Search Results

Search found 23890 results on 956 pages for 'issue'.

Page 766/956 | < Previous Page | 762 763 764 765 766 767 768 769 770 771 772 773  | Next Page >

• rails test.log is always empty

  - by Raiden

  All the log entries generated when running tests with 'rake' are written to my development.log instead of test.log file Do I have to explicitly enable logging for test in enviornments/test.config?? (I'm using 'turn' gem to format test output, Can that cause an issue?) I'm running rails 2.3.5, ruby 1.8.7 I've all these gems installed for RAILS_ENV=test. Any help is appreciated. -[I] less -[I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] mutter = 0.4.2 - [I] mysql - [I] authlogic - [R] activesupport - [I] turn - [I] ansi = 1.1.0 - [I] facets = 2.8.0 - [I] rspec = 1.2.0 - [I] rspec-rails = 1.2.0 - [I] rspec = 1.3.0 - [R] rack = 1.0.0 - [I] webrat = 0.4.3 - [I] nokogiri = 1.2.0 - [R] rack = 1.0 - [I] rack-test = 0.5.3 - [R] rack = 1.0 - [I] cucumber = 0.2.2 - [I] term-ansicolor = 1.0.4 - [I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] polyglot = 0.2.9 - [R] builder = 2.1.2 - [I] diff-lcs = 1.1.2 - [R] json_pure = 1.2.0 - [I] cucumber-rails - [I] cucumber = 0.6.2 - [I] term-ansicolor = 1.0.4 - [I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] polyglot = 0.2.9 - [R] builder = 2.1.2 - [I] diff-lcs = 1.1.2 - [R] json_pure = 1.2.0 - [I] database_cleaner = 0.2.3 - [I] launchy - [R] rake = 0.8.1 - [I] configuration = 0.0.5 - [I] faker - [I] populator - [R] flog = 2.1.0 - [R] flay - [I] rcov - [I] reek - [R] ruby_parser ~ 2.0 - [I] ruby2ruby ~ 1.2 - [R] sexp_processor ~ 3.0 - [R] ruby_parser ~ 2.0 - [R] sexp_processor ~ 3.0 - [I] roodi - [R] ruby_parser - [I] gruff - [I] rmagick - [I] ruby-prof - [R] jscruggs-metric_fu = 1.1.5 - [I] factory_girl - [I] notahat-machinist

  Read the article

• Fck editor problem

  - by Josemalive

  Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

  Read the article

• Scheme Infix to Postfix

  - by Cody

  Let me establish that this is part of a class assignment, so I'm definitely not looking for a complete code answer. Essentially we need to write a converter in Scheme that takes a list representing a mathematical equation in infix format and then output a list with the equation in postfix format. We've been provided with the algorithm to do so, simple enough. The issue is that there is a restriction against using any of the available imperative language features. I can't figure out how to do this in a purely functional manner. This is our fist introduction to functional programming in my program. I know I'm going to be using recursion to iterate over the list of items in the infix expression like such. (define (itp ifExpr) ( ; do some processing using cond statement (itp (cdr ifExpr)) )) I have all of the processing implemented (at least as best I can without knowing how to do the rest) but the algorithm I'm using to implement this requires that operators be pushed onto a stack and used later. My question is how do I implement a stack in this function that is available to all of the recursive calls as well?

  Read the article

• Java Runtime command line Process

  - by AEIOU

  I have a class with the following code: Process process = null; try { process = Runtime.getRuntime().exec("gs -version"); System.out.println(process.toString()); } catch (Exception e1) { e1.printStackTrace(); } finally { process.destroy(); } I can run "gs -version" on my command line and get: GPL Ghostscript 8.71 (2010-02-10) Copyright (C) 2010 Artifex Software, Inc. All rights reserved. So I know I have the path at least set somewhere. I can run that class from command line and it works. But when I run it using eclipse I get the following error: java.io.IOException: Cannot run program "gs": error=2, No such file or directory at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at java.lang.Runtime.exec(Runtime.java:431) at java.lang.Runtime.exec(Runtime.java:328) at clris.batchdownloader.TestJDBC.main(TestJDBC.java:17) Caused by: java.io.IOException: error=2, No such file or directory at java.lang.UNIXProcess.forkAndExec(Native Method) at java.lang.UNIXProcess.(UNIXProcess.java:53) at java.lang.ProcessImpl.start(ProcessImpl.java:91) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 4 more In my program, i can replace "gs" with: "java", "mvn", "svn" and it works. But "gs" does not. It's only in eclipse I have this problem. Any ideas, on what I need to do to resolve this issue?

  Read the article

• Application get crash while using NSAutoreleasepool inside MKMapview regionDidChangeAnimated method

  - by Ram

  Hi, i am working on a map application, in that i like to drop the pins (as in Zillow apps) when ever user change the map view. I am using following code code. i am try to load the xml data from server using NSAutoreleasepool to do the xml parsing in the background thread. (void)mapView:(MKMapView *)mapView regionDidChangeAnimated:(BOOL)animated{ NSLog(@"inside region did changed "); urlString =[NSString stringWithFormat: @"http://asdfasdasdf.com/asdfasdf/mapxml.php]; [stories1 release]; [mapview removeAnnotations:eventPoints1]; eventPoints1 = [[NSMutableArray array] retain]; [self performSelectorInBackground:@selector(callParsing) withObject:nil]; } -(void)callParsing{ NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; [self parseXMLFileAtURL:urlString]; [self performSelectorOnMainThread:@selector(droppingPin) withObject:nil waitUntilDone:YES]; [pool drain]; } The above code is working fine, but once i changed the mapview, the appllication get crashed. Anyone can help me to fix the issue? thanks in advance.

  Read the article

• WCF - remote service without using IIS - base address?

  - by Mark Pim

  I'm trying to get my head around the addressing of WCF services. We have a client-server setup where the server occasionally (maybe once a day) needs to push data to each client. I want to have a lightweight WCF listener service on each client hosted in an NT service to receive that data. We already have such an NT service setup hosting some local WCF services for other tasks so the overhead of this is minimal. Because of existing legacy code on the server I believe the service needs to be exposed as ASMX and use basicHttpBinding to allow it to connect. Each client is registered on the server by the user (they need to configure them individually) so discovery is not the issue. My question is, how does the addressing work? I imagine the user entering the client's address on the server in the form http://0.0.0.0/MyService or even http://hostname/MyService If so, how do I configure the client service in its App.config? Do I use localhost? If not then what is the reccommended way of exposing the service to the server? Note: I don't want to host in IIS as that adds extra requirements to the hardware required for the client. The clients will be almost certainly located on LANs, not over the public internet

  Read the article

• Circle drawing with SVG's arc path

  - by ????

  The following SVG path can draw 99.99% of a circle: (try it on http://jsfiddle.net/DFhUF/46/ and see if you see 4 arcs or only 2, but note that if it is IE, it is rendered in VML, not SVG, but have the similar issue) M 100 100 a 50 50 0 1 0 0.00001 0 But when it is 99.99999999% of a circle, then nothing will show at all? M 100 800 a 50 50 0 1 0 0.00000001 0 And that's the same with 100% of a circle (it is still an arc, isn't it, just a very complete arc) M 100 800 a 50 50 0 1 0 0 0 How can that be fixed? The reason is I use a function to draw a percentage of an arc, and if I need to "special case" a 99.9999% or 100% arc to use the circle function, that'd be kind of silly. Again, a test case on jsfiddle using RaphaelJS is at http://jsfiddle.net/DFhUF/46/ (and if it is VML on IE 8, even the second circle won't show... you have to change it to 0.01) Update: This is because I am rendering an arc for a score in our system, so 3.3 points get 1/3 of a circle. 0.5 gets half a circle, and 9.9 points get 99% of a circle. But what if there are scores that are 9.99 in our system? Do I have to check whether it is close to 99.999% of a circle, and use an arc function or a circle function accordingly? Then what about a score of 9.9987? Which one to use? It is ridiculous to need to know what kind of scores will map to a "too complete circle" and switch to a circle function, and when it is "a certain 99.9%" of a circle or a 9.9987 score, then use the arc function.

  Read the article

• vestal_versions : problem with column named changes

  - by arkannia

  Hi, I am working with vestal version for 2 months. Everything was fine until this afternoon. I didn't done anything special(or i don't remembered...) but the code works fine on others computers... The problem is that i'm not able to save my model anymore: rails give me this error : ActiveRecord::DangerousAttributeError: changes is defined by ActiveRecord changes field is by default an activerecord method. With the console, the message is the next : ActiveRecord::DangerousAttributeError: changes is defined by ActiveRecord Here are my local gem files: abstract (1.0.0) actionmailer (3.0.0.beta3) actionpack (3.0.0.beta3) activemodel (3.0.0.beta3) activerecord (3.0.0.beta3) activeresource (3.0.0.beta3) activesupport (3.0.0.beta3) arel (0.3.3) builder (2.1.2) bundler (0.9.25, 0.9.24) crack (0.1.7) erubis (2.6.5) god (0.9.0) haml (3.0.1, 2.2.23) i18n (0.3.7) mail (2.2.0) memcache-client (1.8.3) memcached (0.17.7) mime-types (1.16) polyglot (0.3.1) rack (1.1.0) rack-mount (0.6.3) rack-test (0.5.3) rails (3.0.0.beta3) railties (3.0.0.beta3) rake (0.8.7) savon (0.7.8, 0.7.6) text-format (1.0.0) text-hyphen (1.0.0) thor (0.13.6, 0.13.4) treetop (1.4.5) tzinfo (0.3.20) And here my Gemfile source 'http://gemcutter.org' gem "rails", "3.0.0.beta3" gem "will_paginate", "3.0.pre" #gem 'nokogiri' #gem 'curb' #gem 'handsoap' gem 'savon' gem 'mysql' gem 'haml', '2.2.23' #gem 'haml', '3.0.1' gem 'hpricot' gem 'i18n', '> 0.3.5' gem 'i18n_routing' gem 'i18n_auto_scoping' gem 'handler301', :git => 'http://github.com/kwi/handler301.git' gem 'seo_meta_builder' gem 'vestal_versions' #gem 'paperclip', :git => 'git://github.com/thoughtbot/paperclip.git', :branch => 'rails3' ## Bundle edge rails: gem "rails", :git => "git://github.com/rails/rails.git" ## Bundle the gems you use: # gem "bj" # gem "hpricot", "0.6" # gem "sqlite3-ruby", :require => "sqlite3" # gem "aws-s3", :require => "aws/s3" ## Bundle gems used only in certain environments: # gem "rspec", :group => :test # group :test do # gem "webrat" # end If you have any suggestions to solve this issue, i'll be glad to hear them ! Thanks

  Read the article

• python: how to design a container with elements that must reference their container

  - by Luke404

  (the title is admittedly not that great. Please forgive my English, this is the best I could think of) I'm writing a python script that will manage email domains and their accounts, and I'm also a newby at OOP design. My two (related?) issues are: the Domain class must do special work to add and remove accounts, like adding/removing them to the underlying implementation how to manage operations on accounts that must go through their container To solve the former issue I'd add a factory method to the Domain class that'll build an Account instance in that domain, and a 'remove' (anti-factory?) method to handle deletions. For the latter this seems to me "anti-oop" since what would logically be an operation on an Account (eg, change password) must always reference the containing Domain. Seems to me that I must add to the Account a reference back to the Domain and use that to get data (like the domain name) or call methods on the Domain class. Code example (element uses data from the container) that manages an underlying Vpopmail system: class Account: def __init__(self, name, password, domain): self.name = name self.password = password self.domain = domain def set_password(self, password): os.system('vpasswd %s@%s %s' % (self.name, self.domain.name, password) self.password = password class Domain: def __init__(self, domain_name): self.name = domain_name self.accounts = {} def create_account(self, name, password): os.system('vadduser %s@%s %s' % (name, self.name, password)) account = Account(name, password, self) self.accounts[name] = account def delete_account(self, name): os.system('vdeluser %s@%s' % (name, self.name)) del self.accounts[name] another option would be for Account.set_password to call a Domain method that would do the actual work - sounds equally ugly to me. Also note the duplication of data (account name also as dict key), it sounds logical (account names are "primary key" inside a domain) but accounts need to know their own name.

  Read the article

• WCF: How can I send data while gracefully closing a connection?

  - by mafutrct

  I've got a WCF service that offers a Login method. A client is required to call this method (due to it being the only IsInitiating=true). This method should return a string that describes the success of the call in any case. If the login failed, the connection should be closed. The issue is with the timing of the close. I'd like to send the return value, then immediately close the connection. string Login (string name, string pass) { if (name != pass) { OperationContext.Current.Channel.Close (); return "fail"; } else { return "yay"; } } The MSDN states that calling Close on the channel causes an ICommunicationObject to gracefully transition from the Opened state to the Closed state. The Close method allows any unfinished work to be completed before returning. For example, finish sending any buffered messages). This did not work for me (or my understanding is wrong), as the close is executed immediately - WCF does not wait for the Login method to finish executing and return a string but closes the connection earlier. Therefore I assume that calling Close does not wait for the running method to finish. Now, how can I still return a value, then close?

  Read the article

• destroy cfwindow in javascript 'is not a function'

  - by Ryan French

  Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

  Read the article

• What is the Best way to databind an ASP.NET TreeView for table with many to many parent child relati

  - by Matt W

  I've got a table which has the usual ParentID, ChildID as it's first two columns in a self-referencing tree data structure. My issue is that when I pull this out and use the following code: DataSet set = DA.GetNewCategories(); set.Relations.Add( new DataRelation("parentChildCategories", set.Tables[0].Columns["CategoryParentID"], set.Tables[0].Columns["CategoryID"]) ); StringBuilder buildXml = new StringBuilder(); StringWriter writer = new StringWriter(buildXml); set.WriteXml(writer); TreeView2.DataSource = new HierarchicalDataSet(set, "CategoryID", "CategoryParentID"); TreeView2.DataBind(); I get the error: These columns don't currently have unique values I believe this is because my data has children with multiple parent nodes. This is fine for my application - I don't mind if one row of data is rendered in multiple nodes of my TreeView. Could someone shed light on this please? It doesn't seem unreasonable to have a DataSet render XML which has nodes appearing in multiple places, but I can't figure out how to do it. Thanks, Matt.

  Read the article

• Display ñ on a C# .NET application

  - by mmr

  I have a localization issue. One of my industrious coworkers has replaced all the strings throughout our application with constants that are contained in a dictionary. That dictionary gets various strings placed in it once the user selects a language (English by default, but target languages are German, Spanish, French, Portuguese, Mandarin, and Thai). For our test of this functionality, we wanted to change a button to include text which has a ñ character, which appears both in Spanish and in the Arial Unicode MS font (which we're using throughout the application). Problem is, the ñ is appearing as a square block, as if the program did not know how to display it. When I debug into that particular string being read from disk, the debugger reports that character as a square block as well. So where is the failure? I think it could be in a few places: 1) Notepad may not be unicode aware, so the ñ displayed there is not the same as what vs2008 expects, and so the program interprets the character as a square (EDIT: notepad shows the same characters as vs; ie, they both show the ñ. In the same place.). 2) vs2008 can't handle ñ. I find that very, very hard to believe. 3) The text is read in properly, but the default font for vs2008 can't display it, which is why the debugger shows a square. 4) The text is not read in properly, and I should use something other than a regular StreamReader to get strings. 5) The text is read in properly, but the default String class in C# doesn't handle ñ well. I find that very, very hard to believe. 6) The version of Arial Unicode MS I have doesn't have ñ, despite it being listed as one of the 50k characters by http://www.fileinfo.info. Anything else I could have left out? Thanks for any help!

  Read the article

• segmentation fault on Unix - possible stack corruption

  - by bob

  hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

  Read the article

• How to figure out what error my Java Eclipse project has?

  - by Greg Mattes

  I've created a Java project from existing source with an Ant build script in Eclipse. I cannot run my project because Eclipse tells me that there is at least one error in it. Now, I know that the project runs fine on the command line, so I suspect an Eclipse configuration error. As far as I can tell, the only feedback that I have from Eclipse is a little red X on my project in the Package Explorer window and dialog window when I try to run the project says there are errors in the project This is all wonderful, but what is the error? Is there a "show me the next error" button somewhere? In the past, on other Eclipse projects, I've notice other little red X's on folders containing source files with errors, the little red X's appear on the source files as well. I scanned (manually) through all of the source files and I haven't found any other red X's (again, where is the "next error" button?). If I select the "Proceed" button I am greeted with a java.lang.NoClassDefFoundError for my main class, which makes me suspect a classpath issue. I've checked the classpath, and I'm fairly certain that it's correct. Is there a way to see the exact jvm command line that Eclipse is invoking? I realize that it might be invoking the JVM programmatically, and not on a "real" command line. In any case, is there a way, other than the run configuration dialog, to see what is actually happening when I hit the "Proceed" button?

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Good resources for building web-app in Tapestry

  - by Rich

  Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

  Read the article

• Amazon S3 and swfaddress

  - by justinbach

  I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

  Read the article

• JVM segmentation faults due to "Invalid memory access of location"

  - by Dan

  I have a small project written in Scala 2.9.2 with unit tests written using ScalaTest. I use SBT for compiling and running my tests. Running sbt test on my project makes the JVM segfault regularly, but just compiling and running my project from SBT works fine. Here is the exact error message: Invalid memory access of location 0x8 rip=0x10959f3c9 [1] 11925 segmentation fault sbt I cannot locate a core dump anywhere, but would be happy to provide it if it can be obtained. Running java -version results in this: java version "1.6.0_37" Java(TM) SE Runtime Environment (build 1.6.0_37-b06-434-11M3909) Java HotSpot(TM) 64-Bit Server VM (build 20.12-b01-434, mixed mode) But I've also got Java 7 installed (though I was never able to actually run a Java program with it, afaik). Another issue that may be related: some of my test cases contain titles including parentheses like ( and ). SBT or ScalaTest (not sure) will consequently insert square parens in the middle of the output. For example, a test case with the name (..)..(..) might suddenly look like (..[)..](..). Any help resolving these issues is much appreciated :-) EDIT: I installed the Java 7 JDK, so now java -version shows the right thing: java version "1.7.0_07" Java(TM) SE Runtime Environment (build 1.7.0_07-b10) Java HotSpot(TM) 64-Bit Server VM (build 23.3-b01, mixed mode) This also means that I now get a more detailed segfault error and a core dump: # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x000000010a71a3e3, pid=16830, tid=19459 # # JRE version: 7.0_07-b10 # Java VM: Java HotSpot(TM) 64-Bit Server VM (23.3-b01 mixed mode bsd-amd64 compressed oops) # Problematic frame: # V [libjvm.dylib+0x3cd3e3] And the dump.

  Read the article

• Free solution for automatic updates with a .NET/C# app?

  - by a2h

  Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

  Read the article

• CSS absolute DIV causing other absolute DIV problems

  - by Tim

  Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

  Read the article

• Using both chunked transfer encoding and gzip

  - by RadiantHeart

  I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

  Read the article

• AsyncTask and Contexts

  - by Michael

  So I'm working out my first multi-threaded application using Android with the AsyncTask class. I'm trying to use it to fire off a Geocoder in a second thread, then update the UI with onPostExecute, but I keep running into an issue with the proper Context. I kind of hobbled my way through using Contexts on the main thread, but I'm not exactly sure what the Context is or how to use it on background threads, and I haven't found any good examples on it. Any help? Here is an excerpt of what I'm trying to do: public class GeoCode extends AsyncTask<GeoThread, Void, GeoThread> { @Override protected GeoThread doInBackground(GeoThread... i) { List<Address> addresses = null; Geocoder geoCode = null; geoCode = new Geocoder(null); //Expects at minimum Geocoder(Context context); addresses = geoCode.getFromLocation(GoldenHour.lat, GoldenHour.lng, 1); } } It keeps failing at the sixth line there, because of the improper Context.

  Read the article

• Backbone Model fetched from Lithium controller is not loaded properly in bb Model

  - by Nilesh Kale

  I'm using backbone.js and Lithium. I'm fetching a model from the server by passing in a _id that is received as a hidden parameter on the page. The database MongoDB has stored the data correctly and can be viewed from console as: { "_id" : ObjectId("50bb82694fbe3de417000001"), "holiday_name" : "SHREE15", "description": "", "star_rating" : "3", "holiday_type" : "family", "rooms" : "1", "adults" : "2", "child" :"0", "emails" : "" } The Lithium Model class is so: class Holidays extends \lithium\data\Model { public $validates = array( 'holiday_name' => array( array( 'notEmpty', 'required' => true, 'message' => 'Please key-in a holiday name! (eg. Family trip for summer holidays)' ))); } The backbone Holiday model is so: window.app.IHoliday = Backbone.Model.extend({ urlRoot: HOLIDAY_URL, idAttribute: "_id", id: "_id", // Default attributes for the holiday. defaults: { }, // Ensure that each todo created has `title`. initialize: function(props) { }, The code for backbone/fetch is: var Holiday = new window.app.IHoliday({ _id: holiday_id }); Holiday.fetch( { success: function(){ alert('Holiday fetched:' + JSON.stringify(Holiday)); console.log('HOLIDAY Fetched: \n' + JSON.stringify(Holiday)); console.log('Holiday name:' + Holiday.get('holiday_name')); } } ); Lithium Controller Code is: public function load($holiday_id) { $Holiday = Holidays::find($holiday_id); return compact('Holiday'); } PROBLEM: The output of the backbone model fetched from server is as below and the Holiday model is not correctly 'formed' when data returns into backbone Model: HOLIDAY Fetched: {"_id":"50bb82694fbe3de417000001","Holiday":{"_id":"50bb82694fbe3de417000001","holiday_name":"SHREE15","description":"","star_rating":"3","holiday_type":"family","rooms":"1","adults":"2","child":"0","emails":""}} iplann...view.js (line 68) Holiday name:undefined Clearly there is some issue when the data is passed/translated from Lithium and loaded up as a model into backbone Holiday model. Is there something very obviously wrong in my code?

  Read the article

• CURL & web.py: transfer closed with outstanding read data remaining

  - by Richard J

  Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

  Read the article

< Previous Page | 762 763 764 765 766 767 768 769 770 771 772 773  | Next Page >