Search Results

Search found 49435 results on 1978 pages for 'query string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 8/1978 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • String replacement problem.

    - by fastcodejava
    I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

    Read the article

  • optimizing an sql query using inner join and order by

    - by Sergio B
    I'm trying to optimize the following query without success. Any idea where it could be indexed to prevent the temporary table and the filesort? EXPLAIN SELECT SQL_NO_CACHE `groups`.* FROM `groups` INNER JOIN `memberships` ON `groups`.id = `memberships`.group_id WHERE ((`memberships`.user_id = 1) AND (`memberships`.`status_code` = 1 AND `memberships`.`manager` = 0)) ORDER BY groups.created_at DESC LIMIT 5;` +----+-------------+-------------+--------+--------------------------+---------+---------+---------------------------------------------+------+----------------------------------------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+-------------+--------+--------------------------+---------+---------+---------------------------------------------+------+----------------------------------------------+ | 1 | SIMPLE | memberships | ref | grp_usr,grp,usr,grp_mngr | usr | 5 | const | 5 | Using where; Using temporary; Using filesort | | 1 | SIMPLE | groups | eq_ref | PRIMARY | PRIMARY | 4 | sportspool_development.memberships.group_id | 1 | | +----+-------------+-------------+--------+--------------------------+---------+---------+---------------------------------------------+------+----------------------------------------------+ 2 rows in set (0.00 sec) +--------+------------+-----------------------------------+--------------+-----------------+-----------+-------------+----------+--------+------+------------+---------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | +--------+------------+-----------------------------------+--------------+-----------------+-----------+-------------+----------+--------+------+------------+---------+ | groups | 0 | PRIMARY | 1 | id | A | 6 | NULL | NULL | | BTREE | | | groups | 1 | index_groups_on_name | 1 | name | A | 6 | NULL | NULL | YES | BTREE | | | groups | 1 | index_groups_on_privacy_setting | 1 | privacy_setting | A | 6 | NULL | NULL | YES | BTREE | | | groups | 1 | index_groups_on_created_at | 1 | created_at | A | 6 | NULL | NULL | YES | BTREE | | | groups | 1 | index_groups_on_id_and_created_at | 1 | id | A | 6 | NULL | NULL | | BTREE | | | groups | 1 | index_groups_on_id_and_created_at | 2 | created_at | A | 6 | NULL | NULL | YES | BTREE | | +--------+------------+-----------------------------------+--------------+-----------------+-----------+-------------+----------+--------+------+------------+---------+ +-------------+------------+----------------------------------------------------------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | +-------------+------------+----------------------------------------------------------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+ | memberships | 0 | PRIMARY | 1 | id | A | 2 | NULL | NULL | | BTREE | | | memberships | 0 | grp_usr | 1 | group_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 0 | grp_usr | 2 | user_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | grp | 1 | group_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | usr | 1 | user_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | grp_mngr | 1 | group_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | grp_mngr | 2 | manager | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | complex_index | 1 | group_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | complex_index | 2 | user_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | complex_index | 3 | status_code | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | complex_index | 4 | manager | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | index_memberships_on_user_id_and_status_code_and_manager | 1 | user_id | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | index_memberships_on_user_id_and_status_code_and_manager | 2 | status_code | A | 2 | NULL | NULL | YES | BTREE | | | memberships | 1 | index_memberships_on_user_id_and_status_code_and_manager | 3 | manager | A | 2 | NULL | NULL | YES | BTREE | | +-------------+------------+----------------------------------------------------------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+

    Read the article

  • how to write this typical mysql query( ho to use subquery column into main query)

    - by I Like PHP
    I HAVE TWO TABLES shown below table_joining id join_id(PK) transfer_id(FK) unit_id transfer_date joining_date 1 j_1 t_1 u_1 2010-06-05 2010-03-05 2 j_2 t_2 u_3 2010-05-10 2010-03-10 3 j_3 t_3 u_6 2010-04-10 2010-01-01 4 j_5 NULL u_3 NULL 2010-06-05 5 j_6 NULL u_4 NULL 2010-05-05 table_transfer id transfer_id(PK) pastUnitId futureUnitId effective_transfer_date 1 t_1 u_3 u_1 2010-06-05 2 t_2 u_6 u_1 2010-05-10 3 t_3 u_5 u_3 2010-04-10 now i want to know total employee detalis( using join_id) which are currently working on unit u_3 . means i want only join_id j_1 (has transfered but effective_transfer_date is future date, right now in u_3) j_2 ( tansfered and right now in `u_3` bcoz effective_transfer_date has been passed) j_6 ( right now in `u_3` and never transfered) what i need to take care of below steps( as far as i know ) <1> first need to check from table_joining whether transfer_id is NULL or not <2> if transfer_id= is NULL then see unit_id=u_3 where joining_date <=CURDATE() ( means that person already joined u_3) <3> if transfer_id is NOT NULL then go to table_transfer using transfer_id (foreign key reference) <4> now see the effective_transfer_date regrading that transfer_id whether effective_transfer_date<=CURDATE() <5> if transfer date has been passed(means transfer has been done) then return futureUnitID otherwise return pastUnitID i used two separate query but don't know how to join those query?? for step <1 ans <2 SELECT unit_id FROM table_joining WHERE joining_date<=CURDATE() AND transfer_id IS NULL AND unit_id='u_3' for step<5 SELECT IF(effective_transfer_date <= CURDATE(),futureUnitId,pastUnitId) AS currentUnitID FROM table_transfer // here how do we select only those rows which have currentUnitID='u_3' ?? please guide me the process?? i m just confused with JOINS. i think using LEFT JOIN can return the data i need, but i m not getting how to implement ...please help me. Thanks for helping me alwayz

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Designing complex query builders in java/jpa/hibernate

    - by Ramraj Edagutti
    I need to build complex sql queries programatically, based on large filter conditions. For example, below are few sample/hypothitical filter conditions, based on which i need to fetch users Country: india States: Andhra Pradesh(AP), Gujarat(GUJ), karnataka(KTK) Districts: All districts in AP except 3 district, 5 any districts from GUJ, all district from KTK except 1 district Cities: All cities in AP, all cities except few, include only 50 specific cities from KTK Villages: similar conditions like above with varies combinations... Currently, we have a query builder, which is very complex in nature, and not easy to modify/re-factory for improvements. So, thinking of complete re-design of it. Any suggesations on how to build this kind of complex query builders programmatically using some best practices/deisgn patterns?

    Read the article

  • Power Query in Modern Corporate BI–Copenhagen, June 3, 2014–#powerquery

    - by Marco Russo (SQLBI)
    I will be in Copenhagen to deliver the SSAS Tabular Workshop on June 2-4, 2014 (few seats still available, but hurry up!). In the same week I will be a speaker in an evening community event, MsBIP møde nr. 21, delivering the Power Query in Modern Corporate BI session that I also presented at TechEd North America 2014 last week. It’s not just a session about Power Query, there is a broader scope related to Corporate BI vs. Self-Service BI, which could be open to many consideration. I think that the two worlds can (and should) collaborate, instead of fighting against each other, especially when there is an existing investment in Corporate BI. I hope to meet many of you there!

    Read the article

  • How to programmatically construct textual query

    - by stibi
    Here is a query language, more specifically, it's JQL, you can use it in Jira, to search for issues, it's something like SQL, but quite simpler. My case is that, I need to construct such queries programmatically, in my application. Something like: JQLMachine jqlMachine = new JQLMachine() jqlMachine.setStatuses("Open", "In Progress") jqlMachine.setReporter("foouser", "baruser") jqlMachine.setDateRange(...) jqlMachine.getQuery() --> String with corresponding JQL query is returned You get my point I hope. I can imagine the code for this, but it's not nice, using my current knowledge how I'd do that. That's why I'm asking. What you'd advice to use to create such thing. I believe some patterns for creating something like this already exist and there is already best practices, how to do that in good way.

    Read the article

  • $query returns results but not the ones i want: $query looks good to me :S

    - by Toni Michel Caubet
    I'll start again, Lets say My data is: Table element (id,name,....) 1, name element 1, .... 2, name element 2, .... 3, name element 3, .... Table tags (id,name,id_element, ....) 1, happy , 1 2, result, 1 3, very , 1 4, element, 2 5, another, 3 6, element, 1 7, happy, 2 So if search is 'very, happy,element,result': Results i would like 1) element with id = 2 because it has all tags 2) element with id = 1 because it has the tag 'element' and the tag 'happy' (only 2 less taggs) 3) .... (only 3 less taggs) So if search is 'happy,element': Results i would like 1) element with id = 1 because it has all tags (and no more) 2) element with id = 2 because it has the tag 'element' and the tag 'happy' (and two more tags) 3) .... and 3 more tags This is an echo to my query: (it doesn't fit al requirements i wrote, but its first test to find with matched tags) SELECT element.id as id_deseada,tagg.* FROM element,tagg WHERE tagg.id_element = element.id AND tagg.nombre IN ('happy','tagg','result') GROUP BY tagg.id_element ORDER BY element.votos This returns 10 duplicated elements... :S and doen't even have all taggs (and on database there are taggs with 'happy' results) if it helps, thats how i get the elements of a tag (by name and with only one tagg) $query = "SELECT element.id FROM element,tagg WHERE tagg.nombre = '$nombre_tagg' AND tagg.id_element = element.id AND lan = '$lan' GROUP BY tagg.id_element"; I hope it's a bit easier to understand now, excuse my english.. :) Thanks a lot for you possible aportation!

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • SQL SERVER – Example of Performance Tuning for Advanced Users with DB Optimizer

    - by Pinal Dave
    Performance tuning is such a subject that everyone wants to master it. In beginning everybody is at a novice level and spend lots of time learning how to master the art of performance tuning. However, as we progress further the tuning of the system keeps on getting very difficult. I have understood in my early career there should be no need of ego in the technology field. There are always better solutions and better ideas out there and we should not resist them. Instead of resisting the change and new wave I personally adopt it. Here is a similar example, as I personally progress to the master level of performance tuning, I face that it is getting harder to come up with optimal solutions. In such scenarios I rely on various tools to teach me how I can do things better. Once I learn about tools, I am often able to come up with better solutions when I face the similar situation next time. A few days ago I had received a query where the user wanted to tune it further to get the maximum out of the performance. I have re-written the similar query with the help of AdventureWorks sample database. SELECT * FROM HumanResources.Employee e INNER JOIN HumanResources.EmployeeDepartmentHistory edh ON e.BusinessEntityID = edh.BusinessEntityID INNER JOIN HumanResources.Shift s ON edh.ShiftID = s.ShiftID; User had similar query to above query was used in very critical report and wanted to get best out of the query. When I looked at the query – here were my initial thoughts Use only column in the select statements as much as you want in the application Let us look at the query pattern and data workload and find out the optimal index for it Before I give further solutions I was told by the user that they need all the columns from all the tables and creating index was not allowed in their system. He can only re-write queries or use hints to further tune this query. Now I was in the constraint box – I believe * was not a great idea but if they wanted all the columns, I believe we can’t do much besides using *. Additionally, if I cannot create a further index, I must come up with some creative way to write this query. I personally do not like to use hints in my application but there are cases when hints work out magically and gives optimal solutions. Finally, I decided to use Embarcadero’s DB Optimizer. It is a fantastic tool and very helpful when it is about performance tuning. I have previously explained how it works over here. First open DBOptimizer and open Tuning Job from File >> New >> Tuning Job. Once you open DBOptimizer Tuning Job follow the various steps indicates in the following diagram. Essentially we will take our original script and will paste that into Step 1: New SQL Text and right after that we will enable Step 2 for Generating Various cases, Step 3 for Detailed Analysis and Step 4 for Executing each generated case. Finally we will click on Analysis in Step 5 which will generate the report detailed analysis in the result pan. The detailed pan looks like. It generates various cases of T-SQL based on the original query. It applies various hints and available hints to the query and generate various execution plans of the query and displays them in the resultant. You can clearly notice that original query had a cost of 0.0841 and logical reads about 607 pages. Whereas various options which are just following it has different execution cost as well logical read. There are few cases where we have higher logical read and there are few cases where as we have very low logical read. If we pay attention the very next row to original query have Merge_Join_Query in description and have lowest execution cost value of 0.044 and have lowest Logical Reads of 29. This row contains the query which is the most optimal re-write of the original query. Let us double click over it. Here is the query: SELECT * FROM HumanResources.Employee e INNER JOIN HumanResources.EmployeeDepartmentHistory edh ON e.BusinessEntityID = edh.BusinessEntityID INNER JOIN HumanResources.Shift s ON edh.ShiftID = s.ShiftID OPTION (MERGE JOIN) If you notice above query have additional hint of Merge Join. With the help of this Merge Join query hint this query is now performing much better than before. The entire process takes less than 60 seconds. Please note that it the join hint Merge Join was optimal for this query but it is not necessary that the same hint will be helpful in all the queries. Additionally, if the workload or data pattern changes the query hint of merge join may be no more optimal join. In that case, we will have to redo the entire exercise once again. This is the reason I do not like to use hints in my queries and I discourage all of my users to use the same. However, if you look at this example, this is a great case where hints are optimizing the performance of the query. It is humanly not possible to test out various query hints and index options with the query to figure out which is the most optimal solution. Sometimes, we need to depend on the efficiency tools like DB Optimizer to guide us the way and select the best option from the suggestion provided. Let me know what you think of this article as well your experience with DB Optimizer. Please leave a comment. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Joins, SQL Optimization, SQL Performance, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • SQL Intersection Conference, Las Vegas MGM Grand 10-13 November 2014

    - by Paul White
    I am very pleased to announce that I will be speaking at the SQL Intersection conference in Las Vegas again this year. This time around, I am giving a full-day workshop, "Mastering SQL Server Execution Plan Analysis" as well as a two-part session, "Parallel Query Execution" during the main conference. The workshop is a pre-conference event, held on Sunday 9 November (straight after this year's PASS Summit). Being on Sunday gives you the whole Monday off to recover and before the...(read more)

    Read the article

  • sort mysql query by filtered query

    - by kalpaitch
    I have two mysql queries: $sql = "SELECT * FROM content WHERE threadName LIKE '%$filter%' ORDER BY lastUpdated desc"; and $sql = "SELECT * FROM content ORDER BY lastUpdated desc"; The end result is to have all rows returned from a particular table 'content' but have those that match the variable $filter at the top. Is there either a single query that could combine these two or should I be using a JOIN?

    Read the article

  • How to apply GROUP_CONCAT in mysql Query

    - by Query Master
    How to apply GROUP_CONCAT in this Query if you guys have any idea or any alternate solution about this please share me. Helps are definitely appreciated also (see Query or result required) Query SELECT WEEK(cpd.added_date) AS week_no,COUNT(cpd.result) AS death_count FROM cron_players_data cpd WHERE cpd.player_id = 81 AND cpd.result = 2 AND cpd.status = 1 GROUP BY WEEK(cpd.added_date); Query output result screen Result Required 23,24,25 AS week_no 2,3,1 AS death_count

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • SQL SERVER – Query Hint – Contest Win Joes 2 Pros Combo (USD 198) – Day 1 of 5

    - by pinaldave
    August 2011 we ran a contest where every day we give away one book for an entire month. The contest had extreme success. Lots of people participated and lots of give away. I have received lots of questions if we are doing something similar this month. Absolutely, instead of running a contest a month long we are doing something more interesting. We are giving away USD 198 worth gift every day for this week. We are giving away Joes 2 Pros 5 Volumes (BOOK) SQL 2008 Development Certification Training Kit every day. One copy in India and One in USA. Total 2 of the giveaway (worth USD 198). All the gifts are sponsored from the Koenig Training Solution and Joes 2 Pros. The books are available here Amazon | Flipkart | Indiaplaza How to Win: Read the Question Read the Hints Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India residents only) 2 Winners will be randomly selected announced on August 20th. Question of the Day: Which of the following queries will return dirty data? a) SELECT * FROM Table1 (READUNCOMMITED) b) SELECT * FROM Table1 (NOLOCK) c) SELECT * FROM Table1 (DIRTYREAD) d) SELECT * FROM Table1 (MYLOCK) Query Hints: BIG HINT POST Most SQL people know what a “Dirty Record” is. You might also call that an “Intermediate record”. In case this is new to you here is a very quick explanation. The simplest way to describe the steps of a transaction is to use an example of updating an existing record into a table. When the insert runs, SQL Server gets the data from storage, such as a hard drive, and loads it into memory and your CPU. The data in memory is changed and then saved to the storage device. Finally, a message is sent confirming the rows that were affected. For a very short period of time the update takes the data and puts it into memory (an intermediate state), not a permanent state. For every data change to a table there is a brief moment where the change is made in the intermediate state, but is not committed. During this time, any other DML statement needing that data waits until the lock is released. This is a safety feature so that SQL Server evaluates only official data. For every data change to a table there is a brief moment where the change is made in this intermediate state, but is not committed. During this time, any other DML statement (SELECT, INSERT, DELETE, UPDATE) needing that data must wait until the lock is released. This is a safety feature put in place so that SQL Server evaluates only official data. Additional Hints: I have previously discussed various concepts from SQL Server Joes 2 Pros Volume 1. SQL Joes 2 Pros Development Series – Dirty Records and Table Hints SQL Joes 2 Pros Development Series – Row Constructors SQL Joes 2 Pros Development Series – Finding un-matching Records SQL Joes 2 Pros Development Series – Efficient Query Writing Strategy SQL Joes 2 Pros Development Series – Finding Apostrophes in String and Text SQL Joes 2 Pros Development Series – Wildcard – Querying Special Characters SQL Joes 2 Pros Development Series – Wildcard Basics Recap Next Step: Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India) Bonus Winner Leave a comment with your favorite article from the “additional hints” section and you may be eligible for surprise gift. There is no country restriction for this Bonus Contest. Do mention why you liked it any particular blog post and I will announce the winner of the same along with the main contest. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Joes 2 Pros, PostADay, SQL, SQL Authority, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • SQL SERVER – Concat Function in SQL Server – SQL Concatenation

    - by pinaldave
    Earlier this week, I was delivering Advanced BI training on the subject of “SQL Server 2008 R2″. I had great time delivering the session. During the session, we talked about SQL Server 2010 Denali. Suddenly one of the attendees suggested his displeasure for the product. He said, even though, SQL Server is now in moving very fast and have proved many times a good enterprise solution, it does not have some basic functions. I naturally asked him for example and he suggested CONCAT() which exists in MySQL and Oracle. The answer is very simple – the equalent function in SQL Server to CONCAT() is ‘+’ (plus operator without quotes). Method 1: Concatenating two strings SELECT 'FirstName' + ' ' + 'LastName' AS FullName Method 2: Concatenating two Numbers SELECT CAST(1 AS VARCHAR(10)) + 'R' + CAST(2 AS VARCHAR(10)) Method 3: Concatenating values from table columns SELECT FirstName + ' ' + LastName FROM AdventureWorks.Person.Contact Well, this may look very simple but sometime it is very difficult to find the information for simple things only. Do you have any such example which you would like to share with community? Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Pinal Dave, SQL, SQL Authority, SQL Query, SQL Scripts, SQL Server, SQL String, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • SQLAuthority News – Microsoft SQL Server 2005/2008 Query Optimization & Performance Tuning Training

    - by pinaldave
    Last 3 days to register for the courses. This is one time offer with big discount. The deadline for the course registration is 5th May, 2010. There are two different courses are offered by Solid Quality Mentors 1) Microsoft SQL Server 2005/2008 Query Optimization & Performance Tuning – Pinal Dave Date: May 12-14, 2010 Price: Rs. 14,000/person for 3 days Discount Code: ‘SQLAuthority.com’ Effective Price: Rs. 11,000/person for 3 days 2) SharePoint 2010 – Joy Rathnayake Date: May 10-11, 2010 Price: Rs. 11,000/person for 3 days Discount Code: ‘SQLAuthority.com’ Effective Price: Rs. 8,000/person for 2 days Download the complete PDF brochure. To register, either send an email to [email protected] or call +91 95940 43399. Feel free to drop me an email at pinal “at” SQLAuthority.com for any additional information and clarification. Training Venue: Abridge Solutions, #90/B/C/3/1, Ganesh GHR & MSY Plaza, Vittalrao Nagar, Near Image Hospital, Madhapur, Hyderabad – 500 081. Additionally there is special program of SolidQ India Insider. This is only available to first few registrants of the courses only. Read more details about the course here. Read my TechEd India 2010 experience here. Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, SQL, SQL Authority, SQL Optimization, SQL Performance, SQL Query, SQL Server, SQL Tips and Tricks, SQL Training, SQLAuthority News, T SQL, Technology

    Read the article

  • SQL SERVER – Using MAXDOP 1 for Single Processor Query – SQL in Sixty Seconds #008 – Video

    - by pinaldave
    Today’s SQL in Sixty Seconds video is inspired from my presentation at TechEd India 2012 on Speed up! – Parallel Processes and Unparalleled Performance. There are always special cases when it is about SQL Server. There are always few queries which gives optimal performance when they are executed on single processor and there are always queries which gives optimal performance when they are executed on multiple processors. I will be presenting the how to identify such queries as well what are the best practices related to the same. In this quick video I am going to demonstrate if the query is giving optimal performance when running on single CPU how one can restrict queries to single CPU by using hint OPTION (MAXDOP 1). More on Errors: Difference Temp Table and Table Variable – Effect of Transaction Effect of TRANSACTION on Local Variable – After ROLLBACK and After COMMIT Debate – Table Variables vs Temporary Tables – Quiz – Puzzle – 13 of 31 I encourage you to submit your ideas for SQL in Sixty Seconds. We will try to accommodate as many as we can. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Database, Pinal Dave, PostADay, SQL, SQL Authority, SQL in Sixty Seconds, SQL Query, SQL Scripts, SQL Server, SQL Tips and Tricks, SQLServer, T SQL, Video

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >