Search Results

Search found 36719 results on 1469 pages for 'value chain'.

Page 752/1469 | < Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Forming triangles from points and relations

    - by SiN
    Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

    Read the article

  • Why can't you return a List from a Compiled Query?

    - by Andrew
    I was speeding up my app by using compiled queries for queries which were getting hit over and over. I tried to implement it like this: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id) End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, List(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ (From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u).ToList()) This did not work and I got this error message: Type : System.ArgumentNullException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089 Message : Value cannot be null. Parameter name: value However, when I changed my compiled query to return IQueryable instead of List like so: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id).ToList() End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, IQueryable(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u) It worked fine. Can anyone shed any light as to why this is? BTW, compiled queries rock! They sped up my app by a factor of 2.

    Read the article

  • C++ MACRO that will execute a block of code and a certain command after that block.

    - by Poni
    void main() { int xyz = 123; // original value { // code block starts xyz++; if(xyz < 1000) xyz = 1; } // code block ends int original_value = xyz; // should be 123 } void main() { int xyz = 123; // original value MACRO_NAME(xyz = 123) // the macro takes the code code that should be executed at the end of the block. { // code block starts xyz++; if(xyz < 1000) xyz = 1; } // code block ends << how to make the macro execute the "xyz = 123" statement? int original_value = xyz; // should be 123 } Only the first main() works. I think the comments explain the issue. It doesn't need to be a macro but to me it just sounds like a classical "macro-needed" case. By the way, there's the BOOST_FOREACH macro/library and I think it does the exact same thing I'm trying to achieve but it's too complex for me to find the essence of what I need. From its introductory manual page, an example: #include <string> #include <iostream> #include <boost/foreach.hpp> int main() { std::string hello( "Hello, world!" ); BOOST_FOREACH( char ch, hello ) { std::cout << ch; } return 0; }

    Read the article

  • OOP/MVC advice on where to place a global helper function

    - by franko75
    Hi, I have a couple of controllers on my site which are handling form data. The forms use AJAX and I have quite a few methods across different controllers which are having to do some specific processing to return errors in a JSON encoded format - see code below. Obviously this isn't DRY and I need to move this code into a single helper function which I can use globally, but I'm wondering where this should actually go! Should I create a static helper class which contains this function (e.g Validation::build_ajax_errors()), or as this code is producing a format which is application specific and tied into the jQuery validation plugin I'm using, should it be a static method stored in, for example, my main Website controller which the form handling controllers extend from? //if ajax request, output errors if (request::is_ajax()) { //need to build errors into array form for javascript validation - move this into a helper method accessible globally $errors = $post->errors('form_data/form_error_messages'); $i = 0; $new_errors = array(); foreach ($errors as $key => $value) { $new_errors[$i][0] = '#' . $key; $new_errors[$i][1] = $value; $new_errors[$i][2] = "error"; $i++; } echo '{"jsonValidateReturn":' . json_encode($new_errors) . '}'; return; }

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • JSP - Beginner question , Bypass the if..statement on page load?

    - by TatMing
    i am new in JSP,i have some problem with the following code : <%@ page contentType="text/html;charset=Big5" %> <html> <head> <title></title> </head> <body> <form method="post" action="InsertStudent.jsp"> <input type="text" size="20" name="txtName" /> <input type="text" size="20" name="txtDob" /> <input type="text" size="20" name="txtProStudied" /> <input type="submit" name="B1" value="Submit" /> </form> <% if (request.getParameter("txtName") !="" && request.getParameter("txtDob") != "" && request.getParameter("txtProStudied") != "" ) { out.println("...bypass the if....statement"); } %> </body> </html> If run this code, the out.println will fire even the 3 input box have value or not..

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • Enforce link in Team foundation server bug work item for duplicates

    - by Tewr
    We have just started out with Team Foundation Server 2008 / Visual Studio Team System and we are pleased to find how we can export and modify work items to our needs. However, this last thing that would make the setup perfect for us has proved somewhat difficult: We have exported the Bug work item type and have made modifications to it to appear differently to different groups of users. We do, however, see a potential problem in non-developers reporting bugs which turn out to be duplicates. We would like to enforce that users who close a ticket with resolved reason:duplicate also creates a link to the bug which is perceived as the first bug report. I have looked at System.RelatedLinkCount, and put the rule <FIELD type="Integer" name="RelatedLinkCount" refname="System.RelatedLinkCount"> <WHEN field="Microsoft.VSTS.Common.ResolvedReason" value="duplicate"> <PROHIBITEDVALUES> <LISTITEM value="0" /> </PROHIBITEDVALUES> </WHEN> </FIELD> However, when I try to put anything in that scope, the importer tells me that System.RelatedLinkCount does not accept the rule, no matter what I put, but the rule above shows what I am trying to do (even though the most preferable rule would also check that the bug that I link to is not a duplicate as well, though this is overkill :P) Has anyone else tried to enforce rules like this in work items? Is there another approach to solving the same issue? I am thankful for any thoughts on the matter.

    Read the article

  • How to pass an integration property to a batch file with CruiseControlNet ?

    - by TridenT
    In the build log of my project, i can see these properties: <integrationProperties> <CCNetProject>Gdet_T</CCNetProject> ... <LastChangeNumber>0</LastChangeNumber> <LastIntegrationStatus>Success</LastIntegrationStatus> <LastSuccessfulIntegrationLabel>25</LastSuccessfulIntegrationLabel> <LastModificationDate>4/6/2010 1:29:04 PM</LastModificationDate> <LastChangeNumber>10841</LastChangeNumber> </integrationProperties> I want to pass the property CCNetProject and LastChangeNumber to a batch file. it works well with CCNetProject, as it can be used in the batch as an environment variable %CCNetProject%. But it doesn't work with other properties (those are not starting with the CCnet prefix) as LastChangeNumber or LastModificationDate. I tried to pass it as environment variable, but it fails ! <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <buildArgs>$(LastModificationDate)</buildArgs> </exec> I tried to pass it as argument, but it fails: <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <environment> <variable> <name>svn_label</name> <value>"${LastModificationDate}"</value> </variable> </environment> </exec> The results is always the same when I display the parameter or variable : empty string or the variable name $(svn_label) I'm sure it is simple, but ... I can't find ! Any idea ?

    Read the article

  • How does asp.net MVC remember my false values on postback?

    - by Michel
    Hi, This is working, but how??? I have a controller action for a post: [AcceptVerbs(HttpVerbs.Post )] public ActionResult Edit(Person person) { bool isvalid = ModelState.IsValid; etc. The Person object has a property BirthDate, type DateTime. When i enter some invalid data in the form, say 'blabla' which is obvious not a valid Datetime, it fills all the (other) Person properties with the correct data and the BirthDate property with a new blank DateTime. The bool isvalid has the value 'false'. So far so good. Then i do this: return View(p); and in the view i have this: <%= Html.TextBox("BirthDate", String.Format("{0:g}", Model.BirthDate)) %> <%= Html.ValidationMessage("BirthDate", "*") %> Ant there it comes: i EXPECTED the model to contain the new, blank DateTime because i didn't put any new data in. Second, when the View displays something, it must be a DateTime, because Model.BirthDate can't hold anything but a DateTime. But to my surprise, it shows a textbox with the 'blabla' value! (and the red * behind it) Which ofcourse is nice because the user can seee what he typed wrong, but how can that (blabla)string be transferred to the View in a DateTime field?

    Read the article

  • wpf progress bar slows 10x times serial port communications... how could be possible that?

    - by D_Guidi
    I know that this could look a dumb question, but here's my problem. I have a worker dialog that "hides" a backgroundworker, so in a worker thread I do my job, I report the progress in a standard way and then I show the results in my WPF program. The dialog contains a simply animated gif and a standard wpf progress bar, and when a progress is notified I set Value property. All lokks as usual and works well for any kind of job, like web service calls, db queries, background elaboration and so on. For my job we use also many "couplers", card readers that reads data from smart card, that are managed with native C code that access to serial port (so, I don't use .NET SerialPort object). I have some nunit tests and I read a sample card in 10 seconds, but using my actual program, under the backgroundworker and showing my worker dialog, I need 1.30 minutes to do the SAME job. I struggled into problem for days until I decide to remove the worker dialog, and without dialog I obtain the same performances of the tests! So I investigated, and It's not the dialog, not the animated gif, but the wpf progress bar! Simply the fact that a progress bar is shown (so, no animation, no Value set called, nothing of nothing) slows serialport communicatitons. Looks incredible? I've tested this behavior and it's exactly what happens.

    Read the article

  • Why do I get this strange output behavior?

    - by WilliamKF
    I have the following program test.cc: #include <iostream> unsigned char bogus1[] = { // Changing # of periods (0x2e) changes output after periods. 0x2e, 0x2e, 0x2e, 0x2e }; unsigned int bogus2 = 1816; // Changing this value changes output. int main() { std::clog << bogus1; } I build it with: g++ -g -c -o test.o test.cc; g++ -static-libgcc -o test test.o Using g++ version 3.4.6 I run it through valgrind and nothing is reported wrong. However the output has two extra control characters and looks like this: .... Thats a control-X and a control-G at the end. If you change the value of bogus2 you get different control characters. If you change the number of periods in the array the issue goes away or changes. I suspect it is a memory corruption bug in the compiler or iostream package. What is going on here?

    Read the article

  • objective-c having issues with an NSDictioary object

    - by Mark
    I have a simple iPhone app that Im learning and I want to have an instance variable called urlLists which is an NSDictionary I have declared it like so: @interface MyViewController : UIViewController <UIPickerViewDataSource, UIPickerViewDelegate>{ IBOutlet UIPickerView *pickerView; NSMutableArray *categories; NSDictionary *urlLists; } @property(retain) NSDictionary *urlLists; @end and in the implementation: @implementation MyViewController @synthesize urlLists; ... - (void)viewDidLoad { [super viewDidLoad]; categories = [[NSMutableArray alloc] init]; [categories addObject:@"Sport"]; [categories addObject:@"Entertainment"]; [categories addObject:@"Technology"]; [categories addObject:@"Political"]; NSArray *objects = [NSArray arrayWithObjects:@"value1", @"value2", @"value3", @"value4", nil]; urlLists = [NSDictionary dictionaryWithObjects:objects forKeys:categories]; for (id key in urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } ... @end And, this all works up to here. I have added a UIPicker to my app, and when I select one of the items, I want to Log the one picked and its related entry in my dictionary. -(void) pickerView:(UIPickerView *)thePickerView didSelectRow:(NSInteger)row inComponent:(NSInteger) component { for (id key in self.urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } but I get the old EXC_BAD_ACCESS error... I know Im missing something small, but what? Thanks

    Read the article

  • Create lambda action from function expression

    - by Martin Robins
    It is relatively easy to create a lambda function that will return the value of a property from an object, even including deep properties... Func<Category, string> getCategoryName = new Func<Category, string>(c => c.Name); and this can be called as follows... string categoryName = getCategoryName(this.category); But, given only the resulting function above (or the expression originally used to create the function), can anybody provide an easy way to create the opposing action... Action<Category, string> setCategoryName = new Action<Category, string>((c, s) => c.Name = s); ...that will enable the same property value to be set as follows? setCategoryName(this.category, ""); Note that I am looking for a way to create the action programatically from the function or expression - I hope that I have shown that I already know how to create it manually. I am open to answers that work in both .net 3.5 and 4.0. Thanks.

    Read the article

  • parsing python to csv

    - by user185955
    I'm trying to download some game stats to do some analysis, only problem is each season the data their isn't 100% consistent. I grab the json file from the site, then wish to save it to a csv with the first line in the csv containing the heading for that column, so the heading would be essentially the key from the python data type. #!/usr/bin/env python import requests import json import csv base_url = 'http://www.afl.com.au/api/cfs/afl/' token_url = base_url + 'WMCTok' player_url = base_url + 'matchItems/round' def printPretty(data): print(json.dumps(data, sort_keys=True, indent=2, separators=(',', ': '))) session = requests.Session() # session makes it simple to use the token across the requests token = session.post(token_url).json()['token'] # get the token session.headers.update({'X-media-mis-token': token}) # set the token Season = 2014 Roundno = 4 if Roundno<10: strRoundno = '0'+str(Roundno) else: strRoundno = str(Roundno) # get some data (could easily be a for loop, might want to put in a delay using Sleep so that you don't get IP blocked) data = session.get(player_url + '/CD_R'+str(Season)+'014'+strRoundno) # print everything printPretty(data.json()) with open('stats_game_test.csv', 'w', newline='') as csvfile: spamwriter = csv.writer(csvfile, delimiter="'",quotechar='|', quoting=csv.QUOTE_ALL) for profile in data.json()['items']: spamwriter.writerow(['%s' %(profile)]) #for key in data.json().keys(): # print("key: %s , value: %s" % (key, data.json()[key])) The above code grabs the json and writes it to a csv, but it puts the key in each individual cell next to the value (eg 'venueId': 'CD_V190'), the key needs to be just across the first row as a heading. It gives me a csv file with data in the cells like this Column A B 'tempInCelsius': 17.0 'totalScore': 32 'tempInCelsius': 16.0 'totalScore': 28 What I want is the data like this tempInCelsius totalScore 17 32 16 28 As I mentioned up the top, the data isn't always consistent so if I define what fields to grab with spamwriter.writerow([profile['tempInCelsius'], profile['totalScore']]) then it will error out on certain data grabs. This is why I'm now trying the above method so it just grabs everything regardless of what data is there.

    Read the article

  • Flex Tree with infinite parents and children

    - by Tempname
    I am working on a tree component and I am having a bit of the issue with populating the data-provider for this tree. The data that I get back from my database is a simple array of value objects. Each value object has 2 properties. ObjectID and ParentID. For parents the ParentID is null and for children the ParentID is the ObjectID of the parent. Any help with this is greatly appreciated. Essentially the tree should look something like this: Parent1 Child1 Child1 Child2 Child1 Child2 Parent2 Child1 Child2 Child3 Child1 This is the current code that I am testing with: public function setDataProvider(data:Array):void { var tree:Array = new Array(); for(var i:Number = 0; i < data.length; i++) { // do the top level array if(!data[i].parentID) { tree.push(data[i], getChildren(data[i].objectID, data)); } } function getChildren(objectID:Number, data:Array):Array { var childArr:Array = new Array(); for(var k:Number = 0; k < data.length; k++) { if(data[k].parentID == objectID) { childArr.push(data[k]); //getChildren(data[k].objectID, data); } } return childArr; } trace(ObjectUtil.toString(tree)); } Here is a cross section of my data: ObjectID ParentID 1 NULL 10 NULL 8 NULL 6 NULL 4 6 3 6 9 6 2 6 11 7 7 8 5 8

    Read the article

  • Help with AJAX, Using PHP and hiding elements.

    - by ryan
    Hey, This is my first time with AJAX, so I'm a bit confused and need your help. I have four div id's and want to toggle hide/show between them based on result from database. Sounds simple, eh! But it is hard to implement for me. HELP!. This is my code - <div id="1">HEya</div> <div id="2">What's up?</div> <input type="submit" id='approve' name="action" value="Approve" onclick="a()" class="approve" /> <input type="submit" id='reject' value="Reject" name="action" onclick="r()" class="reject"/> <script language="javascript" type="text/javascript"> //if cookie exists, at the beginning the form should be hidden if (<?php $responseanswer['response']=='approve'; ?> ){ document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display = 'inline'; } //if user clicks reject, hide one element dislay another else if (<?php $responseanswer['response']=='reject'; ?>){ //if cookie exists document.getElementById('2').style.display = 'none'; document.getElementById('1').style.display = 'block'; } else { function a() { var a = document.getElementById('2'); document.getElementById('1').style.display= 'block'; } //on reject creating a new cookie function r() { var a = document.getElementById('reject'); document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display= 'block'; } } </script> Eveything is fine, but the div is not hiding.

    Read the article

  • Member function overloading/template specialization issue

    - by Ferruccio
    I've been trying to call the overloaded table::scan_index(std::string, ...) member function without success. For the sake of clarity, I have stripped out all non-relevant code. I have a class called table which has an overloaded/templated member function named scan_index() in order to handle strings as a special case. class table : boost::noncopyable { public: template <typename T> void scan_index(T val, std::function<bool (uint recno, T val)> callback) { // code } void scan_index(std::string val, std::function<bool (uint recno, std::string val)> callback) { // code } }; Then there is a hitlist class which has a number of templated member functions which call table::scan_index(T, ...) class hitlist { public: template <typename T> void eq(uint fieldno, T value) { table* index_table = db.get_index_table(fieldno); // code index_table->scan_index<T>(value, [&](uint recno, T n)->bool { // code }); } }; And, finally, the code which kicks it all off: hitlist hl; // code hl.eq<std::string>(*fieldno, p1.to_string()); The problem is that instead of calling table::scan_index(std::string, ...), it calls the templated version. I have tried using both overloading (as shown above) and a specialized function template (below), but nothing seems to work. After staring at this code for a few hours, I feel like I'm missing something obvious. Any ideas? template <> void scan_index<std::string>(std::string val, std::function<bool (uint recno, std::string val)> callback) { // code }

    Read the article

  • Userdefined margins in WPF printing

    - by MTR
    Most printing samples for WPF go like this: PrintDialog dialog = new PrintDialog(); if (dialog.ShowDialog() == true) { StackPanel myPanel = new StackPanel(); myPanel.Margin = new Thickness(15); Image myImage = new Image(); myImage.Width = dialog.PrintableAreaWidth; myImage.Stretch = Stretch.Uniform; myImage.Source = new BitmapImage(new Uri("pack://application:,,,/Images/picture.bmp")); myPanel.Children.Add(myImage); myPanel.Measure(new Size(dialog.PrintableAreaWidth, dialog.PrintableAreaHeight)); myPanel.Arrange(new Rect(new Point(0, 0), myPanel.DesiredSize)); dialog.PrintVisual(myPanel, "A Great Image."); } What I don't like about this is, that they always set the margin to a fixed value. But in PrintDialog the user has the option to choose a individual margin that no sample cares about. If the user now selects a margin that is larger as the fixed margin set by program, the printout is truncated. Is there a way to get the user selected margin value from PrintDialog? TIA Michael

    Read the article

  • Get dragged / saved items state back from Sql Server

    - by user571507
    Ok i saw many post's on how to serialize the value of dragged items to get hash and they tell how to save them. Now the question is how do i persist the dragged items the next time when user log's in using the has value that i got eg: <ul class="list"> <li id="id_1"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_2"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_3"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_4"> <div class="item ui-corner-all ui-widget"> </div> </li> </ul> which on serialize will give "id[]=1&id[]=2&id[]=3&id[]=4" Now think that i saved it to Sql server database in a single field called SortOrder. Now how do i get the items to these order again ? the code to make these sort is below,without which people didn't know which library i had used to sort and serialize <script type="text/javascript"> $(document).ready(function() { $(".list li").css("cursor", "move"); $(".list").sortable(); }); </script>

    Read the article

  • jquery question

    - by OM The Eternity
    I am using the Jquery library to copy the text enter in one textfield to another textfield using a check box when clicked.. which is as follows <html> <head> <script src="js/jquery.js" ></script> </head> <body> <form> <input type="text" name="startdate" id="startdate" value=""/> <input type="text" name="enddate" id="enddate" value=""/> <input type="checkbox" name="checker" id="checker" /> </form> <script> $(document).ready(function(){ $("input#checker").bind("click",function(o){ if($("input#checker:checked").length){ $("#enddate").val($("#startdate").val()); }else{ $("#enddate").val(""); } }); } ); </script> </body> </html> now here i want the check box to be selected by default, so that the data entered in start date get copied automatically as check box is checked by default... so what event should be called here in jquery script? please help me in resolving this issue...

    Read the article

  • Log in to subdomain via main domain

    - by Mattias
    I have a website, available through multiple domainnames. like www.domain1.com .... www.domain5.com All my customers have their own subdomain. like: customer1.domain1.com customer2.domain1.com .... customer351.domain4.com Currently i dont use SSL, each customer log in their own account via their sub domain. I want to change this, and make all customers log in on a central log in page, that would use SSL, for example. https://login.domain1.com And somehow redirect each user to the correct sub domain adress. (Sub domain that don't use SSL) How do I do this, and maintain security? One idea i had: Login - add random value somewhere in the database, Redirect to subdomain, with querystring the randomvalue. And after that the session takes care of it, Each value can be used once only.. But how secure is that? I guess someone would ask the question "why?" to me. Because SSL costs money. And unfortunately i dont have a lot of it. :D Thanks for your time!

    Read the article

< Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >