Search Results

Search found 23890 results on 956 pages for 'issue'.

Page 767/956 | < Previous Page | 763 764 765 766 767 768 769 770 771 772 773 774  | Next Page >

  • Building a python module and linking it against a MacOSX framework

    - by madflo
    I'm trying to build a Python extension on MacOSX 10.6 and to link it against several frameworks (i386 only). I made a setup.py file, using distutils and the Extension object. I order to link against my frameworks, my LDFLAGS env var should look like : LDFLAGS = -lc -arch i386 -framework fwk1 -framework fwk2 As I did not find any 'framework' keyword in the Extension module documentation, I used the extra_link_args keyword instead. Extension('test', define_macros = [('MAJOR_VERSION', '1'), ,('MINOR_VERSION', '0')], include_dirs = ['/usr/local/include', 'include/', 'include/vitale'], extra_link_args = ['-arch i386', '-framework fwk1', '-framework fwk2'], sources = "testmodule.cpp", language = 'c++' ) Everything is compiling and linking fine. If I remove the -framework line from the extra_link_args, my linker fails, as expected. Here is the last two lines produced by a python setup.py build : /usr/bin/g++-4.2 -arch x86_64 -arch i386 -isysroot / -L/opt/local/lib -arch x86_64 -arch i386 -bundle -undefined dynamic_lookup build/temp.macosx-10.6-intel-2.6/testmodule.o -o build/lib.macosx-10.6-intel-2.6/test.so -arch i386 -framework sgdosx -framework srtosx -framework ssvosx -framework stsosx Unfortunately, the .so that I just produced is unable to find several symbols provided by this framework. I tried to check the linked framework with otool. None of them is appearing. $ otool -L test.so test.so: /usr/lib/libstdc++.6.dylib (compatibility version 7.0.0, current version 7.9.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.1) There is the output of otool run on a test binary, made with g++ and ldd using the LDFLAGS described at the top of my post. On this example, the -framework did work. $ otool -L vitaosx vitaosx: /Library/Frameworks/sgdosx.framework/Versions/A/sgdosx (compatibility version 1.0.0, current version 1.0.0) /Library/Frameworks/ssvosx.framework/Versions/A/ssvosx (compatibility version 1.0.0, current version 1.0.0) /usr/lib/libstdc++.6.dylib (compatibility version 7.0.0, current version 7.9.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.1) May this issue be linked to the "-undefined dynamic_lookup" flag on the linking step ? I'm a little bit confused by the few lines of documentation that I'm finding on Google. Cheers,

    Read the article

  • Display ñ on a C# .NET application

    - by mmr
    I have a localization issue. One of my industrious coworkers has replaced all the strings throughout our application with constants that are contained in a dictionary. That dictionary gets various strings placed in it once the user selects a language (English by default, but target languages are German, Spanish, French, Portuguese, Mandarin, and Thai). For our test of this functionality, we wanted to change a button to include text which has a ñ character, which appears both in Spanish and in the Arial Unicode MS font (which we're using throughout the application). Problem is, the ñ is appearing as a square block, as if the program did not know how to display it. When I debug into that particular string being read from disk, the debugger reports that character as a square block as well. So where is the failure? I think it could be in a few places: 1) Notepad may not be unicode aware, so the ñ displayed there is not the same as what vs2008 expects, and so the program interprets the character as a square (EDIT: notepad shows the same characters as vs; ie, they both show the ñ. In the same place.). 2) vs2008 can't handle ñ. I find that very, very hard to believe. 3) The text is read in properly, but the default font for vs2008 can't display it, which is why the debugger shows a square. 4) The text is not read in properly, and I should use something other than a regular StreamReader to get strings. 5) The text is read in properly, but the default String class in C# doesn't handle ñ well. I find that very, very hard to believe. 6) The version of Arial Unicode MS I have doesn't have ñ, despite it being listed as one of the 50k characters by http://www.fileinfo.info. Anything else I could have left out? Thanks for any help!

    Read the article

  • Java Runtime command line Process

    - by AEIOU
    I have a class with the following code: Process process = null; try { process = Runtime.getRuntime().exec("gs -version"); System.out.println(process.toString()); } catch (Exception e1) { e1.printStackTrace(); } finally { process.destroy(); } I can run "gs -version" on my command line and get: GPL Ghostscript 8.71 (2010-02-10) Copyright (C) 2010 Artifex Software, Inc. All rights reserved. So I know I have the path at least set somewhere. I can run that class from command line and it works. But when I run it using eclipse I get the following error: java.io.IOException: Cannot run program "gs": error=2, No such file or directory at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at java.lang.Runtime.exec(Runtime.java:431) at java.lang.Runtime.exec(Runtime.java:328) at clris.batchdownloader.TestJDBC.main(TestJDBC.java:17) Caused by: java.io.IOException: error=2, No such file or directory at java.lang.UNIXProcess.forkAndExec(Native Method) at java.lang.UNIXProcess.(UNIXProcess.java:53) at java.lang.ProcessImpl.start(ProcessImpl.java:91) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 4 more In my program, i can replace "gs" with: "java", "mvn", "svn" and it works. But "gs" does not. It's only in eclipse I have this problem. Any ideas, on what I need to do to resolve this issue?

    Read the article

  • UpdatePanel with GridView with LinkButton with Image Causes Full Postback

    - by Chris
    So this might be a fairly specific issue but I figured I'd post it since I spent hours struggling with it before I was able to determine the cause. <asp:GridView ID="gvAttachments" DataKeyNames="UploadedID" AutoGenerateColumns="false" OnSelectedIndexChanged="gvAttachments_SelectedIndexChanged" runat="server"> <EmptyDataTemplate>There are no attachments associated to this email template.</EmptyDataTemplate> <Columns> <asp:TemplateField ItemStyle-Width="100%"> <ItemTemplate> <asp:LinkButton CommandName="Select" runat="server"><img src="/images/icons/trashcan.png" style="border: none;" /></asp:LinkButton> </ItemTemplate> </asp:TemplateField> </Columns> In the ItemTemplate of the TemplateField of the GridView I have a LinkButton with an image inside of it. Normally I do this when I have an image with some text next to it but this time, for whatever reason, I just have the image. This causes the UpdatePanel to always do a full postback. SOLUTION: Change that LinkButton to be an ImageButton and the problem is solved. <asp:ImageButton ImageUrl="/images/icons/trashcan.png" Style="border: none;" CommandName="Select" runat="server" />

    Read the article

  • Should I be relying on WebTests for data validation?

    - by Alexander Kahoun
    I have a suite of web tests created for a web service. I use it for testing a particular input method that updates a SQL Database. The web service doesn't have a way to retrieve the data, that's not its purpose, only to update it. I have a validator that validates the response XML that the web service generates for each request. All that works fine. It was suggested by a teammate that I add data validation so that I check the database to see the data after the initial response validator runs and compare it with what was in the input request. We have a number of services and libraries that are separate from the web service I'm testing that I can use to get the data and compare it. The problem is that when I run the web test the data validation always fails even when the request succeeds. I've tried putting the thread to sleep between the response validation and the data validation but to no avail; It always gets the data from before the response validation. I can set a break point and visually see that the data has been updated in the DB, funny thing is when I step through it in debug with the breakpoint it does validate successfully. Before I get too much more into this issue I have to ask; Is this the purpose of web tests? Should I be able to validate data through service calls in this manner or am I asking too much of a web test and the response validation is as far as I should go?

    Read the article

  • segmentation fault on Unix - possible stack corruption

    - by bob
    hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

    Read the article

  • Writing to EEPROM on PIC

    - by JB
    Are there any PIC microcontroller programmers here? I'm learning some PIC microcontroller programming using a pickit2 and the 16F690 chip that came with it. I'm working through trying out the various facilities at the moment. I can sucessfully read a byte from the EEPROM in code if I set the EEPROM vaklue in MPLAB but I don't seem to be able to modify the value using the PIC itsself. Simply nothing happens and I don't read back the modified value, I always get the original which implies to me that the write isn't working? This is my code for that section, am I missing something? I know I'm doing a lot of unnecessary bank switches, I added most of them to ensure that being on the wrong bank wasn't the issue. ; ------------------------------------------------------ ; Now SET the EEPROM location ZERO to 0x08 ; ------------------------------------------------------ BANKSEL EEADR CLRF EEADR ; Set EE Address to zero BANKSEL EEDAT MOVLW 0x08 ; Store the value 0x08 in the EEPROM MOVWF EEDAT BANKSEL EECON1 BSF EECON1, WREN ; Enable writes to the EEPROM BANKSEL EECON2 MOVLW 0x55 ; Do the thing we have to do so MOVWF EECON2 ; that writes can work MOVLW 0xAA MOVWF EECON2 BANKSEL EECON1 BSF EECON1, WR ; And finally perform the write WAIT BTFSC EECON1, WR ; Wait for write to finish GOTO WAIT BANKSEL PORTC ; Just to make sure we are on the right bank

    Read the article

  • Activate a python virtual environment using activate_this.py in a fabfile on Windows

    - by Rudy Lattae
    I have a Fabric task that needs to access the settings of my Django project. On Windows, I'm unable to install Fabric into the project's virtualenv (issues with Paramiko + pycrypto deps). However, I am able to install Fabric in my system-wide site-packages, no problem. I have installed Django into the project's virtualenv and I am able to use all the " python manage.py" commands easily when I activate the virtualenv with the "VIRTUALENV\Scripts\activate.bat" script. I have a fabric tasks file (fabfile.py) in my project that provides tasks for setup, test, deploy, etc. Some of the tasks in my fabfile need to access the settings of my django project through "from django.conf import settings". Since the only usable Fabric install I have is in my system-wide site-packages, I need to activate the virtualenv within my fabfile so django becomes available. To do this, I use the "activate_this" module of the project's virtualenv in order to have access to the project settings and such. Using "print sys.path" before and after I execute activate_this.py, I can tell the python path changes to point to the virtualenv for the project. However, I still cannot import django.conf.settings. I have been able to successfully do this on *nix (Ubuntu and CentOS) and in Cygwin. Do you use this setup/workflow on Windows? If so Can you help me figure out why this wont work on Windows or provide any tips and tricks to get around this issue? Thanks and Cheers. REF: http://virtualenv.openplans.org/#id9 | Using Virtualenv without bin/python Local development environment: Python 2.5.4 Virtualenv 1.4.6 Fabric 0.9.0 Pip 0.6.1 Django 1.1.1 Windows XP (SP3)

    Read the article

  • JVM segmentation faults due to "Invalid memory access of location"

    - by Dan
    I have a small project written in Scala 2.9.2 with unit tests written using ScalaTest. I use SBT for compiling and running my tests. Running sbt test on my project makes the JVM segfault regularly, but just compiling and running my project from SBT works fine. Here is the exact error message: Invalid memory access of location 0x8 rip=0x10959f3c9 [1] 11925 segmentation fault sbt I cannot locate a core dump anywhere, but would be happy to provide it if it can be obtained. Running java -version results in this: java version "1.6.0_37" Java(TM) SE Runtime Environment (build 1.6.0_37-b06-434-11M3909) Java HotSpot(TM) 64-Bit Server VM (build 20.12-b01-434, mixed mode) But I've also got Java 7 installed (though I was never able to actually run a Java program with it, afaik). Another issue that may be related: some of my test cases contain titles including parentheses like ( and ). SBT or ScalaTest (not sure) will consequently insert square parens in the middle of the output. For example, a test case with the name (..)..(..) might suddenly look like (..[)..](..). Any help resolving these issues is much appreciated :-) EDIT: I installed the Java 7 JDK, so now java -version shows the right thing: java version "1.7.0_07" Java(TM) SE Runtime Environment (build 1.7.0_07-b10) Java HotSpot(TM) 64-Bit Server VM (build 23.3-b01, mixed mode) This also means that I now get a more detailed segfault error and a core dump: # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x000000010a71a3e3, pid=16830, tid=19459 # # JRE version: 7.0_07-b10 # Java VM: Java HotSpot(TM) 64-Bit Server VM (23.3-b01 mixed mode bsd-amd64 compressed oops) # Problematic frame: # V [libjvm.dylib+0x3cd3e3] And the dump.

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • Using Word COM objects in .NET, InlineShapes not copied from template to document

    - by Keith
    Using .NET and the Word Interop I am programmatically creating a new Word doc from a template (.dot) file. There are a few ways to do this but I've chosen to use the AttachedTemplate property, as such: Dim oWord As New Word.Application() oWord.Visible = False Dim oDocuments As Word.Documents = oWord.Documents Dim oDoc As Word.Document = oDocuments.Add() oDoc.AttachedTemplate = sTemplatePath oDoc.UpdateStyles() (I'm choosing the AttachedTemplate means of doing this over the Documents.Add() method because of a memory leak issue I discovered when using Documents.Add() to open from templates.) This works fine EXCEPT when there is an image (represented as an InlineShape) in the template footer. In that case the image does not appear in the resulting document. Specifically the image should appear in the oDoc.Sections.Item(1).Footers.Item(WdHeaderFooterIndex.wdHeaderFooterPrimary).Range.InlineShapes collection but it does not. This is not a problem when using Documents.Add(), however as I said that method is not an option for me. Is there an extra step I have to take to get the images from the template? I already discovered that when using AttachedTemplate I have to explicitly call UpdateStyles() (as you can see in my code snippet) to apply the template styles to the document, whereas that is done automatically when using Documents.Add(). Or maybe there's some crazy workaround? Your help is much appreciated! :)

    Read the article

  • Lotus Notes - Export emails to plain text file

    - by mbeckish
    I am setting up a Lotus Notes account to accept emails from a client, and automatically save each email as a plain text file to be processed by another application. So, I'm trying to create my very first Agent in Lotus to automatically export the emails to text. Is there a standard, best practices way to do this? I've created a LotusScript Agent that pretty much works. However, there is a bug - once the Body of the memo exceeds 32K characters, it starts inserting extra CR/LF pairs. I am using Lotus Notes 7.0.3. Here is my script: Sub Initialize On Error Goto ErrorCleanup Dim session As New NotesSession Dim db As NotesDatabase Dim doc As NotesDocument Dim uniqueID As Variant Dim curView As NotesView Dim docCount As Integer Dim notesInputFolder As String Dim notesValidOutputFolder As String Dim notesErrorOutputFolder As String Dim outputFolder As String Dim fileNum As Integer Dim bodyRichText As NotesRichTextItem Dim bodyUnformattedText As String Dim subjectText As NotesItem ''''''''''''''''''''''''''''''''''''''''''''''''''''''' 'INPUT OUTPUT LOCATIONS outputFolder = "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\" notesInputFolder = "IBEmails" notesValidOutputFolder = "IBEmailsDone" notesErrorOutputFolder="IBEmailsError" ''''''''''''''''''''''''''''''''''''''''''''''''''''''' Set db = session.CurrentDatabase Set curview = db.GetView(notesInputFolder ) docCount = curview.EntryCount Print "NUMBER OF DOCS " & docCount fileNum = 1 While (docCount > 0) 'set current doc to Set doc = curview.GetNthDocument(docCount) Set bodyRichText = doc.GetFirstItem( "Body" ) bodyUnformattedText = bodyRichText.GetUnformattedText() Set subjectText = doc.GetFirstItem("Subject") If subjectText.Text = "LotusAgentTest" Then uniqueID = Evaluate("@Unique") Open "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\email_" & uniqueID(0) & ".txt" For Output As fileNum Print #fileNum, "Subject:" & subjectText.Text Print #fileNum, "Date:" & Now Print #fileNum, bodyUnformattedText Close fileNum fileNum = fileNum + 1 Call doc.PutInFolder(notesValidOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End If doccount = doccount-1 Wend Exit Sub ErrorCleanup: Call sendErrorEmail(db,doc.GetItemValue("From")(0)) Call doc.PutInFolder(notesErrorOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End Sub Update Apparently the 32KB issue isn't consistent - so far, it's just one document that starts getting extra carriage returns after 32K.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Fck editor problem

    - by Josemalive
    Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

    Read the article

  • Detecting Xml namespace fast

    - by Anna Tjsoken
    Hello there, This may be a very trivial problem I'm trying to solve, but I'm sure there's a better way of doing it. So please go easy on me. I have a bunch of XSD files that are internal to our application, we have about 20-30 Xml files that implement datasets based off those XSDs. Some Xml files are small (<100Kb), others are about 3-4Mb with a few being over 10Mb. I need to find a way of working out what namespace these Xml files are in order to provide (something like) intellisense based off the XSD. The implementation of this is not an issue - another developer has written the code for this. But I'm not sure the best (and fastest!) way of detecting the namespace is without the use of XmlDocument (which does a full parse). I'm using C# 3.5 and the documents come through as a Stream (some are remote files). All the files are *.xml (I can detect if it was extension based) but unfortunately the Xml namespace is the only way. Right now I've tried XmlDocument but I've found it to be innefficient and slow as the larger documents are awaiting to be parsed (even the 100Kb docs). public string GetNamespaceForDocument(Stream document); Something like the above is my method signature - overloads include string for "content". Would a RegEx (compiled) pattern be good? How does Visual Studio manage this so efficiently? Another college has told me to find a fast Xml parser in C/C++, parse the content and have a stub that gives back the namespace as its slower in .NET, is this a good idea?

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • Space in Directory Parameter of svcutil.exe

    - by Drew Frisk
    I'm attempting to download metadata for a WCF service using svcutil but I'm running into issues with the /directory:< parameter. The directory I want to save to has a space in it: C:\Service References\Logging so when I execute /t:metadata I receive the following error: Error: The directory 'C:\Program Files (x86)\Microsoft SDKs\Windows\v8.0A\bin\NETFX 4.0 Tools\References\Logging' could not be found. Verify that the directory exists and that you have the appropriate permissions to read it. It looks to me like the space in "Service References" is causing the issue. From my understanding of command shell (which is very little) spaces act as delimiters for an executable. So I tried escaping the space with a carrot Service^ References and surrounding the path in double quotes "C:\Service References\Logging" but neither of those seem to be working, as the /directory: parameter doesn't recognize them as valid characters in the value. I haven't been able to find any direction in regards to this and svcutil, so I'm at a loss right now. I could download the files to a temp folder and then move them, but I would prefer not to take that approach. I would appreciate any direction that could be given on trying to resolve this. Thanks in advance.

    Read the article

  • Visual Studio 2005 - OleDbConnection throws "Invalid authorization specification" in Form Designer,

    - by Jason Dagit
    I have a form with an OleDbConnection object on it. This form fails to load in the Form Designer with the message: One or more errors encountered while loading the designer. The errors are listed below. Some errors can be fixed by rebuilding your project, while others may require code changes. Invalid authorization specification at ADODB.ConnectionClass.Open(String ConnectionString, String UserID, String Password, Int32 Options) ... (stack trace continues into user code) I've tracked this down to the OleDbConnection string. If I hardcode in the server IP, username/password/dbinstance into the constructor of the GUI form then the form will load in the designer. At run-time it is not an issue because we require the user to provide the login details. The question: Is it possible to use the OleDbConnection and the Form designer without supplying the database credentials in the source code of the form? For example, is there a property of the OleDbConnection or Form that I can set so that it doesn't need to access the database during Form design? My concern is that if we ever move the database server or change the login that the code will stop working in the designer.

    Read the article

  • CSS absolute DIV causing other absolute DIV problems

    - by Tim
    Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

    Read the article

  • JQUERY, AutoSuggest that doesn't kill the Server on ever keyup

    - by nobosh
    I'm working to build a JQUERY enabled AutoSuggest plugin, inspired by Apple's spotlight. Here is the general code: $(document).ready(function() { $('#q').bind('keyup', function() { if( $(this).val().length == 0) { // Hide the q-suggestions box $('#q-suggestions').fadeOut(); } else { // Show the AJAX Spinner $("#q").css("background-image","url(/images/ajax-loader.gif)"); $.ajax({ url: '/search/spotlight/', data: {"q": $(this).val()}, success: function(data) { $('#q-suggestions').fadeIn(); // Show the q-suggestions box $('#q-suggestions').html(data); // Fill the q-suggestions box // Hide the AJAX Spinner $("#q").css("background-image","url(/images/icon-search.gif)"); } }); } }); The issue I want to solve well & elegantly, is not killing the sever. Right now the code above hits the server every time you type a key and does not wait for you to essentially finish typing. What's the best way to solve this? A. Kill previous AJAX request? B. Some type of AJAX caching? C. Adding some type of delay to only submit .AJAX() when the person has stopped typing for 300ms or so? Thanks

    Read the article

  • SQL Stored Queries - use result of query as boolean based on existence of records

    - by Christian Mann
    Just getting into SQL stored queries right now... anyway, here's my database schema (simplified for YOUR convenience): member ------ id INT PK board ------ id INT PK officer ------ id INT PK If you're into OOP, Officer Inherits Board Inherits Member. In other words, if someone is listed on the officer table, s/he is listed on the board table and the member table. I want to find out the highest privilege level someone has. So far my SP looks like this: DELIMITER // CREATE PROCEDURE GetAuthLevel(IN targetID MEDIUMINT) BEGIN IF SELECT `id` FROM `member` WHERE `id` = targetID; THEN IF SELECT `id` FROM `board` WHERE `id` = targetID; THEN IF SELECT `id` FROM `officer` WHERE `id` = targetID; THEN RETURN 3; /*officer*/ ELSE RETURN 2; /*board member*/ ELSE RETURN 1; /*general member*/ ELSE RETURN 0; /*not a member*/ END // DELIMITER ; The exact text of the error is #1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'SELECT id FROM member WHERE id = targetID; THEN IF SEL' at line 4 I suspect the issue is in the arguments for the IF blocks. What I want to do is return true if the result-set is at least one -- i.e. the id was found in the table. Do any of you guys see anything to do here, or should I reconsider my database design into this:? person ------ id INT PK level SMALLINT

    Read the article

  • Using both chunked transfer encoding and gzip

    - by RadiantHeart
    I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

    Read the article

  • Including variables inside curly braces in a Zend config ini file on Linux

    - by Dave Morris
    I am trying to include a variable in a .ini file setting by surrounding it with curly braces, and Zend is complaining that it cannot parse it properly on Linux. It works properly on Windows, though: welcome_message = Welcome, {0}. This is the error that is being thrown on Linux: : Uncaught exception 'Zend_Config_Exception' with message 'Error parsing /var/www/html/portal/application/configs/language/messages.ini on line 10 ' in /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php:181 Stack trace: 0 /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php(201): Zend_Config_Ini-&gt;_parseIniFile('/var/www/html/p...') 1 /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php(125): Zend_Config_Ini-&gt;_loadIniFile('/var/www/html/p...') 2 /var/www/html/portal/library/Ingrain/Language/Base.php(49): Zend_Config_Ini-&gt;__construct('/var/www/html/p...', NULL) 3 /var/www/html/portal/library/Ingrain/Language/Base.php(23): Ingrain_Language_Base-&gt;setConfig('messages.ini', NULL, NULL) 4 /var/www/html/portal/library/Ingrain/Language/Messages.php(7): Ingrain_Language_Base-&gt;__construct('messages.ini', NULL, NULL, NULL) 5 /var/www/html/portal/library/Ingrain/Helper/Language.php(38): Ingrain_Language_Messages-&gt;__construct() 6 /usr/local/zend/share/ZendFramework/library/Zend/Contr in We are able to get the error to go away on Linux if we surround the braces with quotes, but that seems like a strange solution: welcome_message = Welcome, "{"0"}". Is there a better way to solve this issue for all platforms? Thanks for your help, Dave

    Read the article

  • How to invalidate layout of listbox from custom children

    - by Stephen Price
    I have a custom panel for a listbox <ItemsPanelTemplate x:Key="FloatPanelTemplate"> <Controls:FloatPanel x:Name="CardPanel" /> </ItemsPanelTemplate> The panel lays out its children using its X and Y dependency properties. This all works nicely when the FloatPanel is used by itself - I'm using FrameworkPropertyMetadataOptions.AffectsArrange | FrameworkPropertyMetadataOptions.AffectsMeasure on the dependency properties of the child items to tell the FloatPanel to redraw its layout. When I use it in a Listbox (code above) then it draws fine the first time, but when I drag the children (which modifies the item's X and Y) it is not notifying the Listbox that it needs to redraw the FloatPanel's children. I think the issue is related to the fact that each item in the bound collection is wrapped with a ListBoxItem. Hopefully I've described what i'm doing well enough that someone can tell me how to make the panel (or its children) tell it needs to do the Layout routines again. As I said it works once (initial draw) but then dragging items doesn't work (Listbox isnt aware that its children have changed and needs to relayout.) If I drag an item and then resize the window, the listbox does a layout and the items are drawn in their new locations. How do I notify the ListBox (or more importantly the FloatPanel in the ItemsPanelTemplate) that it needs to do a Layout pass?

    Read the article

  • Windows update breaks dlls?

    - by shoosh
    I'm compiling a project which uses multiple DLL and compiles with VS2008. After a recent windows update DLLs compiled on my computer stopped working on other computers. After some investigation it turned out that it updated the CRT redistributable library which I'm compiling with from version "9.0.21022.8" to version "9.0.30729.4148" This is evident from the Manifest file of the EXE i'm compiling. it contains the following: <dependency> <dependentAssembly> <assemblyIdentity type="win32" name="Microsoft.VC90.CRT" version="9.0.21022.8" processorArchitecture="amd64" publicKeyToken="1fc8b3b9a1e18e3b"></assemblyIdentity> </dependentAssembly> </dependency> <dependency> <dependentAssembly> <assemblyIdentity type="win32" name="Microsoft.VC90.CRT" version="9.0.30729.4148" processorArchitecture="amd64" publicKeyToken="1fc8b3b9a1e18e3b"></assemblyIdentity> </dependentAssembly> </dependency> Meaning it wants to use two different versions of the CRT at the same time. the second version is needed by the code which I'm compiling right now and the first version is needed by older dlls which were compiled a few weeks ago. In the computers where the application is deployed this becomes a problem since they get their CRT dll from a local folder called Microsoft.VC90.CRT and not from WinSXS. This folder can't contain two different versions of the dll. Is there a known solution to this issue or do I need to start compiling all of the other DLLs with the new CRT?

    Read the article

< Previous Page | 763 764 765 766 767 768 769 770 771 772 773 774  | Next Page >