Search Results

Search found 36719 results on 1469 pages for 'value chain'.

Page 752/1469 | < Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >

  • OOP/MVC advice on where to place a global helper function

    - by franko75
    Hi, I have a couple of controllers on my site which are handling form data. The forms use AJAX and I have quite a few methods across different controllers which are having to do some specific processing to return errors in a JSON encoded format - see code below. Obviously this isn't DRY and I need to move this code into a single helper function which I can use globally, but I'm wondering where this should actually go! Should I create a static helper class which contains this function (e.g Validation::build_ajax_errors()), or as this code is producing a format which is application specific and tied into the jQuery validation plugin I'm using, should it be a static method stored in, for example, my main Website controller which the form handling controllers extend from? //if ajax request, output errors if (request::is_ajax()) { //need to build errors into array form for javascript validation - move this into a helper method accessible globally $errors = $post->errors('form_data/form_error_messages'); $i = 0; $new_errors = array(); foreach ($errors as $key => $value) { $new_errors[$i][0] = '#' . $key; $new_errors[$i][1] = $value; $new_errors[$i][2] = "error"; $i++; } echo '{"jsonValidateReturn":' . json_encode($new_errors) . '}'; return; }

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • JSP - Beginner question , Bypass the if..statement on page load?

    - by TatMing
    i am new in JSP,i have some problem with the following code : <%@ page contentType="text/html;charset=Big5" %> <html> <head> <title></title> </head> <body> <form method="post" action="InsertStudent.jsp"> <input type="text" size="20" name="txtName" /> <input type="text" size="20" name="txtDob" /> <input type="text" size="20" name="txtProStudied" /> <input type="submit" name="B1" value="Submit" /> </form> <% if (request.getParameter("txtName") !="" && request.getParameter("txtDob") != "" && request.getParameter("txtProStudied") != "" ) { out.println("...bypass the if....statement"); } %> </body> </html> If run this code, the out.println will fire even the 3 input box have value or not..

    Read the article

  • Reading from an write-only(OUT) parameter in pl/sql

    - by sqlgrasshopper5
    When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

    Read the article

  • Greasemonkey failing to GM_setValue()

    - by HonoredMule
    I have a Greasemonkey script that uses a Javascript object to maintain some stored objects. It covers quite a large volume of information, but substantially less than it successfully stored and retrieved prior to encountering my problem. One value refuses to save, and I can not for the life of me determine why. The following problem code: Works for other larger objects being maintained. Is presently handling a smaller total amount of data than previously worked. Is not colliding with any function or other object definitions. Can (optionally) successfully save the problem storage key as "{}" during code startup. this.save = function(table) { var tables = this.tables; if(table) tables = [table]; for(i in tables) { logger.log(this[tables[i]]); logger.log(JSON.stringify(this[tables[i]])); GM_setValue(tables[i] + "_" + this.user, JSON.stringify(this[tables[i]])); logger.log(tables[i] + "_" + this.user + " updated"); logger.log(GM_getValue(tables[i] + "_" + this.user)); } } The problem is consistently reproducible and the logging statments produce the following output in Firebug: Object { 54,10 = Object } // Expansion shows complete contents as expected, but there is one oddity--Firebug highlights the array keys in purple instead of the usual black for anonymous objects. {"54,10":{"x":54,"y":10,"name":"Lucky Pheasant"}} // The correctly parsed string. bookmarks_HonoredMule saved undefined I have tried altering the format of the object keys, to no effect. Further narrowing down the issue is that this particular value is successfully saved as an empty object ("{}") during code initialization, but skipping that also does not help. Reloading the page confirms that saving of the nonempty object truly failed. Any idea what could cause this behavior? I've thoroughly explored the possibility of hitting size constraints, but it doesn't appear that can be the problem--as previously mentioned, I've already reduced storage usage. Other larger objects save still, and the total number of objects, which was not high already, has further been reduced by an amount greater than the quantity of data I'm attempting to store here.

    Read the article

  • Is this reference or code in mistake or bug?

    - by mikezang
    I copied some text from NSDate Reference as below, please check Return Value, it is said the format will be in YYYY-MM-DD HH:MM:SS ±HHMM, but I got as below in my app, so the reference is mistake? or code in mistake? Saturday, January 1, 2011 12:00:00 AM Japan Standard Time or 2011?1?1????0?00?00? ????? descriptionWithLocale: Returns a string representation of the receiver using the given locale. - (NSString *)descriptionWithLocale:(id)locale Parameters locale An NSLocale object. If you pass nil, NSDate formats the date in the same way as the description method. On Mac OS X v10.4 and earlier, this parameter was an NSDictionary object. If you pass in an NSDictionary object on Mac OS X v10.5, NSDate uses the default user locale—the same as if you passed in [NSLocale currentLocale]. Return Value A string representation of the receiver, using the given locale, or if the locale argument is nil, in the international format YYYY-MM-DD HH:MM:SS ±HHMM, where ±HHMM represents the time zone offset in hours and minutes from GMT (for example, “2001-03-24 10:45:32 +0600”)

    Read the article

  • Image jQuery scroller in a container. (like facebook cropper) can't get values of position.

    - by Stefan
    Hey all. Having a reallllll mind pain. I have a php image uploader which is all good and sotring the file and the jquery ajax is returning the image in an ammended html div with a div set up like this: #crop-holder { width:80px; height:80px; margin:10px 10px 20px 10px; border:1px #c0c0c0 solid; overflow:hidden; cursor:move; } The image is viewing fine and I am using the jquery scrollview plugin: http://code.google.com/p/jquery-scrollview/ I have tried adding a few lines to the plugin to store variables of scrollTop and Left and then replacing two hidden input values with x and y in my page. And then on the returned ajax html in the div I am trying to on a button click (for example) retrieve the values of the two hidden inputs.... Heres what i added to the plugin (i'm no js expert!): .mouseout(function(){ var _m = this.m; var lasty = _m.scrollTop(); getElementById("ycord").value = lasty; var lastx = _m.scrollLeft(); getElementById("xcord").value = lastx; self.stopgrab(); }) Still no luck!! How can I get the scrollTop and scrollLeft and successfully prepare them for sending onto another php script!? Thanks:) stefpretty

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • jquery question

    - by OM The Eternity
    I am using the Jquery library to copy the text enter in one textfield to another textfield using a check box when clicked.. which is as follows <html> <head> <script src="js/jquery.js" ></script> </head> <body> <form> <input type="text" name="startdate" id="startdate" value=""/> <input type="text" name="enddate" id="enddate" value=""/> <input type="checkbox" name="checker" id="checker" /> </form> <script> $(document).ready(function(){ $("input#checker").bind("click",function(o){ if($("input#checker:checked").length){ $("#enddate").val($("#startdate").val()); }else{ $("#enddate").val(""); } }); } ); </script> </body> </html> now here i want the check box to be selected by default, so that the data entered in start date get copied automatically as check box is checked by default... so what event should be called here in jquery script? please help me in resolving this issue...

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • Generic Constraints And Type Parameters Mess

    - by Dummy01
    Hi everyone, I have the following base abstract class defined as: public abstract class BaseObject<T> : IComparable, IComparable<T>, IEquatable<T> {} I also have an interface defined as: public interface ICode<T> where T : struct { T Code { get; } } Now I want to derive a class that is inherited from BaseObject<T> and includes interface ICode<T>. I tried to define it like that: public class DerivedObject<T, U> : BaseObject<T>, ICode<U> where T : DerivedObject<T, U> where U : struct { public DerivedObject(U code) { Code = code; } // From BaseObject protected override int InstanceCompareTo(T obj) { return Code.CompareTo(obj.Code); } // From BaseObject protected override bool InstanceEquals(T obj) { return Code.Equals(obj.Code); } // From ICode U _Code; public U Code { get { return _Code; } protected set { _Code = value; } } } The only error that comes from the compiler is for Code.CompareTo(obj.Code) with the message: 'U' does not contain a definition for 'CompareTo' and no extension method 'CompareTo' accepting a first argument of type 'U' could be found. But U is a value type and should know CompareTo. Have you any idea what I am doing wrong, or if I do all wrong? My final aim is to derive classes such these: public class Account : DerivedObject<Account, int> public class ItemGroup : DerivedObject<ItemGroup, string> Big Thanks In Advance!

    Read the article

  • How to pass an integration property to a batch file with CruiseControlNet ?

    - by TridenT
    In the build log of my project, i can see these properties: <integrationProperties> <CCNetProject>Gdet_T</CCNetProject> ... <LastChangeNumber>0</LastChangeNumber> <LastIntegrationStatus>Success</LastIntegrationStatus> <LastSuccessfulIntegrationLabel>25</LastSuccessfulIntegrationLabel> <LastModificationDate>4/6/2010 1:29:04 PM</LastModificationDate> <LastChangeNumber>10841</LastChangeNumber> </integrationProperties> I want to pass the property CCNetProject and LastChangeNumber to a batch file. it works well with CCNetProject, as it can be used in the batch as an environment variable %CCNetProject%. But it doesn't work with other properties (those are not starting with the CCnet prefix) as LastChangeNumber or LastModificationDate. I tried to pass it as environment variable, but it fails ! <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <buildArgs>$(LastModificationDate)</buildArgs> </exec> I tried to pass it as argument, but it fails: <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <environment> <variable> <name>svn_label</name> <value>"${LastModificationDate}"</value> </variable> </environment> </exec> The results is always the same when I display the parameter or variable : empty string or the variable name $(svn_label) I'm sure it is simple, but ... I can't find ! Any idea ?

    Read the article

  • Optimizing a "set in a string list" to a "set as a matrix" operation

    - by Eric Fournier
    I have a set of strings which contain space-separated elements. I want to build a matrix which will tell me which elements were part of which strings. For example: "" "A B C" "D" "B D" Should give something like: A B C D 1 2 1 1 1 3 1 4 1 1 Now I've got a solution, but it runs slow as molasse, and I've run out of ideas on how to make it faster: reverseIn <- function(vector, value) { return(value %in% vector) } buildCategoryMatrix <- function(valueVector) { allClasses <- c() for(classVec in unique(valueVector)) { allClasses <- unique(c(allClasses, strsplit(classVec, " ", fixed=TRUE)[[1]])) } resMatrix <- matrix(ncol=0, nrow=length(valueVector)) splitValues <- strsplit(valueVector, " ", fixed=TRUE) for(cat in allClasses) { if(cat=="") { catIsPart <- (valueVector == "") } else { catIsPart <- sapply(splitValues, reverseIn, cat) } resMatrix <- cbind(resMatrix, catIsPart) } colnames(resMatrix) <- allClasses return(resMatrix) } Profiling the function gives me this: $by.self self.time self.pct total.time total.pct "match" 31.20 34.74 31.24 34.79 "FUN" 30.26 33.70 74.30 82.74 "lapply" 13.56 15.10 87.86 97.84 "%in%" 12.92 14.39 44.10 49.11 So my actual questions would be: - Where are the 33% spent in "FUN" coming from? - Would there be any way to speed up the %in% call? I tried turning the strings into factors prior to going into the loop so that I'd be matching numbers instead of strings, but that actually makes R crash. I've also tried going for partial matrix assignment (IE, resMatrix[i,x] <- 1) where i is the number of the string and x is the vector of factors. No dice there either, as it seems to keep on running infinitely.

    Read the article

  • Call Oracle package function using Odbc from C#

    - by Paolo Tedesco
    I have a function defined inside an Oracle package: CREATE OR REPLACE PACKAGE BODY TESTUSER.TESTPKG as FUNCTION testfunc(n IN NUMBER) RETURN NUMBER as begin return n + 1; end testfunc; end testpkg; / How can I call it from C# using Odbc? I tried the following: using System; using System.Data; using System.Data.Odbc; class Program { static void Main(string[] args) { using (OdbcConnection connection = new OdbcConnection("DSN=testdb;UID=testuser;PWD=testpwd")) { connection.Open(); OdbcCommand command = new OdbcCommand("TESTUSER.TESTPKG.testfunc", connection); command.CommandType = System.Data.CommandType.StoredProcedure; command.Parameters.Add("ret", OdbcType.Int).Direction = ParameterDirection.ReturnValue; command.Parameters.Add("n", OdbcType.Int).Direction = ParameterDirection.Input; command.Parameters["n"].Value = 42; command.ExecuteNonQuery(); Console.WriteLine(command.Parameters["ret"].Value); } } } But I get an exception saying "Invalid SQL Statement". What am I doing wrong?

    Read the article

  • not saving when using setDidReceiveDataSelector

    - by coder4xc
    i want to download a file and show the progress bar i was able to do this. now , i want to show the progress value in a label and use this code to progress init and update label : [queue setDelegate:self]; [queue setRequestDidFinishSelector:@selector(updateLabel)]; [queue setDownloadProgressDelegate:progress]; [queue setShowAccurateProgress:YES]; ASIHTTPRequest *request; request = [ASIHTTPRequest requestWithURL:url]; [request setDelegate:self]; [request setTemporaryFileDownloadPath:[filePath stringByAppendingString:@".download"]]; [request setAllowResumeForFileDownloads:YES]; [request setDidFinishSelector:@selector(updateLabel)]; [request setDidReceiveDataSelector:@selector(updateLabel)]; [request setShouldContinueWhenAppEntersBackground:YES]; [request setShouldAttemptPersistentConnection:NO]; [request setDownloadDestinationPath:filePath]; [queue addOperation:request]; [queue go]; but not save in the destination path ! and when i clear this code :  [request setDidReceiveDataSelector:@selector(updateLabel)]; saving done ! what is problem ? i want to update label text when progress value changed

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How can I bind multiple Jquery UI Slider with "year" Select?

    - by arthur_br
    Hi, I'm trying to render sliders instead of select components. Each page has several select components marked with class='jqselect' and all of them will have decreasing year values (some years may be missing). Eg. a select may have values [2010, 2009, 2006, 2005, 2004]. I have tried binding it both following the examples in the jQuery UI doc (but ignoring the missing years) and using selectToUISlider by filamentgroup (http://www.filamentgroup.com/lab/update_jquery_ui_slider_from_a_select_element_now_with_aria_support//). None of them work. Here is what I've done so far: Binding selects with following slider container divs: $('#content div.jqslider').slider({ animate: true, min: $(this).prev().children().last().val(), max: $(this).prev().children().first().val(), slide: function(event, ui) { var select = $(this).prev(); select.val($(this).slider('option', 'value')); console.log($(this).slider('option', 'value')); //debug } }); This renders the slider, but console logs values from 0 to 100 and selects obviously does not change with the event. Using selectToUISlider: $('#content select.jqselect').selectToUISlider(); This does not even render the slider, throwing an error 'b is undefined' in jquery-min.js (line 30, v1.4.2). If I pass the identifier of only one of the sliders, it is rendered but very buggy. Please, I'm stucked in the by two days and any help is much appreciated. Regards, Arthur

    Read the article

  • Is there a way to load an existing connection string for Linq to SQL from an app.config file?

    - by Brian Surowiec
    I'm running into a really annoying problem with my Linq to SQL project. When I add everything in under the web project everything goes as expected and I can tell it to use my existing connection string stored in the web.config file and the Linq code pulls directly from the ConfigurationManager. This all turns ugly once I move the code into its own project. I’ve created an app.config file, put the connection string in there as it was in the web.config but when I try to add another table in the IDE keeps forcing me to either hardcode the connection string or creates a Settings file and puts it in there, which then adds a new entry into the app.config file with a new name. Is there a way keep my Linq code in its own project yet still refer back to my config file without the IDE continuously hardcoding the connection string or creating the Settings file? I’m converting part of my DAL over to use Linq to SQL so I’d like to use the existing connection string that our old code is using as well as keep the value in a common location, and one spot, instead of in a number of spots. Manually changing the mode to WebSettings instead of AppSettings works untill I try to add a new table, then it goes back to hardcoding the value or recreating the Settings file. I also tried to switch the project type to be a web project and then rename my app.config to web.config and then everything works as I’d like it to. I’m just not sure if there are any downfalls to keeping this as a web project since it really isn't one. The project only contains the Linq to SQL code and an implementation of my repository classes. My project layout looks like this Website -connectionString.config -web.config (refers to connectionString.config) Middle Tier -Business Logic -Repository Interfaces -etc. DAL -Linq to SQL code -Existing SPROC code -connectionString.config (linked from the web poject) -app.config (refers to connectionString.config)

    Read the article

  • Help with AJAX, Using PHP and hiding elements.

    - by ryan
    Hey, This is my first time with AJAX, so I'm a bit confused and need your help. I have four div id's and want to toggle hide/show between them based on result from database. Sounds simple, eh! But it is hard to implement for me. HELP!. This is my code - <div id="1">HEya</div> <div id="2">What's up?</div> <input type="submit" id='approve' name="action" value="Approve" onclick="a()" class="approve" /> <input type="submit" id='reject' value="Reject" name="action" onclick="r()" class="reject"/> <script language="javascript" type="text/javascript"> //if cookie exists, at the beginning the form should be hidden if (<?php $responseanswer['response']=='approve'; ?> ){ document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display = 'inline'; } //if user clicks reject, hide one element dislay another else if (<?php $responseanswer['response']=='reject'; ?>){ //if cookie exists document.getElementById('2').style.display = 'none'; document.getElementById('1').style.display = 'block'; } else { function a() { var a = document.getElementById('2'); document.getElementById('1').style.display= 'block'; } //on reject creating a new cookie function r() { var a = document.getElementById('reject'); document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display= 'block'; } } </script> Eveything is fine, but the div is not hiding.

    Read the article

  • CAML query soap SharePoint

    - by robScott
    I'm trying to access a SharePoint list and return the calendar dates for a custom webpart I made. It was working fine, then I decided to only retrieve the date selected rather than the whole calendar, so I wanted to add a where clause. I've tried 'yyyy-MM-dd', 'yyyy-MM-ddThh:mm:ssZ', and 'yyyy-MM-dd hh:mm:ssZ' as string formats I've also tried MM/dd/yyyy as a date format. I'm using jQuery, and I do have list items in the calendar. I'm assuming my date is not in the correct format. var date = $(this).attr('date'); var sharepointDate = Date.parse(date).toString('yyyy-mm-ddT00:00:01Z'); var soapEnv = "<soapenv:Envelope xmlns:soapenv='http://schemas.xmlsoap.org/soap/envelope/'> \ <soapenv:Body> \ <GetListItems xmlns='http://schemas.microsoft.com/sharepoint/soap/'> \ <listName>CorporateCalendar</listName> \ <viewFields> \ <ViewFields> \ <FieldRef Name='Title' /> \ </ViewFields> \ </viewFields> \ <query><Query><Where><Geq><FieldRef Name='EventDate' /><Value Type='DateTime'>" + sharepointDate + "</Value></Geq></Where></Query></query> \ <rowLimit>500</rowLimit> \ </GetListItems> \ </soapenv:Body> \ </soapenv:Envelope>"; If I take the where clause out I receive all the items in the calendar. If the query is in there, I receive no results. Thanks in advance

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • Can a lambda can be used to change a List's values in-place ( without creating a new list)?

    - by Saint Hill
    I am trying to determine the correct way of transforming all the values in a List using the new lambdas feature in the upcoming release of Java 8 without creating a **new** List. This pertains to times when a List is passed in by a caller and needs to have a function applied to change all the contents to a new value. For example, the way Collections.sort(list) changes a list in-place. What is the easiest way given this transforming function and this starting list: String function(String s){ return [some change made to value of s]; } List<String> list = Arrays.asList("Bob", "Steve", "Jim", "Arbby"); The usual way of applying a change to all the values in-place was this: for (int i = 0; i < list.size(); i++) { list.set(i, function( list.get(i) ); } Does lambdas and Java 8 offer: an easier and more expressive way? a way to do this without setting up all the scaffolding of the for(..) loop?

    Read the article

  • Member function overloading/template specialization issue

    - by Ferruccio
    I've been trying to call the overloaded table::scan_index(std::string, ...) member function without success. For the sake of clarity, I have stripped out all non-relevant code. I have a class called table which has an overloaded/templated member function named scan_index() in order to handle strings as a special case. class table : boost::noncopyable { public: template <typename T> void scan_index(T val, std::function<bool (uint recno, T val)> callback) { // code } void scan_index(std::string val, std::function<bool (uint recno, std::string val)> callback) { // code } }; Then there is a hitlist class which has a number of templated member functions which call table::scan_index(T, ...) class hitlist { public: template <typename T> void eq(uint fieldno, T value) { table* index_table = db.get_index_table(fieldno); // code index_table->scan_index<T>(value, [&](uint recno, T n)->bool { // code }); } }; And, finally, the code which kicks it all off: hitlist hl; // code hl.eq<std::string>(*fieldno, p1.to_string()); The problem is that instead of calling table::scan_index(std::string, ...), it calls the templated version. I have tried using both overloading (as shown above) and a specialized function template (below), but nothing seems to work. After staring at this code for a few hours, I feel like I'm missing something obvious. Any ideas? template <> void scan_index<std::string>(std::string val, std::function<bool (uint recno, std::string val)> callback) { // code }

    Read the article

  • Elegant code question: How to avoid creating unneeded object

    - by SeaDrive
    The root of my question is that the C# compiler is too smart. It detects a path via which an object could be undefined, so demands that I fill it. In the code, I look at the tables in a DataSet to see if there is one that I want. If not, I create a new one. I know that dtOut will always be assigned a value, but the the compiler is not happy unless it's assigned a value when declared. This is inelegant. How do I rewrite this in a more elegant way? System.Data.DataTable dtOut = new System.Data.DataTable(); . . // find table with tablename = grp // if none, create new table bool bTableFound = false; foreach (System.Data.DataTable d1 in dsOut.Tables) { string d1_name = d1.TableName; if (d1_name.Equals(grp)) { dtOut = d1; bTableFound = true; break; } } if (!bTableFound) dtOut = RptTable(grp);

    Read the article

  • Create lambda action from function expression

    - by Martin Robins
    It is relatively easy to create a lambda function that will return the value of a property from an object, even including deep properties... Func<Category, string> getCategoryName = new Func<Category, string>(c => c.Name); and this can be called as follows... string categoryName = getCategoryName(this.category); But, given only the resulting function above (or the expression originally used to create the function), can anybody provide an easy way to create the opposing action... Action<Category, string> setCategoryName = new Action<Category, string>((c, s) => c.Name = s); ...that will enable the same property value to be set as follows? setCategoryName(this.category, ""); Note that I am looking for a way to create the action programatically from the function or expression - I hope that I have shown that I already know how to create it manually. I am open to answers that work in both .net 3.5 and 4.0. Thanks.

    Read the article

< Previous Page | 748 749 750 751 752 753 754 755 756 757 758 759  | Next Page >