Search Results

Search found 36719 results on 1469 pages for 'value chain'.

Page 751/1469 | < Previous Page | 747 748 749 750 751 752 753 754 755 756 757 758  | Next Page >

  • How to write a simple Lexer/Parser with antlr 2.7?

    - by Burkhard
    Hello, I have a complex grammar (in antlr 2.7) which I need to extend. Having never used antlr before, I wanted to write a very simple Lexer and Parser first. I found a very good explanation for antlr3 and tried to adapt it: header{ #include <iostream> using namespace std; } options { language="Cpp"; } class P2 extends Parser; /* This will be the entry point of our parser. */ eval : additionExp ; /* Addition and subtraction have the lowest precedence. */ additionExp : multiplyExp ( "+" multiplyExp | "-" multiplyExp )* ; /* Multiplication and addition have a higher precedence. */ multiplyExp : atomExp ( "*" atomExp | "/" atomExp )* ; /* An expression atom is the smallest part of an expression: a number. Or when we encounter parenthesis, we're making a recursive call back to the rule 'additionExp'. As you can see, an 'atomExp' has the highest precedence. */ atomExp : Number | "(" additionExp ")" ; /* A number: can be an integer value, or a decimal value */ number : ("0".."9")+ ("." ("0".."9")+)? ; /* We're going to ignore all white space characters */ protected ws : (" " | "\t" | "\r" | "\n") { newline(); } ; It does generate four files without errors: P2.cpp, P2.hpp, P2TokenTypes.hpp and P2TokenTypes.txt. But now what? How do I create a working programm with that? I tried to add these files to a VS2005-WinConsole-Project but it does not compile: p2.cpp(277) : fatal error C1010: unexpected end of file while looking for precompiled header. Did you forget to add '#include "stdafx.h"' to your source?

    Read the article

  • I'm trying to make a php Curl call to formstack api, but I get nothing

    - by Oskar Calvo
    This is one of my first curls code, so it can have mistakes I'm trying to be able to make calls to form/:id/submissions https://www.formstack.com/developers/api/resources/submission#form/:id/submission_GET If I load: https://www.formstack.com/api/v2/form/1311091/submission.json?oauth_token=44eedc50d015b95164897f5e408670f0&min_time=2012-09-01%2000:01:01&max_time=2012-10-27%2000:01:01 If works great. If I try this code: <?php $host = 'https://www.formstack.com/api/v2/'; // TODO this should manage dinamics values or build an action in every method. $action = 'form/1311091/submission.json'; $url = $host . $action; // TODO this values will arrive like an array with values $postData['oauth_token']= '44eedc50d015b95164897f5e408670f0'; $postData['min_time'] ='2012-09-01 00:01:01'; $postData['max_time'] ='2012-10-27 00:01:01'; // TODO make a method with this action function getElements($postData) { $elements = array(); foreach ($postData as $name=>$value) { $elements[] = "{$name}=".urlencode($value); } } $curl = curl_init(); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_HTTPGET, true); curl_setopt($curl, CURLOPT_POSTFIELDS, $elements); $result = curl_exec($curl) ; curl_close($curl); var_dump($result); ?>

    Read the article

  • Call to a member function get_segment() error

    - by hogofwar
    I'm having this problem with this piece of PHP code: class Core { public function start() { require("funk/funks/libraries/uri.php"); $this->uri = new uri(); require("funk/core/loader.php"); $this->load = new loader(); if($this->uri->get_segment(1) != "" and file_exists("funk/pages/".$uri->get_segment(1).".php")){ Only a snippet of the code The best way I can explain it is that it is a class calling upon another class (uri.php) and i am getting the error: Fatal error: Call to a member function get_segment() on a non-object in /home/eeeee/public_html/private/funkyphp/funk/core/core.php on line 11 (the if($this-uri-get_segment(1) part) I'm having this problem a lot and it is really bugging me. the library code is: <?php class uri { private $server_path_info = ''; private $segment = array(); private $segments = 0; public function __construct() { $segment_temp = array(); $this->server_path_info = preg_replace("/\?/", "", $_SERVER["PATH_INFO"]); $segment_temp = explode("/", $this->server_path_info); foreach ($segment_temp as $key => $seg) { if (!preg_match("/([a-zA-Z0-9\.\_\-]+)/", $seg) || empty($seg)) unset($segment_temp[$key]); } foreach ($segment_temp as $k => $value) { $this->segment[] = $value; } unset($segment_temp); $this->segments = count($this->segment); } public function segment_exists($id = 0) { $id = (int)$id; if (isset($this->segment[$id])) return true; else return false; } public function get_segment($id = 0) { $id--; $id = (int)$id; if ($this->segment_exists($id) === true) return $this->segment[$id]; else return false; } } ?>

    Read the article

  • no instance of overloaded function getline c++

    - by Dave
    I'm a bit confused as to what i have incorrect with my script that is causing this error. I have a function which calls a fill for game settings but it doesn't like my getline. Also i should mention these are the files i have included for it: #include <fstream> #include <cctype> #include <map> #include <iostream> #include <string> #include <algorithm> #include <vector> using namespace std;' This is what i have: std::map<string, string> loadSettings(std::string file){ ifstream file(file); string line; std::map<string, string> config; while(std::getline(file, line)) { int pos = line.find('='); if(pos != string::npos) { string key = line.substr(0, pos); string value = line.substr(pos + 1); config[trim(key)] = trim(value); } } return (config); } The function is called like this from my main.cpp //load settings for game std::map<string, string> config = loadSettings("settings.txt"); //load theme for game std::map<string, string> theme = loadSettings("theme.txt"); Where did i go wrong ? Please help! The error: settings.h(61): error C2784: 'std::basic_istream<_Elem,_Traits> &std::getline(std::basic_istream<_Elem,_Traits> &&,std::basic_string<_Elem,_Traits,_Alloc> &)' : could not deduce template argument for 'std::basic_istream<_Elem,_Traits> &&' from 'std::string'

    Read the article

  • how to handle empty selection in a jface bound combobox?

    - by guido
    I am developing a search dialog in my eclipse-rcp application. In the search dialog I have a combobox as follows: comboImp = new CCombo(grpColSpet, SWT.BORDER | SWT.READ_ONLY); comboImp.setBounds(556, 46, 184, 27); comboImpViewer = new ComboViewer(comboImp); comboImpViewer.setContentProvider(new ArrayContentProvider()); comboImpViewer.setInput(ImpContentProvider.getInstance().getImps()); comboImpViewer.setLabelProvider(new LabelProvider() { @Override public String getText(Object element) { return ((Imp)element).getImpName(); } }); Imp is a database entity, ManyToOne to the main entity which is searched, and ImpContentProvider is the model class which speaks to embedded sqlite database via jpa/hibernate. This combobox is supposed to contain all instances of Imp, but to also let empty selection; it's value is bound to a service bean as follows: IObservableValue comboImpSelectionObserveWidget = ViewersObservables.observeSingleSelection(comboImpViewer); IObservableValue filterByImpObserveValue = BeansObservables.observeValue(searchPrep, "imp"); bindingContext.bindValue(comboImpSelectionObserveWidget, filterByImpObserveValue , null, null); As soon as the user clicks on the combo, a selection (first element) is made: I can see the call to a selectionlistener i added on the viewer. My question is: after a selection has been made, how do I let the user change his mind and have an empty selection in the combobox? should I add a "fake" empty instance of Imp to the List returned by the ImpContentProvider? or should I implement an alternative to ArrayContentProvider? and one additional related question is: why calling deselectAll() and clearSelection() on the combo does NOT set a null value to the bound bean?

    Read the article

  • Greasemonkey failing to GM_setValue()

    - by HonoredMule
    I have a Greasemonkey script that uses a Javascript object to maintain some stored objects. It covers quite a large volume of information, but substantially less than it successfully stored and retrieved prior to encountering my problem. One value refuses to save, and I can not for the life of me determine why. The following problem code: Works for other larger objects being maintained. Is presently handling a smaller total amount of data than previously worked. Is not colliding with any function or other object definitions. Can (optionally) successfully save the problem storage key as "{}" during code startup. this.save = function(table) { var tables = this.tables; if(table) tables = [table]; for(i in tables) { logger.log(this[tables[i]]); logger.log(JSON.stringify(this[tables[i]])); GM_setValue(tables[i] + "_" + this.user, JSON.stringify(this[tables[i]])); logger.log(tables[i] + "_" + this.user + " updated"); logger.log(GM_getValue(tables[i] + "_" + this.user)); } } The problem is consistently reproducible and the logging statments produce the following output in Firebug: Object { 54,10 = Object } // Expansion shows complete contents as expected, but there is one oddity--Firebug highlights the array keys in purple instead of the usual black for anonymous objects. {"54,10":{"x":54,"y":10,"name":"Lucky Pheasant"}} // The correctly parsed string. bookmarks_HonoredMule saved undefined I have tried altering the format of the object keys, to no effect. Further narrowing down the issue is that this particular value is successfully saved as an empty object ("{}") during code initialization, but skipping that also does not help. Reloading the page confirms that saving of the nonempty object truly failed. Any idea what could cause this behavior? I've thoroughly explored the possibility of hitting size constraints, but it doesn't appear that can be the problem--as previously mentioned, I've already reduced storage usage. Other larger objects save still, and the total number of objects, which was not high already, has further been reduced by an amount greater than the quantity of data I'm attempting to store here.

    Read the article

  • im i doing this right or wrong using pointers in C

    - by Amandeep Singh Dhari
    i like to point out that i need some help with my home work, ok the lectuer gave us the idea of a program and we have to make it from bottom to top. got to have user to type in two set of string. pointers take in the value and then puts into a prototype i need to make a 3rd pointer that has the value of p1 and p2. like this p1 = asd, p2 = qwe and p3 = asdqwe #include "stdafx.h" #include <ctype.h> char *mystrcat(char*s1p, char*s2p); // Prototype char main(void) { char string1[80]; char string2[80]; printf("%s", "enter in your srting one "); gets_s(string1); printf("%s", "enter in your srting two "); gets_s(string2); *mystrcat(string1, string2); return 0; } char *mystrcat(char *s1p,char *s2p) { //char *string3; //char *string4; //string3 = s1p; //string4 = s2p; printf("whatever = %s%s\n", s1p, s2p); return 0; } this is the code that i made so far just need some help, thank guys in advance.

    Read the article

  • Image jQuery scroller in a container. (like facebook cropper) can't get values of position.

    - by Stefan
    Hey all. Having a reallllll mind pain. I have a php image uploader which is all good and sotring the file and the jquery ajax is returning the image in an ammended html div with a div set up like this: #crop-holder { width:80px; height:80px; margin:10px 10px 20px 10px; border:1px #c0c0c0 solid; overflow:hidden; cursor:move; } The image is viewing fine and I am using the jquery scrollview plugin: http://code.google.com/p/jquery-scrollview/ I have tried adding a few lines to the plugin to store variables of scrollTop and Left and then replacing two hidden input values with x and y in my page. And then on the returned ajax html in the div I am trying to on a button click (for example) retrieve the values of the two hidden inputs.... Heres what i added to the plugin (i'm no js expert!): .mouseout(function(){ var _m = this.m; var lasty = _m.scrollTop(); getElementById("ycord").value = lasty; var lastx = _m.scrollLeft(); getElementById("xcord").value = lastx; self.stopgrab(); }) Still no luck!! How can I get the scrollTop and scrollLeft and successfully prepare them for sending onto another php script!? Thanks:) stefpretty

    Read the article

  • SQL Binary Microsoft Access - Combining two tables if specific field values are equal

    - by Jordan
    I am new to Microsoft Access and SQL but have a decent programming background and I believe this problem should be relatively simple. I have two tables that I have imported into Access. I will give you a little context. One table is huge and contains generic, global data. The other table is still big but contains specific, regional data. There is only one common field (or column) between the two tables. Let’s call this common field CF. The other fields in both tables are different. I’ll take you through one iteration of what I need to do. I need to take each CF value in the regional, smaller table and find the common CF value in the larger, global table. After finding the match, I need to take the whole “record” or “row” from the global data and copy it over to the corresponding record in the smaller regional table (This should involve creating the new fields). I need to do this for all CF values in the regional, smaller table. I was recommended to use SQL and a binary search, but I am unfamiliar. Let me know if you have any questions. I appreciate the help!

    Read the article

  • How do I get 2-way data binding to work for nested asp.net Repeater controls

    - by jimblanchard
    I have the following (trimmed) markup: <asp:Repeater ID="CostCategoryRepeater" runat="server"> <ItemTemplate> <div class="costCategory"> <asp:Repeater ID="CostRepeater" runat="server" DataSource='<%# Eval("Costs")%>'> <ItemTemplate> <tr class="oddCostRows"> <td class="costItemTextRight"><span><%# Eval("Variance", "{0:c0}")%></span></td> <td class="costItemTextRight"><input id="SupplementAmount" class="costEntryRight" type="text" value='<%# Bind("SupplementAmount")%>' runat="server" /></td> </tr> </ItemTemplate> </asp:Repeater> </div> </ItemTemplate> </asp:Repeater> The outer repeater's DataSource is set in the code-beside. I've snipped them, but there are Eval statements that wire up to the properties in the outer Repeater. Anyway, one of the fields in the inner Repeater needs to be a Bind instead of an Eval, as I want to get the values that the user types in. The SupplementAmount input element correctly receives it's value when the page loads, but on the other side, when I inspect the contents of the Costs List when the form posts back, the changes the user made aren't present. Thanks.

    Read the article

  • Help Optimizing MySQL Table (~ 500,000 records) and PHP Code.

    - by Pyrite
    I have a MySQL table that collects player data from various game servers (Urban Terror). The bot that collects the data runs 24/7, and currently the table is up to about 475,000+ records. Because of this, querying this table from PHP has become quite slow. I wonder what I can do on the database side of things to make it as optomized as possible, then I can focus on the application to query the database. The table is as follows: CREATE TABLE IF NOT EXISTS `people` ( `id` bigint(20) unsigned NOT NULL AUTO_INCREMENT, `name` varchar(40) NOT NULL, `ip` int(4) unsigned NOT NULL, `guid` varchar(32) NOT NULL, `server` int(4) unsigned NOT NULL, `date` int(11) NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `Person` (`name`,`ip`,`guid`), KEY `server` (`server`), KEY `date` (`date`), KEY `PlayerName` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 COMMENT='People that Play on Servers' AUTO_INCREMENT=475843 ; I'm storying the IPv4 (ip and server) as 4 byte integers, and using the MySQL functions NTOA(), etc to encode and decode, I heard that this way is faster, rather than varchar(15). The guid is a md5sum, 32 char hex. Date is stored as unix timestamp. I have a unique key on name, ip and guid, as to avoid duplicates of the same player. Do I have my keys setup right? Is the way I'm storing data efficient? Here is the code to query this table. You search for a name, ip, or guid, and it grabs the results of the query and cross references other records that match the name, ip, or guid from the results of the first query, and does it for each field. This is kind of hard to explain. But basically, if I search for one player by name, I'll see every other name he has used, every IP he has used and every GUID he has used. <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> Search: <input type="text" name="query" id="query" /><input type="submit" name="btnSubmit" value="Submit" /> </form> <?php if (!empty($_POST['query'])) { ?> <table cellspacing="1" id="1up_people" class="tablesorter" width="300"> <thead> <tr> <th>ID</th> <th>Player Name</th> <th>Player IP</th> <th>Player GUID</th> <th>Server</th> <th>Date</th> </tr> </thead> <tbody> <?php function super_unique($array) { $result = array_map("unserialize", array_unique(array_map("serialize", $array))); foreach ($result as $key => $value) { if ( is_array($value) ) { $result[$key] = super_unique($value); } } return $result; } if (!empty($_POST['query'])) { $query = trim($_POST['query']); $count = 0; $people = array(); $link = mysql_connect('localhost', 'mysqluser', 'yea right!'); if (!$link) { die('Could not connect: ' . mysql_error()); } mysql_select_db("1up"); $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name LIKE \"%$query%\" OR INET_NTOA(ip) LIKE \"%$query%\" OR guid LIKE \"%$query%\")"; $result = mysql_query($sql, $link); if (!$result) { die(mysql_error()); } // Now take the initial results and parse each column into its own array while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } // now for each name, ip, guid in results, find additonal records $people2 = array(); foreach ($people AS $person) { $ip = $person['ip']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (ip = \"$ip\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people2[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people3 = array(); foreach ($people AS $person) { $guid = $person['guid']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (guid = \"$guid\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people3[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people4 = array(); foreach ($people AS $person) { $name = $person['name']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name = \"$name\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people4[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } // Combine people and people2 into just people $people = array_merge($people, $people2); $people = array_merge($people, $people3); $people = array_merge($people, $people4); $people = super_unique($people); foreach ($people AS $person) { $date = ($person['date']) ? date("M d, Y", $person['date']) : 'Before 8/1/10'; echo "<tr>\n"; echo "<td>".$person['id']."</td>"; echo "<td>".$person['name']."</td>"; echo "<td>".$person['ip']."</td>"; echo "<td>".$person['guid']."</td>"; echo "<td>".$person['server']."</td>"; echo "<td>".$date."</td>"; echo "</tr>\n"; $count++; } // Find Total Records //$result = mysql_query("SELECT id FROM 1up_people", $link); //$total = mysql_num_rows($result); mysql_close($link); } ?> </tbody> </table> <p> <?php echo $count." Records Found for \"".$_POST['query']."\" out of $total"; ?> </p> <?php } $time_stop = microtime(true); print("Done (ran for ".round($time_stop-$time_start)." seconds)."); ?> Any help at all is appreciated! Thank you.

    Read the article

  • Deleting elements from stl set while iterating through it does not invalidate the iterators.

    - by pedromanoel
    I need to go through a set and remove elements that meet a predefined criteria. This is the test code I wrote: #include <set> #include <algorithm> void printElement(int value) { std::cout << value << " "; } int main() { int initNum[] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 }; std::set<int> numbers(initNum, initNum + 10); // print '0 1 2 3 4 5 6 7 8 9' std::for_each(numbers.begin(), numbers.end(), printElement); std::set<int>::iterator it = numbers.begin(); // iterate through the set and erase all even numbers for (; it != numbers.end(); ++it) { int n = *it; if (n % 2 == 0) { // wouldn't invalidate the iterator? numbers.erase(it); } } // print '1 3 5 7 9' std::for_each(numbers.begin(), numbers.end(), printElement); return 0; } At first, I thought that erasing an element from the set while iterating through it would invalidate the iterator, and the increment at the for loop would have undefined behavior. Even though, I executed this test code and all went well, and I can't explain why. My question: Is this the defined behavior for std sets or is this implementation specific? I am using gcc 4.3.3 on ubuntu 10.04 (32-bit version), by the way. Thanks!

    Read the article

  • How to query multiple tables with multiple selects MySQL

    - by brybam
    I'm trying to write a php function that gets all the basic food data(this part works fine in my code) Then grabs all the ingredients related to the ids of the selected items from the query before. Anyone have have any idea why my second array keeps coming back as false? I should be getting 1 array with the list of foods (this works) Then, the second one should be an array with all the ingredients for all the foods that were previously selected...then in my code im planning to work with the array and sort them with the proper foods based on the ids. function getFood($start, $limit) { $one = mysql_query("SELECT a.id, a.name, a.type, AVG(b.r) AS fra, COUNT(b.id) as tvotes FROM `foods` a LEFT JOIN `foods_ratings` b ON a.id = b.id GROUP BY a.id ORDER BY fra DESC, tvotes DESC LIMIT $start, $limit;"); $row = mysql_fetch_array($one); $qry = ""; foreach ($row as &$value) { $fid = $value['id']; $qry = $qry . "SELECT ing, amount FROM foods_ing WHERE fid='$fid';"; } $two = mysql_query($qry); return array ($one, $two); }

    Read the article

  • Querying the size of a drive on a remote server is giving me an error

    - by Testifier
    Here's what I have: public static bool DriveHasLessThanTenPercentFreeSpace(string server) { long driveSize = 0; long freeSpace = 0; var oConn = new ConnectionOptions {Username = "username", Password = Settings.Default.SQLServerAdminPassword}; var scope = new ManagementScope("\\\\" + server + "\\root\\CIMV2", oConn); //connect to the scope scope.Connect(); //construct the query var query = new ObjectQuery("SELECT FreeSpace FROM Win32_LogicalDisk where DeviceID = 'D:'"); //this class retrieves the collection of objects returned by the query var searcher = new ManagementObjectSearcher(scope, query); //this is similar to using a data adapter to fill a data set - use an instance of the ManagementObjectSearcher to get the collection from the query and store it ManagementObjectCollection queryCollection = searcher.Get(); //iterate through the object collection and get what you're looking for - in my case I want the FreeSpace of the D drive foreach (ManagementObject m in queryCollection) { //the FreeSpace value is in bytes freeSpace = Convert.ToInt64(m["FreeSpace"]); //error happens here! driveSize = Convert.ToInt64(m["Size"]); } long percentFree = ((freeSpace / driveSize) * 100); if (percentFree < 10) { return true; } return false; } This line of code is giving me an error: driveSize = Convert.ToInt64(m["Size"]); The error says: ManagementException was unhandled by user code Not found I'm assuming the query to get the drive size is wrong. Please note that I AM getting the freeSpace value at the line: freeSpace = Convert.ToInt64(m["FreeSpace"]); So I know the query IS working for freeSpace. Can anyone give me a hand?

    Read the article

  • Call Oracle package function using Odbc from C#

    - by Paolo Tedesco
    I have a function defined inside an Oracle package: CREATE OR REPLACE PACKAGE BODY TESTUSER.TESTPKG as FUNCTION testfunc(n IN NUMBER) RETURN NUMBER as begin return n + 1; end testfunc; end testpkg; / How can I call it from C# using Odbc? I tried the following: using System; using System.Data; using System.Data.Odbc; class Program { static void Main(string[] args) { using (OdbcConnection connection = new OdbcConnection("DSN=testdb;UID=testuser;PWD=testpwd")) { connection.Open(); OdbcCommand command = new OdbcCommand("TESTUSER.TESTPKG.testfunc", connection); command.CommandType = System.Data.CommandType.StoredProcedure; command.Parameters.Add("ret", OdbcType.Int).Direction = ParameterDirection.ReturnValue; command.Parameters.Add("n", OdbcType.Int).Direction = ParameterDirection.Input; command.Parameters["n"].Value = 42; command.ExecuteNonQuery(); Console.WriteLine(command.Parameters["ret"].Value); } } } But I get an exception saying "Invalid SQL Statement". What am I doing wrong?

    Read the article

  • Is there a way to load an existing connection string for Linq to SQL from an app.config file?

    - by Brian Surowiec
    I'm running into a really annoying problem with my Linq to SQL project. When I add everything in under the web project everything goes as expected and I can tell it to use my existing connection string stored in the web.config file and the Linq code pulls directly from the ConfigurationManager. This all turns ugly once I move the code into its own project. I’ve created an app.config file, put the connection string in there as it was in the web.config but when I try to add another table in the IDE keeps forcing me to either hardcode the connection string or creates a Settings file and puts it in there, which then adds a new entry into the app.config file with a new name. Is there a way keep my Linq code in its own project yet still refer back to my config file without the IDE continuously hardcoding the connection string or creating the Settings file? I’m converting part of my DAL over to use Linq to SQL so I’d like to use the existing connection string that our old code is using as well as keep the value in a common location, and one spot, instead of in a number of spots. Manually changing the mode to WebSettings instead of AppSettings works untill I try to add a new table, then it goes back to hardcoding the value or recreating the Settings file. I also tried to switch the project type to be a web project and then rename my app.config to web.config and then everything works as I’d like it to. I’m just not sure if there are any downfalls to keeping this as a web project since it really isn't one. The project only contains the Linq to SQL code and an implementation of my repository classes. My project layout looks like this Website -connectionString.config -web.config (refers to connectionString.config) Middle Tier -Business Logic -Repository Interfaces -etc. DAL -Linq to SQL code -Existing SPROC code -connectionString.config (linked from the web poject) -app.config (refers to connectionString.config)

    Read the article

  • Drupal Ubercart: error in passing values back to the Content Type after checkout

    - by user512826
    I am trying to set up event registration in a drupal site using Ubercart + the UC Node Checkout Module. I have followed the instructions provided in http://drupaleasy.com/blogs/ultimike/2009/03/event-registration-ubercart. However I seem to be unable to pass the Order ID and Payment Status back to the node. I have created a conditional action that on node checkout executes the following PHP code: I am using the following code to update the node on checkout - but nothing happens: if (isset($order)) { foreach ($order->products as $product) { if (isset($product->data['node_checkout_nid'])) { $node = node_load($product->data['node_checkout_nid']); $node->field_status['0']['value'] = 1; $node->field_orderid['0']['value'] = $order->order_id; node_save($node); } } } I know the conditional action is working because it prints dsm('hello world') messages on node checkout - however when I include a dsm($node) or dsm($product) in the PHP code, they return blank. Also when I go back to my product and click the 'Devel' tab, the 'data' string contains the following characters: a:1:{s:13:"form_build_id";s:37:"form-3ccc03345f4832c69666a89c560de940";} In this link http://www.ubercart.org/forum/support/10951/node_checkout_issue I found someone else with the same issue, but I have been unable to replicate his solution. Can anybody please help? Thanks so much!

    Read the article

  • Generic Constraints And Type Parameters Mess

    - by Dummy01
    Hi everyone, I have the following base abstract class defined as: public abstract class BaseObject<T> : IComparable, IComparable<T>, IEquatable<T> {} I also have an interface defined as: public interface ICode<T> where T : struct { T Code { get; } } Now I want to derive a class that is inherited from BaseObject<T> and includes interface ICode<T>. I tried to define it like that: public class DerivedObject<T, U> : BaseObject<T>, ICode<U> where T : DerivedObject<T, U> where U : struct { public DerivedObject(U code) { Code = code; } // From BaseObject protected override int InstanceCompareTo(T obj) { return Code.CompareTo(obj.Code); } // From BaseObject protected override bool InstanceEquals(T obj) { return Code.Equals(obj.Code); } // From ICode U _Code; public U Code { get { return _Code; } protected set { _Code = value; } } } The only error that comes from the compiler is for Code.CompareTo(obj.Code) with the message: 'U' does not contain a definition for 'CompareTo' and no extension method 'CompareTo' accepting a first argument of type 'U' could be found. But U is a value type and should know CompareTo. Have you any idea what I am doing wrong, or if I do all wrong? My final aim is to derive classes such these: public class Account : DerivedObject<Account, int> public class ItemGroup : DerivedObject<ItemGroup, string> Big Thanks In Advance!

    Read the article

  • How to access the members of this data in PHP?

    - by George Edison
    Okay. Now I give up. I have been playing with this for hours. I have a variable name $data. The variable contains these contents: (extracted by using var_export()) array ( 'headers' => array ( 'content-type' => 'multipart/alternative; boundary="_689e1a7d-7a0a-442a-bd6c-a1fb1dc2993e_"', ), 'ctype_parameters' => array ( 'boundary' => '_689e1a7d-7a0a-442a-bd6c-a1fb1dc2993e_', ), 'parts' => array ( 0 => stdClass::__set_state(array( 'headers' => array ( 'content-type' => 'text/plain; charset="iso-8859-1"', 'content-transfer-encoding' => 'quoted-printable', ), 'ctype_primary' => 'text', )), ), ) I removed some non-essential data. I want to access the headers value (on the second line above) - simple: $data->headers I want to access the headers value (on the fourteenth line after the stdClass:: stuff) - how? How can I possibly access the values within the stdClass::__set_state section? I tried var_export($data->parts); but all I get is NULL

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • Passing a outside variable into a <asp:sqldatasource> tag. ASP.NET 2.0

    - by MadMAxJr
    I'm designing some VB based ASP.NET 2.0, and I am trying to make more use of the various ASP tags that visual studio provides, rather than hand writing everything in the code-behind. I want to pass in an outside variable from the Session to identify who the user is for the query. <asp:sqldatasource id="DataStores" runat="server" connectionstring="<%$ ConnectionStrings:MY_CONNECTION %>" providername="<%$ ConnectionStrings:MY_CONNECTION.ProviderName %>" selectcommand="SELECT THING1, THING2 FROM DATA_TABLE WHERE (THING2 IN (SELECT THING2 FROM RELATED_DATA_TABLE WHERE (USERNAME = @user)))" onselecting="Data_Stores_Selecting"> <SelectParameters> <asp:parameter name="user" defaultvalue ="" /> </SelectParameters> </asp:sqldatasource> And on my code behind I have: Protected Sub Data_Stores_Selecting(ByVal sender As Object, ByVal e As System.Web.UI.WebControls.SqlDataSourceSelectingEventArgs) Handles Data_Stores.Selecting e.Command.Parameters("user").Value = Session("userid") End Sub Oracle squaks at me with ORA-01036, illegal variable name. Am I declaring the variable wrong in the query? I thought external variables share the same name with a @ prefixed. from what I understand, this should be placing the value I want into the query when it executes the select. EDIT: Okay, thanks for the advice so far, first error was corrected, I need to use : and not @ for the variable declaration in the query. Now it generates an ORA-01745 invalid host/bind variable name. EDIT AGAIN: Okay, looks like user was a reserved word. It works now! Thanks for other points of view on this one. I hadn't thought of that approach.

    Read the article

  • shreding xml column

    - by csetzkorn
    Hi, I have a XML column which contains XML like this: <Set> <Element> <ID> 1 </ID> <List> <ListElement> <Part1> ListElement 1 </Part1> </ListElement> <ListElement> <Part1> ListElement2 </Part1> </ListElement> </List> </Element> <Element> <ID> 2 </ID> <List> <ListElement> <Part1> ListElement3 </Part1> </ListElement> <ListElement> <Part1> ListElement4 </Part1> </ListElement> </List> </Element> </Set> I would like to shred this into a relation table containing this: ID, ListElement 1, ListElement1 1, ListElement2 2, ListElement3 2, ListElement4 I am able to obtain the content of the Parts using something like this: select List.value('(Part1/text())[1]', 'varchar(max)') as test from Table CROSS APPLY xml.nodes('// Element/List/ListElement') AS List(List) but I have not yet achieved to keep the ‘foreign key’ (the ID value). Thanks. Best wishes, Christian

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • HTML input not working correctly with AJAX update panels used else where on page

    - by Sean P
    I have some update panels on my page that do some asyncpostbacks to keep some dropdownlists correctly populated. My problem is that on my page i have an HTML input that is handling some file uploads. With the AJAX on the page with asyncpostbacks, and while i step through my code behind, the files arent being uploaded. Using a postbacktrigger (non-async) is not possible because of my layout. Here is my code: <div id="divFileInputs" runat="server"> <input id="file1" name="fileInput" type="file" runat="server" size="50" style="width: 50em" onfocus="AddFileInput()" class="textbox" /></div> <select id="selectFileList" name="ListBox1" size="5" style="width: 50em; text-align: left;" class="textbox" /> <input id="RemoveAttachmentButton" type="button" value="Remove" onclick="RemoveFileInput()" class="removebutton " /> </div> Here is my code behind: Protected Sub CopyAttachments(ByVal issueId As String) Dim files As HttpFileCollection = Request.Files Dim myStream As System.IO.Stream Dim service As New SubmitService.Service For i As Integer = 0 To files.Count - 1 Dim postedFile As HttpPostedFile = files(i) Dim fileNameWithoutPath As String = System.IO.Path.GetFileName(postedFile.FileName) If fileNameWithoutPath.Length > 0 And issueId.Length > 0 Then Dim fileLength As Integer = postedFile.ContentLength Dim fileContents(fileLength) As Byte ' Read the file into the byte array. Send it to the web service. myStream = postedFile.InputStream myStream.Read(fileContents, 0, fileLength) service.ClearQuestAttachToIssue(issueId, fileNameWithoutPath, fileContents) End If Next service = Nothing End Sub When I put a breakpoint in at the declaration of service and then check the value of "files", the count is 0. I am expecting it to be 2 when i have one file uploaded. Anyone know how to fix this?

    Read the article

< Previous Page | 747 748 749 750 751 752 753 754 755 756 757 758  | Next Page >