Search Results

Search found 21343 results on 854 pages for 'pass by reference'.

Page 794/854 | < Previous Page | 790 791 792 793 794 795 796 797 798 799 800 801  | Next Page >

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • PHP - error when insert date into MySQL

    - by Michael Mao
    Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

    Read the article

  • Delphi Unit local variables - how to make each instance unique?

    - by Justin
    Ok, this, I'm sure is something simple that is easy to do. The problem : I've inherited scary spaghetti code and am slowly trying to better it when new features need adding - generally when a refactor makes adding the new feature neater. I've got a bunch of code I'm packing into a single unit which, in different places in the application, controls the same physical thing in the outside world. The control appears in several places in the application and operates slightly differently in each instance. What I've done is to create a unit with all of the features I need which I can simply drop, as a frame, into each form that requires it. Each form then uses the unit's interface methods to customise the behaviour for each instance. The problem within the problem : In the unit in question (the frame) I have a variable declared in the IMPLEMENTATION section - local to the unit. I also have a procedure, declared in the TYPE section which takes an argument and assigns that argument to the local variable in question - each form passes a unique variable to each instance of the frame/unit. What I want it to do is for each instance of the frame to keep its own version of that variable, different from the others, and use that to define how it operates. What seems to be happening, however, is that all instances are using the same value, even if I explicitly pass each instance a different variable. ie: Unit FlexibleUnit; interface uses //the uses stuff type TFlexibleUnit=class(TFrame) //declarations including procedure makeThisInstanceX(passMeTheVar:integer); private // public // end; implementation uses //the uses var myLocalVar; procedure makeThisInstanceX(passMeTheVar:integer); begin myLocalVar:=passMeTheVar; end; //other procedures using myLocalVar //etc to the end; Now somewhere in another Form I've dropped this Frame onto the Design pane, sometimes two of these frames on one Form, and have it declared in the proper places, etc. Each is unique in that : ThisFlexibleUnit : TFlexibleUnit; ThatFlexibleUnit : TFlexibleUnit; and when I do a: ThisFlexibleUnit.makeThisInstanceX(var1); //want to behave in way "var1" ThatFlexibleUnit.makeThisInstanceX(var2); //want to behave in way "var2" it seems that they both share the same variable "myLocalVar". Am I doing this wrong, in principle? If this is the correct method then it's a matter of debugging what I have (which is too huge to post) but if this is not correct in principle then is there a way to do what I am suggesting? Thanks in advance, Stack Overflow - you guys (and gals!) are legendary.

    Read the article

  • Nested attributes form for model which belongs_to few models

    - by ExiRe
    I have few models - User, Teacher and TeacherLeader. class User < ActiveRecord::Base attr_accessible ..., :teacher_attributes has_one :teacher has_one :teacher_leader accepts_nested_attributes_for :teacher_leader end class Teacher < ActiveRecord::Base belongs_to :user has_one :teacher_leader end class TeacherLeader < ActiveRecord::Base belongs_to :user belongs_to :teacher end I would like to fill TeacherLeader via nested attributes. So, i do such things in controller: class TeacherLeadersController < ApplicationController ... def new @user = User.new @teacher_leader = @user.build_teacher_leader @teachers_collection = Teacher.all.collect do |t| [ "#{t.teacher_last_name} #{t.teacher_first_name} #{t.teacher_middle_name}", t.id ] end @choosen_teacher = @teachers_collection.first.last unless @teachers_collection.empty? end end And also have such view (new.html.erb): <%= form_for @user, :url => teacher_leaders_url, :html => {:class => "form-horizontal"} do |f| %> <%= field_set_tag do %> <% f.fields_for :teacher_leader do |tl| %> <div class="control-group"> <%= tl.label :teacher_id, "Teacher names", :class => "control-label" %> <div class="controls"> <%= select_tag( :teacher_id, options_for_select( @teachers_collection, @choosen_teacher )) %> </div> </div> <% end %> <div class="control-group"> <%= f.label :user_login, "Login", :class => "control-label" %> <div class="controls"> <%= f.text_field :user_login, :placeholder => @everpresent_field_placeholder %> </div> </div> <div class="control-group"> <%= f.label :password, "Pass", :class => "control-label" %> <div class="controls"> <%= f.text_field :password, :placeholder => @everpresent_field_placeholder %> </div> </div> <% end %> <%= f.submit "Create", :class => "btn btn-large btn-success" %> <% end %> Problem is that select form here does NOT appear. Why? Do i do something wrong?

    Read the article

  • How to change the JSON output format and how to support chinese character?

    - by sky
    Currently I using the following code to get my JSON output from MySQL. <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT message FROM posts', $session); $somethings = array(); while ($row = mysql_fetch_assoc($result)) { $somethings[] = $row; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> And the output is: <script type="text/javascript"> var somethings= [{"message":"Welcome to Yo~ :)"},{"message":"Try iPhone post!"},{"message":"????"}]; </script> Here is the question, how can I change my output into format like : <script type="text/javascript"> userAge = new Array('21','36','20'), userMid = new Array('liuple','anhu','jacksen'); </script> Which I'll be using later with following code : var html = ' <table class="map-overlay"> <tr> <td class="user">' + '<a class="username" href="/' + **userMid[index]** + '" target="_blank"><img alt="" src="' + getAvatar(signImgList[index], '72x72') + '"></a><br> <a class="username" href="/' + **userMid[index]** + '" target="_blank">' + userNameList[index] + '</a><br> <span class="info">' + **userSex[index]** + ' ' + **userAge[index]** + '?<br> ' + cityList[index] + '</span>' + '</td> <td class="content">' + picString + somethings[index] + '<br> <span class="time">' + timeList[index] + picTips + '</span></td> </tr> </table> '; Thanks for helping and reading!

    Read the article

  • FILE_NOT_FOUND when trying to open COM port C++

    - by Moutabreath
    I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • C#: My callback function gets called twice for every Sent Request

    - by Madi D.
    I've Got a program that uploads/downloads files into an online server,Has a callback to report progress and log it into a textfile, The program is built with the following structure: public void Upload(string source, string destination) { //Object containing Source and destination to pass to the threaded function KeyValuePair<string, string> file = new KeyValuePair<string, string>(source, destination); //Threading to make sure no blocking happens after calling upload Function Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.TUpload)); t.Start(file); } private void TUpload(object fileInfo) { KeyValuePair<string, string> file = (KeyValuePair<string, string>)fileInfo; /* Some Magic goes here,Checking The file and Authorizing Upload */ var ftiObject = new FtiObject () { FileNameOnHDD = file.Key, DestinationPath = file.Value, //Has more data used for calculations. }; //Threading to make sure progress gets callback gets called. Thread t = new Thread(new ParameterizedThreadStart(amazonHandler.UploadOP)); t.Start(ftiObject); //Signal used to stop progress untill uploadCompleted is called. uploadChunkDoneSignal.WaitOne(); /* Some Extra Code */ } private void UploadOP(object ftiSentObject) { FtiObject ftiObject = (FtiObject)ftiSentObject; /* Some useless code to create the uri and prepare the ftiObject. */ // webClient.UploadFileAsync will open a thread that // will upload the file and report // progress/complete using registered callback functions. webClient.UploadFileAsync(uri, "PUT", ftiObject.FileNameOnHDD, ftiObject); } I got a callback that is registered to the Webclient's UploadProgressChanged event , however it is getting called twice per sent request. void UploadProgressCallback(object sender, UploadProgressChangedEventArgs e) { FtiObject ftiObject = (FtiObject )e.UserState; Logger.log(ftiObject.FileNameOnHDD, (double)e.BytesSent ,e.TotalBytesToSend); } Log Output: Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:1024 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:2048 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Filename: C:\Text1.txt Uploaded:3072 TotalFileSize: 665241 Etc... I am watching the Network Traffic using a watcher, and only 1 request is being sent. Some how i cant Figure out why the callback is being called twice, my doubt was that the callback is getting fired by each thread opened(the main Upload , and TUpload), however i dont know how to test if thats the cause. Note: The reason behind the many /**/ Comments is to indicate that the functions do more than just opening threads, and threading is being used to make sure no blocking occurs (there a couple of "Signal.WaitOne()" around the code for synchronization)

    Read the article

  • using dictionaries with WebServices

    - by umit-alba
    Hi! I tried to pass a dictionary via WebServices. However it is not serializeable. So i wrote an Own Class that makes it serializeable: using System; using System.Net; using System.Windows; using System.Collections.Generic; using System.Xml.Serialization; using System.Xml; using System.Xml.Schema; namespace Platform { public class SaDictionary<TKey, TValue> : Dictionary<TKey, TValue>, IXmlSerializable { #region Constructors public SaDictionary() : base() { } public SaDictionary(IDictionary<TKey, TValue> dictionary) : base(dictionary) { } public SaDictionary(IEqualityComparer<TKey> comparer) : base(comparer) { } public SaDictionary(int capacity) : base(capacity) { } public SaDictionary(IDictionary<TKey, TValue> dictionary, IEqualityComparer<TKey> comparer) : base(dictionary, comparer) { } public SaDictionary(int capacity, IEqualityComparer<TKey> comparer) : base(capacity, comparer) { } //protected SaDictionary(SerializationInfo info, StreamingContext context) // : base(info, context) //{ //} #endregion public XmlSchema GetSchema() { return null; } public void ReadXml(XmlReader reader) { XmlSerializer keySerializer = new XmlSerializer(typeof(TKey)); XmlSerializer valueSerializer = new XmlSerializer(typeof(TValue)); bool wasEmpty = reader.IsEmptyElement; reader.Read(); if (wasEmpty) return; while (reader.NodeType != XmlNodeType.EndElement) { reader.ReadStartElement("item"); reader.ReadStartElement("key"); TKey key = (TKey)keySerializer.Deserialize(reader); reader.ReadEndElement(); //key reader.ReadStartElement("value"); TValue value = (TValue)valueSerializer.Deserialize(reader); reader.ReadEndElement(); //value this.Add(key, value); reader.ReadEndElement(); //item // reader.MoveToContent(); } reader.ReadEndElement(); } public void WriteXml(XmlWriter writer) { XmlSerializer keySerializer = new XmlSerializer(typeof(TKey)); XmlSerializer valueSerializer = new XmlSerializer(typeof(TValue)); foreach (TKey key in this.Keys) { writer.WriteStartElement("item"); writer.WriteStartElement("key"); keySerializer.Serialize(writer, key); writer.WriteEndElement(); //key writer.WriteStartElement("value"); TValue value = this[key]; valueSerializer.Serialize(writer, value); writer.WriteEndElement(); //value writer.WriteEndElement(); //item } } } } However i get an ArrayOfXElement back. Is there a way to cast it back to a Dictionary? greets

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • ASP.Net / MySQL : Translating content into several languages

    - by philwilks
    I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

    Read the article

  • Moving Function With Arguments To RequireJS

    - by Jazimov
    I'm not only relatively new to JavaScript but also to RequireJS (coming from string C# background). Currently on my web page I have a number of JavaScript functions. Each one takes two arguments. Imagine that they look like this: functionA(x1, y1) { ... } functionB(x2, y2) { ... } functionC(x3, y3) { ... } Currently, these functions exist in a tag on my HTML page and I simply call each as needed. My functions have dependencies on KnockoutJS, jQuery, and some other JS libraries. I currently have Script tags that synchronously load those external .js dependencies. But I want to use RequireJS so that they're loaded asynchronously, as needed. To do this, I plan to move all three functions above into an external .js file (a type of AMD "module") called MyFunctions.js. That file will have a define() call (to RequireJS's define function) that will look something like this: define(["knockout", "jquery", ...], function("ko","jquery", ...) {???} ); My question is how to "wrap" my functionA, functionB, and functionC functions where the ??? is above so that I can use those functions on my page as needed. For example, in the onclick event handler for a button on my HTML page, I would want to call functionA and pass two it two arguments; same for functionB and functionC. I don't fully understand how to expose those functions when they're wrapped in a define that itself is located in an external .js file. I know that define assures that my listed libraries are loaded asynchronously before the callback function is called, but after that's done I don't understand how the web page's script tags would use my functions. Would I need to use require to ensure they're available, such as: require(["myfunctions"],function({not sure what to put here})] I think I understand the basics of RequireJS but I don't understand how to wrap my functions so that they're in external .js files, don't pollute the global namespace, and yet can still be called from the main page so that arguments can be passed to them. I imagine they're are many ways to do this but in reviewing the RequireJS docs and some videos out there, I can't say I understand how... Thank you for any help.

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • Why I can't draw in a loop? (Using UIView in iPhone)

    - by Tattat
    I can draw many things using this : NSString *imagePath = [[NSBundle mainBundle] pathForResource:@"dummy2.png" ofType:nil]; UIImage *img = [UIImage imageWithContentsOfFile:imagePath]; image = CGImageRetain(img.CGImage); CGRect imageRect; double x = 0; double y = 0; for (int k=0; k<someValue; k++) { x += k; y += k; imageRect.origin = CGPointMake(x, y); imageRect.size = CGSizeMake(25, 25); CGContextDrawImage(UIGraphicsGetCurrentContext(), imageRect, image); } } CGImageRelease(img.CGImage); So, it works, so, I put it into a command object's execute method. Then, I want to do similar thing, but this time, my execute method only do this: NSString *imagePath = [[NSBundle mainBundle] pathForResource:@"dummy2.png" ofType:nil]; UIImage *img = [UIImage imageWithContentsOfFile:imagePath]; image = CGImageRetain(img.CGImage); CGRect imageRect; double x = inComingX; double y = inComingY; imageRect.origin = CGPointMake(x, y); imageRect.size = CGSizeMake(25, 25); CGContextDrawImage(UIGraphicsGetCurrentContext(), imageRect, image); CGImageRelease(img.CGImage); This time, this is also a Command, and it is the execute method. But I take the for loop away. I will have another method that pass the inComingX , and inComingY into my Command object. My Drawing method is simply execute the Cmd that passed in my drawingEngine: -(void)drawInContext:(CGContextRef)context { [self.cmdToBeExecuted execute]; } I also have the assign method to assign the command,: -(void)assignCmd:(Command* )cmd{ self.cmdToBeExecuted = cmd; } And this is the way I called the drawingEngine for(int k=0; k<5; k++){ [self.drawingEngine assignCmd:[DrawingCmd setDrawingInformation:(10*k):0:@"dummy.png"]]; [self.drawingEngine setNeedsDisplay]; } It can draw, but the sad thing is it only draw the last one. Why? and how to fix it? I can draw all the things in my First code, but after I take the loop outside, and use the loop in last code, it just only draw the last one. Plz help

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Maximum nametable char count exceeded

    - by doc
    I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

    Read the article

  • How to use Mozilla ActiveX Control without registry

    - by Andrew McKinlay
    I've been using the IE Browser component that is part of Windows. But I'm running into problems with security settings. For example, users get security warnings on pages with Javascript. So I'm looking at using the Mozilla ActiveX control instead. It's especially nice because it has a compatible interface. It works well if I let it install the control in the registry. But my users don't always have administrator rights to install things in the registry. So I'm trying to figure out how to use the control without registry changes. I'm using DllGetClassObject to get the class factory (IID_ICLASSFACTORY) and then CoRegisterClassObject to register it. All the API calls appear to succeed. And when I create an AtlAxWin window with the CLSID, it also appears to work. But when I try to call Navigate on the AtlAxGetControl it doesn't work - the interface doesn't have Navigate. I would show the code but it's in an obscure language (Suneido) so it wouldn't mean much. An example in C or C++ would be easy for me to translate. Or an example in another dynamic language like Python or Ruby might be helpful. Obviously I'm doing something wrong. Maybe I'm passing the wrong thing to CoRegisterClassObject? The MSDN documentation isn't very clear on what to pass and I haven't found any good examples. Or if there is another approach, I'm ok with that too. Note: I'm using the AtlAxWin window class so I'm not directly creating the control and can't use this approach. Another option is registry free com with a manifest. But again, I couldn't find a good example, especially since I'm not using Visual Studio. I tried to use the MT manifest tool, but couldn't figure it out. I don't think I can use DLL redirection since that doesn't get around the registry issue AFAIK. Another possibility is using WebKit but it seems even harder to use.

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

    - by Sam
    The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

    Read the article

< Previous Page | 790 791 792 793 794 795 796 797 798 799 800 801  | Next Page >