Search Results

Search found 19908 results on 797 pages for 'bit ly'.

Page 744/797 | < Previous Page | 740 741 742 743 744 745 746 747 748 749 750 751  | Next Page >

  • Cannot work for 2nd iteration because of writing delay.

    - by karikari
    My code's IF-THEN does not work for 2nd iteration. This is due to, the jar processing take some time to write it result inside the output.txt. Since the writing is a bit late, my code's 2nd iteration will always read the previous written value inside the output.txt in order to pass it to the IF-THEN. For example, in 1st iteration: output.txt -- 0.9888 twrite.txt -- msg: ok 2nd iteration: output.txt -- 0.5555 twrite.txt -- msg: ok //the IF-THEN still gives this result which is based on previous iteration. it should be msg: not ok . since it is < 0.7 I need help, how to solve this 'delay' problem? HRESULT CButtonDemoBHO::onDocumentComplete(IDispatch *pDisp, VARIANT *vUrl){ ATLTRACE("CButtonDemoBHO::onDocumentComplete %S\n", vUrl->bstrVal); WinHttpClient client(vUrl->bstrVal); client.SendHttpRequest(); wstring httpResponseHeader = client.GetHttpResponseHeader(); wstring httpResponse = client.GetHttpResponse(); writeToLog(httpResponse.c_str()); if (isMainFrame(pDisp)){ m_normalPageLoad=false; FILE *child = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt > c:\\output.txt", "r"); fclose(child); char readnumber[10]; float f = 0; FILE *file11 = fopen("c:\\output.txt","r"); char* p = fgets(readnumber,10,file11); std::istringstream iss(p); iss >> f; if (f > 0.7) { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: ok"; file12.close(); } else { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: not ok"; file12.close(); } iss.clear(); fclose(file11); return S_OK; } return S_OK; }

    Read the article

  • Asp.net web service: Problems accessing without www

    - by MysterM
    I have a Asp.net web service running on www.domain.com/Service.svc that I connect to using jQuery from my asp.net website. Everything works perfect if the user access my website with www.domain.com. But if the user uses only domain.com I get error: There was no channel actively listening at 'http://domain.com/Service.svc/get?date=2010-10-09'. This is often caused by an incorrect address URI. Ensure that the address to which the message is sent matches an address on which a service is listening. In my web.config I use the serviceHostingEnvironment tag to get the service running on my webhost (it doesn't work otherwise). Maybe this is what causes the error? Here is my system.serviceModel in web.config (I had some problems setting up the web service so that's why my web.config might be a bit messy: <system.serviceModel> <behaviors> <endpointBehaviors> <behavior name="ServiceAspNetAjaxBehavior"> <enableWebScript /> </behavior> </endpointBehaviors> <serviceBehaviors> <behavior name="ServiceBehavior"> <serviceDebug includeExceptionDetailInFaults="true" /> </behavior> </serviceBehaviors> </behaviors> <serviceHostingEnvironment aspNetCompatibilityEnabled="true"> <baseAddressPrefixFilters> <add prefix="http://www.domain.com"/> </baseAddressPrefixFilters> </serviceHostingEnvironment> <services> <service behaviorConfiguration="ServiceBehavior" name="Service"> <endpoint address="" behaviorConfiguration="ServiceAspNetAjaxBehavior" binding="webHttpBinding" bindingConfiguration="ServiceBinding" contract="Service" /> </service> </services> <bindings> <webHttpBinding> <binding name="ServiceBinding" maxBufferPoolSize="1000000" maxReceivedMessageSize="1000000"> <readerQuotas maxDepth="1000000" maxStringContentLength="1000000" maxArrayLength="1000000" maxBytesPerRead="1000000" maxNameTableCharCount="1000000" /> </binding> </webHttpBinding> </bindings> </system.serviceModel> How can I make it possible for my users to access my webservice also when using only domain.com?

    Read the article

  • OpenGL Shader Compile Error

    - by Tomas Cokis
    I'm having a bit of a problem with my code for compiling shaders, namely they both register as failed compiles and no log is received. This is the shader compiling code: /* Make the shader */ Uint size; GLchar* file; loadFileRaw(filePath, file, &size); const char * pFile = file; const GLint pSize = size; newCashe.shader = glCreateShader(shaderType); glShaderSource(newCashe.shader, 1, &pFile, &pSize); glCompileShader(newCashe.shader); GLint shaderCompiled; glGetShaderiv(newCashe.shader, GL_COMPILE_STATUS, &shaderCompiled); if(shaderCompiled == GL_FALSE) { ReportFiler->makeReport("ShaderCasher.cpp", "loadShader()", "Shader did not compile", "The shader " + filePath + " failed to compile, reporting the error - " + OpenGLServices::getShaderLog(newCashe.shader)); } And these are the support functions: bool loadFileRaw(string fileName, char* data, Uint* size) { if (fileName != "") { FILE *file = fopen(fileName.c_str(), "rt"); if (file != NULL) { fseek(file, 0, SEEK_END); *size = ftell(file); rewind(file); if (*size > 0) { data = (char*)malloc(sizeof(char) * (*size + 1)); *size = fread(data, sizeof(char), *size, file); data[*size] = '\0'; } fclose(file); } } return data; } string OpenGLServices::getShaderLog(GLuint obj) { int infologLength = 0; int charsWritten = 0; char *infoLog; glGetShaderiv(obj, GL_INFO_LOG_LENGTH,&infologLength); if (infologLength > 0) { infoLog = (char *)malloc(infologLength); glGetShaderInfoLog(obj, infologLength, &charsWritten, infoLog); string log = infoLog; free(infoLog); return log; } return "<Blank Log>"; } and the shaders I'm loading: void main(void) { gl_FragColor = vec4(1.0, 0.0, 0.0, 1.0); } void main(void) { gl_Position = ftransform(); } In short I get From: ShaderCasher.cpp, In: loadShader(), Subject: Shader did not compile Message: The shader Data/Shaders/Standard/standard.vs failed to compile, reporting the error - <Blank Log> for every shader I compile I've tried replacing the file reading with just a hard coded string but I get the same error so there must be something wrong with how I'm compiling them. I have run and compiled example programs with shaders, so I doubt my drivers are the issue, but in any case I'm on a Nvidia 8600m GT. Can anyone help?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • [c++] upload image to imageshack

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • Getting key/value pairs from plist-style xml using simplexml in php

    - by Anthony
    Here is an example bit from the xml file: <array> <dict> <key>Name</key> <string>Joe Smith</string> <key>Type</key> <string>Profile</string> <key>Role</key> <string>User</string> <key>Some Number</key> <integer>1</integer> <key>Some Boolean</key> <true/> </dict> </array> I have two separate goals. The first is to extract an array from the dictnode that would look like: [Name] => Joe Smith [Type] => Profile [Role] => User [Some Number] => 1 [Some Boolean] => true It's not crucial that the boolean be included, so if that adds too much complexity, I'd rather just know how to deal with the others for now. The second goal is to be able to select the value node (<string>, <integer>,etc) so that I can change the value. I would need to select it based on the text value of the preceding key element. I think the following XPath should work: //key[.=$keyname]/following-sibling[1] But I'm not sure. Basically, this whole system that Apple uses seems logical, but totally contrary to the XML is supposed to work. If I ran the world, the original XML would look more like: <dict type="array"> <value key="Name" type="string">Joe Smith</value> <value key="Type" type="string">Profile</value> <value key="Role type="string">User</value> <value key="Some Number" type="integer">1</value> <value key="Some Boolean" type="boolean">true</value> </dict> But since it is fairly logical, I am wondering if I'm missing some obvious way of handling it.

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • Feedback on Optimizing C# NET Code Block

    - by Brett Powell
    I just spent quite a few hours reading up on TCP servers and my desired protocol I was trying to implement, and finally got everything working great. I noticed the code looks like absolute bollocks (is the the correct usage? Im not a brit) and would like some feedback on optimizing it, mostly for reuse and readability. The packet formats are always int, int, int, string, string. try { BinaryReader reader = new BinaryReader(clientStream); int packetsize = reader.ReadInt32(); int requestid = reader.ReadInt32(); int serverdata = reader.ReadInt32(); Console.WriteLine("Packet Size: {0} RequestID: {1} ServerData: {2}", packetsize, requestid, serverdata); List<byte> str = new List<byte>(); byte nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // Password Sent to be Authenticated string string1 = Encoding.UTF8.GetString(str.ToArray()); str.Clear(); nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // NULL string string string2 = Encoding.UTF8.GetString(str.ToArray()); Console.WriteLine("String1: {0} String2: {1}", string1, string2); // Reply to Authentication Request MemoryStream stream = new MemoryStream(); BinaryWriter writer = new BinaryWriter(stream); writer.Write((int)(1)); // Packet Size writer.Write((int)(requestid)); // Mirror RequestID if Authenticated, -1 if Failed byte[] buffer = stream.ToArray(); clientStream.Write(buffer, 0, buffer.Length); clientStream.Flush(); } I am going to be dealing with other packet types as well that are formatted the same (int/int/int/str/str), but different values. I could probably create a packet class, but this is a bit outside my scope of knowledge for how to apply it to this scenario. If it makes any difference, this is the Protocol I am implementing. http://developer.valvesoftware.com/wiki/Source_RCON_Protocol

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

  • Incompatible library creating new project with Aptana

    - by Phil Rice
    I am a ruby and rails newbie, so my abilities to debug this are somewhat limited. I have just added the eclipse plugin which failed, then downloaded the latest aptana studio which also failed. The failure was the same in both cases. The nature of the failure is that when I create a new rails project, I get an error message about an incompatible library version "C:/Ruby193/lib/ruby/gems/1.9.1/gems/mongrel-1.1.5-x86-mswin32-60/lib/http11.so". The project is actually created, along with directories and files. Google searches around this error message have only returned a couple of hits, which were not very helpful I am wondering if this is about 64 bit libraries. My software stack is: Windows 7 home premium 64bit Aptana RadRails, build: 2.0.5.1278709071 Ruby1.9.3 gem 1.8.24 The console shows: "4320" C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:36:in `require': iconv will be deprecated in the future, use String#encode instead. C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:36:in `require': incompatible library version - C:/Ruby193/lib/ruby/gems/1.9.1/gems/mongrel-1.1.5-x86-mswin32-60/lib/http11.so (LoadError) from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:36:in `require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:156:in `block in require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:521:in `new_constants_in' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:156:in `require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/mongrel-1.1.5-x86-mswin32-60/lib/mongrel.rb:12:in `<top (required)>' from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:60:in `require' from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:60:in `rescue in require' from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:35:in `require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:156:in `block in require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:521:in `new_constants_in' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/activesupport-2.3.4/lib/active_support/dependencies.rb:156:in `require' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rack-1.0.0/lib/rack/handler/mongrel.rb:1:in `<top (required)>' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rack-1.0.0/lib/rack/handler.rb:17:in `const_get' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rack-1.0.0/lib/rack/handler.rb:17:in `block in get' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rack-1.0.0/lib/rack/handler.rb:17:in `each' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rack-1.0.0/lib/rack/handler.rb:17:in `get' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/rails-2.3.4/lib/commands/server.rb:45:in `<top (required)>' from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:36:in `require' from C:/Ruby193/lib/ruby/site_ruby/1.9.1/rubygems/custom_require.rb:36:in `require' from script/server:3:in `<top (required)>' from -e:2:in `load' from -e:2:in `<main>'

    Read the article

  • Rails populate edit form for non-column attributes

    - by Rabbott
    I have the following form: <% form_for(@account, :url => admin_accounts_path) do |f| %> <%= f.error_messages %> <%= render :partial => 'form', :locals => {:f => f} %> <h2>Account Details</h2> <% f.fields_for :customer do |customer_fields| %> <p> <%= customer_fields.label :company %><br /> <%= customer_fields.text_field :company %> </p> <p> <%= customer_fields.label :first_name %><br /> <%= customer_fields.text_field :first_name %> </p> <p> <%= customer_fields.label :last_name %><br /> <%= customer_fields.text_field :last_name %> </p> <p> <%= customer_fields.label :phone %><br /> <%= customer_fields.text_field :phone %> </p> <% end %> <p> <%= f.submit 'Create' %> </p> <% end %> As well as attr_accessor :customer And I have a before_create method for the account model which does not store the customer_fields, but instead uses them to submit data to an API.. The only thing I store are in the form partial.. The problem I'm running into is that when a validation error gets thrown, the page renders the new action (expected) but none of the non-column attributes within the Account Detail form will show? Any ideas as to how I can change this code around a bit to make this work me?? This same solution may be the help I need for the edit form, I have a getter for the data which it asks the API for, but without place a :value = "asdf" within each text box, it doesn't populate the fields either..

    Read the article

  • Dynamically find other hosts in a LAN in Java

    - by Federico Cristina
    A while ago I developed a little LAN chat app. in Java which allows chatting with other hosts, send images, etc. Although it was created just for fun, now it's being used where I work. Currently, there is no "chat server" on the app. where each client registers, updates it's status, etc. (I liked the idea of symmetric design and not depending on a server running on some other machine). Instead, each host is a client/server which has a hosts.properties file with the hostname of the other hosts, and - for instance - broadcasts to each one of them when sending a massive message/image/whatever. In the beginning there were just a couple of hosts, so this hosts.properties file wasn't an issue. But as the amount of users increased, the need of updating that file was a bit daunting. So now I've decided to get rid of it, and each time the app. starts, dynammically find the other active hosts. However, I cannot find the correct way of implement this. I've tried starting different threads, each one of them searching for other hosts in a known range of IP addresses. Something like this (simplified for the sake of readability): /** HostsLocator */ public static void searchForHosts(boolean waitToEnd) { for (int i=0; i < MAX_IP; i+= MAX_IP / threads) { HostsLocator detector = new HostsLocator(i, i+(MAX_IP / threads - 1)); // range: from - to new Thread(detector).start(); } } public void run() { for (int i=from; i<=to; i++) findHosts( maskAddress + Integer.toString(i) ); } public static boolean findHosts(String IP) { InetAddress address = InetAddress.getByName(IP); if ( address.isReachable(CONNECTION_TIME_OUT) ) // host found! } However: With a single thread and a low value in CONNECTION_TIME_OUT (500ms) I get wrong Host Not Found status for for hosts actually active. With a high value in CONNECTION_TIME_OUT (5000ms) and only one single thread takes forever to end With several threads I've also found problems similar like the first one, due to collisions. So... I guess there's a better way of solving this problem but I couldn't find it. Any advice? Thanks!

    Read the article

  • Linux configurations that would affect Java memory usage?

    - by wmacura
    Hi, Background: I have a set of java background workers I start as part of my webapp. I develop locally on Ubuntu 10.10 and deploy to an Ubuntu 10.04LTS server (a media temple (ve) instance). They're both running the same JVM: Sun JVM 1.6.0_22-b04. As part of the initialization script each worker is started with explicit Xmx, Xms, and XX:MaxPermGen settings. Yet somehow locally all 10 workers use 250MB, while on the server they use more than 2.7GB. I don't know how to begin to track this down. I thought the Ubuntu (and thus, kernel) version might make a difference, but I tried an old 10.04 VM and it behaves as expected. I've noticed that the machine does not seem to ever use memory for buffer or cache (according to htop), which seems a bit strange, but perhaps normal for a server? (edited) Some info: (server) root@devel:/app/axir/target# uname -a Linux devel 2.6.18-028stab069.5 #1 SMP Tue May 18 17:26:16 MSD 2010 x86_64 GNU/Linux (local) wiktor@beastie:~$ uname -a Linux beastie 2.6.35-25-generic #44-Ubuntu SMP Fri Jan 21 17:40:44 UTC 2011 x86_64 GNU/Linux (edited) Comparing PS output: (ps -eo "ppid,pid,cmd,rss,sz,vsz") PPID PID CMD RSS SZ VSZ (local) 1588 1615 java -cp axir-distribution. 25484 234382 937528 1615 1631 java -cp /home/wiktor/Code/ 83472 163059 652236 1615 1657 java -cp /home/wiktor/Code/ 70624 89135 356540 1615 1658 java -cp /home/wiktor/Code/ 37652 77625 310500 1615 1669 java -cp /home/wiktor/Code/ 38096 77733 310932 1615 1675 java -cp /home/wiktor/Code/ 37420 61395 245580 1615 1684 java -cp /home/wiktor/Code/ 38000 77736 310944 1615 1703 java -cp /home/wiktor/Code/ 39180 78060 312240 1615 1712 java -cp /home/wiktor/Code/ 38488 93882 375528 1615 1719 java -cp /home/wiktor/Code/ 38312 77874 311496 1615 1726 java -cp /home/wiktor/Code/ 38656 77958 311832 1615 1727 java -cp /home/wiktor/Code/ 78016 89429 357716 (server) 22522 23560 java -cp axir-distribution. 24860 285196 1140784 23560 23585 java -cp /app/axir/target/a 100764 161629 646516 23560 23667 java -cp /app/axir/target/a 72408 92682 370728 23560 23670 java -cp /app/axir/target/a 39948 97671 390684 23560 23674 java -cp /app/axir/target/a 40140 81586 326344 23560 23739 java -cp /app/axir/target/a 39688 81542 326168 They look very similar. In fact, the question now is why, if I add up the virtual memory usage on the server (3.2GB) does it more closely reflect 2.4GB of memory used (according to free), yet locally the virtual memory used adds up to a much more substantial 4.7GB but only actually uses ~250MB. It seems that perhaps memory isn't being shared as aggressively. (if that's even possible) Thank you for your help, Wiktor

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • Wordpress installed in root folder, subdomain now not working, GoDaddy host

    - by Kristin
    Hi, please forgive me for being a complete beginner at this, I'd rather not have to try to deal with this myself but as GoDaddy support have not replied after 2 days I'm going to have to. I think my problem is the same as the one above, but I'm not 100% sure, so I'm reposting it, I'm not really confident enough to attempt to try the fixes I've seen here so I need someone to give me baby instructions? Our original website (www.mwpics.com.au) was built in Dreamweaver etc, recently we created a new website in Wordpress, in a subdomain, then migrated it over to the root folder where it is now operating fine. I also moved the files for the old website into another directory which I called 'old', so they're all still there. The problem is that I have a subdomain set up - which is still showing as set up in the control panel on godaddy the url is www.mwpics.com.au/clients and it is at www.clients.mwpics.com.au. This directory contains loads of other directories, each of which is password protected by .htaccess files and which our clients access directly (not through the site) to download their finished work. The test one and the one for random clients is www.mwpics.com.au/clients/temp - username and password both temp (the usernames are all the same as the directory names). Since the WP install to the root directory the /clients extension no longer works (it should bring up an information page which is an .html index page in the directory) and the /clients/name extensions no longer works - it goes back to the wp site with a 'not found' error message. Strangely it does bring up the box for the username and password, but when you enter it it just goes back to the 'not found' message. Someone told me it was the .htaccess file - so as an experiment, I renamed the .htaccess file in the root directory and then copied the .htaccess file from the old root files into the root directory, eureka! It worked - and also the WP site opened to the home page... but bummer - the /pages in the WP site now no longer worked! But at least I know the source of the problem. So I switched it back and this is the status quo - I have no idea how to fix this, and with everyone back at work tomorrow, clients are going to want to start downloading their stuff... Can anyone help me? I'm starting to panic a bit

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • Why do sockets not die when server dies? Why does a socket die when server is alive?

    - by Roman
    I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

    Read the article

  • How to position some text?

    - by Faery
    Sorry for the noobie and stupid question, but I know only a bit about css and I don't know how to style my site. Here is my code: HTML (Twig) : <div class="wrap"> <div> <img class="birthday" src="http://www.clker.com/cliparts/1/d/a/6/11970917161615154558carlitos_Balloons.svg.med.png"> <div class="try"> This friends have brithday today: {% for bd in birthdays %} <p> <a href="{{ path('friend_id', {'id': bd.id}) }}">{{ bd.name }}</a> <span class="years"> ({{ bd.years }} years) </span> </p> {% endfor %} </div> </div> </div> CSS: body { background-color: #FFFFF1; text-align: center; font-size: 17px; font-family: Tahoma, Geneva, sans-serif; } p { margin: 10px; } a { text-decoration: none; color: #6a9211; } a:hover { text-decoration: underline; } .wrap { width: 700px; margin: auto; } .birthday { width: 49px; height: 80px; float: left; margin-left: 150px; display: block; } .try { display: block; margin-right: 150px; margin-bottom: 50px; } .years { font-size: 12px; } And this is what I get. The thing I want to fix is Maria and Peter to be display under Anna and John, all of them 4 centered under the label This friends have birthday today:. I know that it's because of the image, but I don't know how to make it look fine. :( Please help! Thanks in advance!

    Read the article

  • jQuery Form plugin - no data from file upload?

    - by pojo
    I've been struggling a bit with the jQuery Form plugin. I want to create a file upload form that posts the data (JSON, from the chosen file) into a REST service exposed by a servlet. The URL for the POST is calculated from what the user chooses in a SELECT dropdown. When the upload is complete, I want to notify the user immediately, AJAX-style. The problem is that the POST header has a Content-Length of 0 and contains no data. I would appreciate any help! <html> <head> <script type="text/javascript" src="js/jquery-1.4.2.min.js">/* ppp */</script> <script type="text/javascript" src="js/jquery.form.js">/* ppp */</script> <script type="text/javascript"> function cb_beforesubmit (arr, $form, options) { // This should override the form's action attribute options.url = "/rest/services/" + $('#selectedaction')[0].value; return true; } function cb_success (rt, st, xhr, wf) { $('#response').html(rt + '<br>' + st + '<br>' + xhr); } $(document).ready(function () { var options = { beforeSubmit: cb_beforesubmit, success: cb_success, dataType: 'json', contentType: 'application/json', method: 'POST', }; $('#myform').ajaxForm(options); $.getJSON('/rest/services', function (data, ts) { for (var property in data) { if (typeof property == 'string') { $('#selectedaction').append('<option>' + property + '</option>'); } } }); }); </script> </head> <body> <form id="myform" action="/rest/services/foo1" method="POST" enctype="multipart/form-data"> <!-- The form does not seem to submit at all if I don't set action to a default value? !--> <select id="selectedaction"> <script type="text/javascript"> </script> </select> <input type="file" value="Choose"/> <input type="submit" value="Submit" /> </form> <div id="response"> </div> </body> </html>

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • Android - exception from an AsynchTask call

    - by GeekedOut
    I have an Activity that makes a remote server call and tries to populate a list. The call to the server works fine, and the call returns some JSON which is good. But then the system throws this exception: 04-06 18:43:19.626: D/AndroidRuntime(2564): Shutting down VM 04-06 18:43:19.626: W/dalvikvm(2564): threadid=1: thread exiting with uncaught exception (group=0x409c01f8) 04-06 18:43:19.686: E/AndroidRuntime(2564): FATAL EXCEPTION: main 04-06 18:43:19.686: E/AndroidRuntime(2564): java.lang.NullPointerException 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.createViewFromResource(ArrayAdapter.java:394) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.getView(ArrayAdapter.java:362) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.AbsListView.obtainView(AbsListView.java:2033) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.measureHeightOfChildren(ListView.java:1244) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.onMeasure(ListView.java:1155) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureChildBeforeLayout(LinearLayout.java:1369) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:660) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:812) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.policy.impl.PhoneWindow$DecorView.onMeasure(PhoneWindow.java:2092) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.performTraversals(ViewRootImpl.java:1064) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.handleMessage(ViewRootImpl.java:2442) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Handler.dispatchMessage(Handler.java:99) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Looper.loop(Looper.java:137) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.app.ActivityThread.main(ActivityThread.java:4424) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invokeNative(Native Method) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invoke(Method.java:511) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 04-06 18:43:19.686: E/AndroidRuntime(2564): at dalvik.system.NativeStart.main(Native Method) Why would this happen? It doesn't point to any of my code so its a bit strange. the protected void onPostExecute(String result) never gets called on the callback. Thanks!

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

< Previous Page | 740 741 742 743 744 745 746 747 748 749 750 751  | Next Page >