Search Results

Search found 21343 results on 854 pages for 'pass by reference'.

Page 793/854 | < Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >

• How to handle environment-specific application configuration organization-wide?

  - by Stuart Lange

  Problem Your organization has many separate applications, some of which interact with each other (to form "systems"). You need to deploy these applications to separate environments to facilitate staged testing (for example, DEV, QA, UAT, PROD). A given application needs to be configured slightly differently in each environment (each environment has a separate database, for example). You want this re-configuration to be handled by some sort of automated mechanism so that your release managers don't have to manually configure each application every time it is deployed to a different environment. Desired Features I would like to design an organization-wide configuration solution with the following properties (ideally): Supports "one click" deployments (only the environment needs to be specified, and no manual re-configuration during/after deployment should be necessary). There should be a single "system of record" where a shared environment-dependent property is specified (such as a database connection string that is shared by many applications). Supports re-configuration of deployed applications (in the event that an environment-specific property needs to change), ideally without requiring a re-deployment of the application. Allows an application to be run on the same machine, but in different environments (run a PROD instance and a DEV instance simultaneously). Possible Solutions I see two basic directions in which a solution could go: Make all applications "environment aware". You would pass the environment name (DEV, QA, etc) at the command line to the app, and then the app is "smart" enough to figure out the environment-specific configuration values at run-time. The app could fetch the values from flat files deployed along with the app, or from a central configuration service. Applications are not "smart" as they are in #1, and simply fetch configuration by property name from config files deployed with the app. The values of these properties are injected into the config files at deploy-time by the install program/script. That install script takes the environment name and fetches all relevant configuration values from a central configuration service. Question How would/have you achieved a configuration solution that solves these problems and supports these desired features? Am I on target with the two possible solutions? Do you have a preference between those solutions? Also, please feel free to tell me that I'm thinking about the problem all wrong. Any feedback would be greatly appreciated.

  Read the article

• Few doubts regarding Bitmaps , Images & `using` blocks

  - by imageWorker

  I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

  Read the article

• Do You Really Know Your Programming Languages?

  - by Kristopher Johnson

  I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

  Read the article

• .Net Remote Log Querying

  - by jlafay

  I have a Win Service that I'm working on that consists of the service, WF Service (using WorkflowServiceHost), a Workflow (WorkflowApplication) that queries/processes data from a SQL Server DB, and a Comm Marshall class that handles data flow between the service and the WF. The WF does a lot of heavy data processing and the original app (early VB6) logged all the processing and displayed the results on the screen of the host machine. Critical events will be committed to eventlog because I strongly believe that should be common practice because admins naturally will look there and because it already has support for remote viewing. The workflow will also need to write logging events as it processes and iterates according to our business logic. Such as: records queried, records returned, processed records, etc. The data is very critical and we need to log actions as they occur. The logs are currently kept as text files on disk and I think that is ok. Ideally I would like to record log events in XML so it's easier to query and because it is less costly than a DB, especially since our DB servers do a lot of heavy processing anyways. Since we are replacing essentially a VB6 application with a robust windows service (taking advantage of WF 4.0), it has been requested that a remote client also be created. It receives callbacks from the service after subscribing to it and being added to a collection of subscribers. Basic statistics and summaries are updated client side after receiving basic monitoring data of what is going on with the service. We would like to also provide a way to provide details when we need to examine what is going on further because this is a long running data processing service and issues need to be addressed immediately. What is the best way to implement some type of query from the client that is sent to the service and returned to the client? Would it be efficient to implement another method to expose on the service and then have that pass that off to some querying class/object to examine the XML files by whichever specification and then return it to the client? That's the main concern. I don't want the service to processing to bottleneck much while this occurs. It seems that WF already auto-magically threads well for the most part but I want to make sure this is the right way to go about it. Any suggestions/recommendations on how to architect and implement a small log querying framework for a remote service would be awesome.

  Read the article

• OpenGL ES functions not accepting values originating outside of it's view

  - by Josh Elsasser

  I've been unable to figure this out on my own. I currently have an Open GLES setup where a view controller both updates a game world (with a dt), fetches the data I need to render, passes it off to an EAGLView through two structures (built of Apple's ES1Renderer), and draws the scene. Whenever a value originates outside of the Open GL view, it can't be used to either translate objects using glTranslatef, or set up the scene using glOrthof. If I assign a new value to something, it will work - even if it is the exact same number. The two structures I have each contain a variety of floating-point numbers and booleans, along with two arrays. I can log the values from within my renderer - they make it there - but I receive errors from OpenGL if I try to do anything with them. No crashes result, but the glOrthof call doesn't work if I don't set the camera values to anything different. Code used to set up scene: [EAGLContext setCurrentContext:context]; glBindFramebufferOES(GL_FRAMEBUFFER_OES, viewFramebuffer); //clears the color buffer bit glClear(GL_COLOR_BUFFER_BIT); glMatrixMode(GL_PROJECTION); //sets up the scene w/ ortho projection glViewport(0, 0, 320, 480); glLoadIdentity(); glOrthof(320, 0, dynamicData.cam_x2, dynamicData.cam_x1, 1.0, -1.0); glClearColor(1.0, 1.0, 1.0, 1.0); /*error checking code here*/ "dynamicData" (which is replaced every frame) is created within my game simulation. From within my controller, I call a method (w/in my simulation) that returns it, and pass the result on to the EAGLView, which passes it on to the renderer. I haven't been able to come up with a better solution for this - suggestions in this regard would be greatly appreciated as well. Also, this function doesn't work as well (values originate in the same place): glTranslatef(dynamicData.ship_x, dynamicData.ship_y, 0.0); Thanks in advance. Additional Definitions: Structure (declared in a separate header): typedef struct { float ship_x, ship_y; float cam_x1, cam_x2; } dynamicRenderData; Render data getter (and builder) (every frame) - (dynamicData)getDynRenderData { //d_rd is an ivar, zeroed on initialization d_rd.ship_x = mainShip.position.x; d_rd.ship_y = mainShip.position.y; d_rd.cam_x1 = d_rd.ship_x - 30.0f; d_rd.cam_x2 = d_rd.cam_x1 + 480.0f; return d_rd; } Zeroed at start. (d_rd.ship_x = 0;, etc…) Setting up the view. Prototype (GLView): - (void)draw: (dynamicRenderData)dynamicData Prototype (Renderer): - (void)drawView: (dynamicRenderData)dynamicData How it's called w/in the controller: //controller [glview draw: [world getDynRenderData]]; //glview (within draw) [renderer drawView: dynamicData];

  Read the article

• Need Google Map InfoWindow Hyperlink to Open Content in Overlay (Fusion Table Usage)

  - by McKev

  I have the following code established to render the map in my site. When the map is clicked, the info window pops up with a bunch of content including a hyperlink to open up a website with a form in it. I would like to utilize a function like fancybox to open up this link "form" in an overlay. I have read that fancybox doesn't support calling the function from within an iframe, and was wondering if there was a way to pass the link data to the DOM and trigger the fancybox (or another overlay option) in another way? Maybe a callback trick - any tips would be much appreciated! <style> #map-canvas { width:850px; height:600px; } </style> <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=true"></script> <script src="http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/src/fusiontips.js" type="text/javascript"></script> <script type="text/javascript"> var map; var tableid = "1nDFsxuYxr54viD_fuH7fGm1QRZRdcxFKbSwwRjk"; var layer; var initialLocation; var browserSupportFlag = new Boolean(); var uscenter = new google.maps.LatLng(37.6970, -91.8096); function initialize() { map = new google.maps.Map(document.getElementById('map-canvas'), { zoom: 4, mapTypeId: google.maps.MapTypeId.ROADMAP }); layer = new google.maps.FusionTablesLayer({ query: { select: "'Geometry'", from: tableid }, map: map }); //http://gmaps-utility-gis.googlecode.com/svn/trunk/fusiontips/docs/reference.html layer.enableMapTips({ select: "'Contact Name','Contact Title','Contact Location','Contact Phone'", from: tableid, geometryColumn: 'Geometry', suppressMapTips: false, delay: 500, tolerance: 8 }); ; // Try W3C Geolocation (Preferred) if(navigator.geolocation) { browserSupportFlag = true; navigator.geolocation.getCurrentPosition(function(position) { initialLocation = new google.maps.LatLng(position.coords.latitude,position.coords.longitude); map.setCenter(initialLocation); //Custom Marker var pinColor = "A83C0A"; var pinImage = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_letter&chld=%E2%80%A2|" + pinColor, new google.maps.Size(21, 34), new google.maps.Point(0,0), new google.maps.Point(10, 34)); var pinShadow = new google.maps.MarkerImage("http://chart.apis.google.com/chart?chst=d_map_pin_shadow", new google.maps.Size(40, 37), new google.maps.Point(0, 0), new google.maps.Point(12, 35)); new google.maps.Marker({ position: initialLocation, map: map, icon: pinImage, shadow: pinShadow }); }, function() { handleNoGeolocation(browserSupportFlag); }); } // Browser doesn't support Geolocation else { browserSupportFlag = false; handleNoGeolocation(browserSupportFlag); } function handleNoGeolocation(errorFlag) { if (errorFlag == true) { //Geolocation service failed initialLocation = uscenter; } else { //Browser doesn't support geolocation initialLocation = uscenter; } map.setCenter(initialLocation); } } google.maps.event.addDomListener(window, 'load', initialize); </script>

  Read the article

• Java - is this an idiom or pattern, behavior classes with no state

  - by Berlin Brown

  I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

  Read the article

• Can't access font resource in Silverlight class library

  - by Matt

  I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

  Read the article

• Opinions on collision detection objects with a moving scene

  - by Evan Teran

  So my question is simple, and I guess it boils down to how anal you want to be about collision detection. To keep things simple, lets assume we're talking about 2D sprites defined by a bounding box. In addition, let's assume that my sprite object has a function to detect collisions like this: S.collidesWith(other); Finally the scene is moving and "walls" in the scene can move, an object may not touch a wall. So a simple implementation might look like this (psuedo code): moveWalls(); moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } The problem with this is that if the sprite and wall move towards each other, depending on the circumstances (such as diagonal moment). They may pass though each other (unlikely but could happen). So I may do this instead. moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } This takes care of the passing through each other issue, but another rare issue comes up. If they are adjacent to each other (literally the next pixel) and both the wall and the sprite are moving left, then I will get an invalid collision since the wall moves, checks for collision (hit) then the sprite is moved. Which seems unfair. In addition, to that, the redundant collision detection feels very inefficient. I could give the player movement priority alleviating the first issue but it is still checking twice. moveSprite(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } moveWalls(); foreach(wall as w) { if(s.collidesWith(w)) { gameover(); } } Am I simply over thinking this issue, should this just be chalked up to "it'll happen rare enough that no one will care"? Certainly looking at old sprite based games, I often find situations where the collision detection has subtle flaws, but I figure by now we can do better :-P. What are people's thoughts?

  Read the article

• Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

  - by Ted

  There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

  Read the article

• Stubbing a before_filter with RSpec

  - by TheDelChop

  Guys, I'm having trouble understanding why I can't seem to stub this controller method :load_user, since all of my tests fail if I change the actual implementation of :load_user to not return and instance of @user. Can anybody see why my stub (controller.stub!(:load_user).and_return(@user)) seems to fail to actually get called when RSpec makes a request to the controller? require 'spec_helper' describe TasksController do before(:each) do @user = Factory(:user) sign_in @user @task = Factory(:task) User.stub_chain(:where, :first).and_return(@user) controller.stub!(:load_user).and_return(@user) end #GET Index describe "GET Index" do before(:each) do @tasks = 7.times{Factory(:task, :user = @user)} @user.stub!(:tasks).and_return(@tasks) end it "should should find all of the tasks owned by a user" do @user.should_receive(:tasks).and_return(@tasks) get :index, :user_id = @user.id end it "should assign all of the user's tasks to the view" do get :index, :user_id = @user.id assigns[:tasks].should be(@tasks) end end #GET New describe "GET New" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should return a new Task" do @user.tasks.should_receive(:new).and_return(@task) get :new, :user_id = @user.id end end #POST Create describe "POST Create" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should create a new task" do @user.tasks.should_receive(:new).and_return(@task) post :create, :user_id = @user.id, :task = @task.to_s end it "saves the task" do @task.should_receive(:save) post :create, :user_id = @user.id, :task = @task end context "when the task is saved successfully" do before(:each) do @task.stub!(:save).and_return(true) end it "should set the flash[:notice] message to 'Task Added Successfully'"do post :create, :user_id = @user.id, :task = @task flash[:notice].should == "Task Added Successfully!" end it "should redirect to the user's task page" do post :create, :user_id = @user.id, :task = @task response.should redirect_to(user_tasks_path(@user.id)) end end context "when the task isn't saved successfully" do before(:each) do @task.stub(:save).and_return(false) end it "should return to the 'Create New Task' page do" do post :create, :user_id = @user.id, :task = @task response.should render_template('new') end end end it "should attempt to authenticate and load the user who owns the tasks" do context "when the tasks belong to the currently logged in user" do it "should set the user instance variable to the currently logged in user" do pending end end context "when the tasks belong to another user" do it "should set the flash[:notice] to 'Sorry but you can't view other people's tasks.'" do pending end it "should redirect to the home page" do pending end end end end class TasksController < ApplicationController before_filter :load_user def index @tasks = @user.tasks end def new @task = @user.tasks.new end def create @task = @user.tasks.new if @task.save flash[:notice] = "Task Added Successfully!" redirect_to user_tasks_path(@user.id) else render :action => 'new' end end private def load_user if current_user.id == params[:user_id].to_i @user = User.where(:id => params[:user_id]).first else flash[:notice] = "Sorry but you can't view other people's tasks." redirect_to root_path end end end Can anybody see why my stub doesnt' work? Like I said, my tests only pass if I make sure that load_user works, if not, all my tests fail which makes my think that RSpec isn't using the stub I created. Thanks, Joe

  Read the article

• What is GC holes?

  - by tianyi

  I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

  Read the article

• C#: My callback function gets called twice for every Sent Request

  - by Madi D.

  I've Got a program that uploads/downloads files into an online server,Has a callback to report progress and log it into a textfile, The program is built with the following structure: public void Upload(string source, string destination) { //Object containing Source and destination to pass to the threaded function KeyValuePair<string, string> file = new KeyValuePair<string, string>(source, destination); //Threading to make sure no blocking happens after calling upload Function Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.TUpload)); t.Start(file); } private void TUpload(object fileInfo) { KeyValuePair<string, string> file = (KeyValuePair<string, string>)fileInfo; /* Some Magic goes here,Checking The file and Authorizing Upload */ var ftiObject = new FtiObject () { FileNameOnHDD = file.Key, DestinationPath = file.Value, //Has more data used for calculations. }; //Threading to make sure progress gets callback gets called. Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.UploadOP)); t.Start(ftiObject); //Signal used to stop progress untill uploadCompleted is called. uploadChunkDoneSignal.WaitOne(); /* Some Extra Code */ } private void UploadOP(object ftiSentObject) { FtiObject ftiObject = (FtiObject)ftiSentObject; /* Some useless code to create the uri and prepare the ftiObject. */ // webClient.UploadFileAsync will open a thread that // will upload the file and report // progress/complete using registered callback functions. webClient.UploadFileAsync(uri, "PUT", ftiObject.FileNameOnHDD, ftiObject); } I got a callback that is registered to the Webclient's UploadProgressChanged event , however it is getting called twice per sent request. void UploadProgressCallback(object sender, UploadProgressChangedEventArgs e) { FtiObject ftiObject = (FtiObject )e.UserState; Logger.log(ftiObject.FileNameOnHDD, (double)e.BytesSent ,e.TotalBytesToSend); } Log Output: Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Etc... I am watching the Network Traffic using a watcher, and only 1 request is being sent. Some how i cant Figure out why the callback is being called twice, my doubt was that the callback is getting fired by each thread opened(the main Upload , and TUpload), however i dont know how to test if thats the cause. Note: The reason behind the many /**/ Comments is to indicate that the functions do more than just opening threads, and threading is being used to make sure no blocking occurs (there a couple of "Signal.WaitOne()" around the code for synchronization)

  Read the article

• ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

  - by Terminal Frost

  Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

  Read the article

• Create a timer countdown using hours, minutes & seconds from a future date

  - by Tommy Coffee

  I am using some code I found on the internet that creates a countdown from a certain date. I am trying to edit the code so that it only gives me a countdown from an hour, minute, and second that I specify from a future date. I cannot just have code that counts down from a specified time, I need it to countdown to a specified date in the future. This is important so that if the browser is refreshed the countdown doesn't start over but continues where left off. I will be using cookies so the browser remembers what future date was specified when it was first run. Here is the HTML: <form name="count"> <input type="text" size="69" name="count2"> </form> And here is the javascript: window.onload = function() { //change the text below to reflect your own, var montharray=new Array("Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec") function countdown(yr,m,d){ var theyear=yr; var themonth=m; var theday=d var today=new Date() var todayy=today.getYear() if (todayy < 1000) todayy+=1900; var todaym=today.getMonth() var todayd=today.getDate() var todayh=today.getHours() var todaymin=today.getMinutes() var todaysec=today.getSeconds() var todaystring=montharray[todaym]+" "+todayd+", "+todayy+" "+todayh+":"+todaymin+":"+todaysec futurestring=montharray[m-1]+" "+d+", "+yr var dd=Date.parse(futurestring)-Date.parse(todaystring) var dday=Math.floor(dd/(60*60*1000*24)*1) var dhour=Math.floor((dd%(60*60*1000*24))/(60*60*1000)*1) var dmin=Math.floor(((dd%(60*60*1000*24))%(60*60*1000))/(60*1000)*1) var dsec=Math.floor((((dd%(60*60*1000*24))%(60*60*1000))%(60*1000))/1000*1) if(dday==0&&dhour==0&&dmin==0&&dsec==1){ document.forms.count.count2.value=current return } else document.forms.count.count2.value= dhour+":"+dmin+":"+dsec; setTimeout(function() {countdown(theyear,themonth,theday)},1000) } //enter the count down date using the format year/month/day countdown(2012,12,25) } I am sure there is superfluous code above since I only need an hour, minute, and second that I would like to pass to the countdown() function. The year, month and day is unimportant but as I said this is code I am trying to edit which I found on the internet. Any help would be very appreciated. Thank you!

  Read the article

• Nested attributes form for model which belongs_to few models

  - by ExiRe

  I have few models - User, Teacher and TeacherLeader. class User < ActiveRecord::Base attr_accessible ..., :teacher_attributes has_one :teacher has_one :teacher_leader accepts_nested_attributes_for :teacher_leader end class Teacher < ActiveRecord::Base belongs_to :user has_one :teacher_leader end class TeacherLeader < ActiveRecord::Base belongs_to :user belongs_to :teacher end I would like to fill TeacherLeader via nested attributes. So, i do such things in controller: class TeacherLeadersController < ApplicationController ... def new @user = User.new @teacher_leader = @user.build_teacher_leader @teachers_collection = Teacher.all.collect do |t| [ "#{t.teacher_last_name} #{t.teacher_first_name} #{t.teacher_middle_name}", t.id ] end @choosen_teacher = @teachers_collection.first.last unless @teachers_collection.empty? end end And also have such view (new.html.erb): <%= form_for @user, :url => teacher_leaders_url, :html => {:class => "form-horizontal"} do |f| %> <%= field_set_tag do %> <% f.fields_for :teacher_leader do |tl| %> <div class="control-group"> <%= tl.label :teacher_id, "Teacher names", :class => "control-label" %> <div class="controls"> <%= select_tag( :teacher_id, options_for_select( @teachers_collection, @choosen_teacher )) %> </div> </div> <% end %> <div class="control-group"> <%= f.label :user_login, "Login", :class => "control-label" %> <div class="controls"> <%= f.text_field :user_login, :placeholder => @everpresent_field_placeholder %> </div> </div> <div class="control-group"> <%= f.label :password, "Pass", :class => "control-label" %> <div class="controls"> <%= f.text_field :password, :placeholder => @everpresent_field_placeholder %> </div> </div> <% end %> <%= f.submit "Create", :class => "btn btn-large btn-success" %> <% end %> Problem is that select form here does NOT appear. Why? Do i do something wrong?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

  - by gWiz

  I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

  Read the article

• Flex/Air/AS3 Selecting and Populating a unFocused tab.

  - by Deyon

  I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

  Read the article

• PHP - error when insert date into MySQL

  - by Michael Mao

  Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

  Read the article

• Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

  - by chernevik

  I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

  Read the article

• Backbone.js (model instanceof Model) via Chrome Extension

  - by Leoncelot

  Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

  Read the article

• How to implement a caching model without violating MVC pattern?

  - by RPM1984

  Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

  Read the article

• problem to create session of facebook

  - by khoyendra

  try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

  Read the article

• using LoadControl with object initializer to create properties

  - by lloydphillips

  In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

  Read the article

< Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >