice' when returning dynamic data for a table (server side sorting, filtering etc from a db) ? Do you return just the data in json, and repeatedly clone a row element, replacing the values in each row (thus decreasing the size of the ajax call, but increasing the client side processing), or return the full html, and replace with .html or .append? Or is there another method I'm missing? This is a frequent situation in my app, and in some cases a bottleneck, and I am unsure if what I am doing is the best solution. Currently, I return the row html and use a single .append call, after emptying all the rows except the header.

  Read the article

• Best way to handle different panels occupying same area

  - by gmnnn

  I have this application: I want to change the marked area when the user is clicked one of the navBarItems (like Microsoft OUTLOOK). I've been doing some research and a lot of people said that I can add several panels and show/hide them when user is clicked a navBarItem. But the area will contain a lot of gridviews and a lot of other controls. I don't know if I want to initialize all of them when application starts because it's gonna be hard on the cpu and memory to keep all the controls running at the same time. And I don't think it's an elegant solution for this kind of situation. But if I choose to initialize controls when user is clicked to corresponding navBarItem, it's gonna be laggy for the user. What is the best design approach for this situation? PS: I can use commercial libraries too. Thank you.

  Read the article

• How do I do pivoting in this query in SQL?

  - by dewacorp.alliances

  Hi there I have this table like this: Name; Amount1, Amount, Rate1, Rate2 Test; 1000; 2000; 1.0; 2.0 I want to display into: Parameter; Amount1; Rate1; Total 'Parameter 1'; 1000; 1.0; 1000 'Parameter 2'; 2000; 2.0; 4000 BTW ... I am using SQL2K5. All I can think of is CURSOR. Any other solution in elegant way? Thanks

  Read the article

• XmlResolver Class' GetEntity function

  - by Pok

  I wrote a custom resolver class. It works OK for resolving SYSTEM DTDs, but not for resolving PUBLIC DTDs. When the class has to resolve PUBLIC DTDs instead of the URI of the resource, the function receives the public identifier through the absoluteUri parameter of the GetEntity function. Is there a solution to this. In examples: if I have a DTD declaration like <!DOCTYPE document SYSTEM "document.dtd"> then the custom resolver correctly receives the string "document.dtd" through the absoluteUri parameter of the GetEntity function. if I have a DTD declaration like <!DOCTYPE document PUBLIC "-//Organization//DTD Document 1.0//EN" "http://localhost/document.dtd"> then the custom resolver incorrectly receives the string "-//Organization//DTD Document 1.0//EN" instead of "scheme://host/document.dtd".

  Read the article

• lookup datasource in context every time, Is it right?

  - by Srikanth Dyapa

  In my application i configured more than one datasource (for diff databases). Whenever user sends a request depends upon user category i need to look up for the respective datasource in the context and get a connection from that datasource to execute queries which are assigned to that user. Is it right way to achieve my requirement? I am using tomcat 6, struts 1.3. The databases may be oracle or mysql or both. Give me an optimized solution. Thanks in advance.

  Read the article

• wanted to get all dates in mysql result

  - by PankajK

  I have mysql table called user(id, name, join_on) join on is a date field what I want is to show in each day how many uses has been created I can use group by but it will only give me the dates when users get added like if date 4/12/10 5 users added 4/13/10 2 users added 4/15/10 7 users added here date 4/14/10 is missing and I want listing of all dates in one month. I have one solution for it by creating another table only for adding date and that table will left join my users table on join_on and will give total result but I don't want to do that as for creating that I need to create and add entries in date table please suggest the different approach for doing so. Thank you.

  Read the article

• AS3/AIR: Managing Run-Time Image Data

  - by grey

  I'm developing a game with AS3 and AIR. I will have a large-ish quantity of images that I need to load for display elements. It would be nice not to embed all of the images that the game needs, thereby avoiding having them all in memory at once. That's okay in smaller projects, but doesn't make sense here. I'm curious about strategies for loading images during run time. Since all of the files are quite small and local ( in my current project ) loading them on request might be the best solution, but I'd like to hear what ideas people have for managing this. For bonus points, I'm also curious about solutions for loading images on-demand server-side as well.

  Read the article

• WMI instrinsic events. Resources

  - by Nickolodeon

  Hi. I subscribe to usb inserted event like this select * FROM __INSTANCECREATIONEVENT WITHIN 3 WHERE TARGETINSTANCE ISA Win32_DiskDrive After inserting usb flash it blinks every 3 seconds. This is polling interval and intrinsic events work by polling object that's in query. Now, we know these types of events may be resource expensive. (Putting value greater then 3 sometimes chokes these events and client program doesn't get notified). Are there other ways to do that, so that usb doesn't get scanned all the time? May be there some extrinsic events available? Right now the only solution I see is to unsubscribe from event above once it trigerred and resubscribe to it in __INSTANCEDELETIONEVENT handler. Hm, althought deletionevent will also poll diskdrive controllers(

  Read the article

• r -- finding difference between business days

  - by acesnap

  I have several years of data (only for business days (no weekends or holidays)) in an [r] data frame and would like to find the difference between the data on the 2nd and 5th business day of each month. So the solution needs to go thru the list, determine the 2nd and 5th business day, get the data for the corresponding dates and then find the difference. the data looks like: 1/19/1990 1.22 1/20/1990 1.25 1/23/1990 1.26 (Gap in date is weekend) ... 2/1/1990 1.34 2/2/1990 1.36 2/5/1990 1.22 (Gap in date is weekend) I have tried using dateTime() but it doesn't handicap for weekends and holidays. Any suggestions would be appreciated, thanks.

  Read the article

• JQuery get element from a string problem

  - by SLC

  Sorry for such a simple question but I can't seem to find the solution. I am trying to fade in and out some divs. Divs have an ID of "div1", "div2", "div3". My code is: var Divs = new Array("div1", "div2", "div3"); I want to fade out one div and then fade in the next on top of it. I have a setinterval that runs every 5 seconds and checked it works. Inside it is this code: $(Divs[1]).fadeOut(1000); $(Divs[2]).fadeIn(1000); However nothing happens when the timer method is ran. Any ideas?

  Read the article

• How to check an exectuable's path is correct in PHP?

  - by nickf

  I'm writing a setup/installer script for my application, basically just a nice front end to the configuration file. One of the configuration variables is the executable path for mysql. After the user has typed it in (for example: /path/to/mysql-5.0/bin/mysql or just mysql if it is in their system PATH), I want to verify that it is correct. My initial reaction would be to try running it with "--version" to see what comes back. However, I quickly realised this would lead to me writing this line of code: shell_exec($somethingAUserHasEntered . " --version"); ...which is obviously a Very Bad Thing. Now, this is a setup script which is designed for trusted users only, and ones which probably already have relatively high level access to the system, but still I don't think the above solution is something I want to write. Is there a better way to verify the executable path? Perhaps one which doesn't expose a massive security hole?

  Read the article

• Is it possible to exclude folders from a web application project in vs 2010?

  - by JL

  I had previously asked this question. At the time I was working with VS 2008. To restate the question. I have a web application that generates 1000's of small xml files in a certain directory. I would like to exclude this directory from the web application project in visual studio 2010. With vs 2008 it was not possible. Has anything changed? Besides the general wait for VS to iterate through this directory and add an item in the solution explorer for each file, it also strains my system resources, so I would like to exclude it from the project, but the dir and files need to physically exist on disk, because they are part of the application. Any OOB VS 2010 solutions, or any good workarounds? Thanks Update: This also sums up the issue nicely http://forums.asp.net/t/1179077.aspx

  Read the article

• Reading from a file into an array in c

  - by NaNa21

  My file contains a series of numbers (integer, float, integer, float ....), each written on a separate line. The numbers of columns are different from one line to another i.e. 1 2.45 3 1.75 5 3.45 7 2.55 9 3.25 6 1.75 4 3.55 6 2.55 9 2.45 The program should read the contents of the entire file and place the data into an array of type float with an entry for each line. Here is my basic solution, but this is only suitable if I have fixed no of columns. float Read(FILE *pFile) { char line[50]; char letter[5]; fi = fopen("file.txt", "r"); while (fgets(line,200,fi)!=NULL) { sscanf(line,"%f %f %f",&a[i], &a2[i],&a3[i]); printf("%2.0f %2.5f %2.0f\n",a[i],a2[i],a3[i]); } fclose(fi); return a[i]; } Please HELP.

  Read the article

• How should I make up for the lack of static initializers in PHP?

  - by kahoon

  I'm thinking about putting every class into a separate file and doing the static initialization outside of the class definition. The problem with this is the fact that the initialization will happen before the said class is actually needed (it will happen when the file which contains the class is included for the first time). It's a problem, because it may happen that the class won't be used at all, hence the initialization is unnecessary. And I think the practice of including the used files not in the beginning of your code is simply a dirty technique. If anybody has a viable solution to this problem, I would greatly appreciate it.

  Read the article

• Does ini_set('session.save_path', 'custom path'); effect the session garbage cleaner?

  - by newbtophp

  Hi! Does ini_set('session.save_path', 'custom path'); effect the session garbage cleaner? As I'm setting a custom directory for the sessions, because I've read from various php security guides, that setting a custom directory on shared hosting for sessions; can improve session security. But the problem is I've read somewhere that PHP does/handles the session garbage cleaning only when the session_save_path is the default and not modified (ie. using a custom directory)? - is this true, if so is their a solution for this?. (take into consideration I'm using shared hosting). Appreciate all help!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

< Previous Page | 732 733 734 735 736 737 738 739 740 741 742 743  | Next Page >