Search Results

Search found 21301 results on 853 pages for 'duplicate values'.

Page 801/853 | < Previous Page | 797 798 799 800 801 802 803 804 805 806 807 808  | Next Page >

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • how to handle a array of objects in a session

    - by Robert
    Hello, In the project I'm working on I have got a list List<Item> with objects that Is saved in a session. Session.Add("SessionName", List); In the Controller I build a viewModel with the data from this session var arrayList = (List<Item>)Session["SessionName"]; var arrayListItems= new List<CartItem>(); foreach (var item in arrayList) { var listItem = new Item { Amount = item.Amount, Variant= item.variant, Id = item.Id }; arrayListItems.Add(listItem); } var viewModel = new DetailViewModel { itemList = arrayListItems } and in my View I loop trough the list of Items and make a form for all of them to be able to remove the item. <table> <%foreach (var Item in Model.itemList) { %> <% using (Html.BeginForm()) { %> <tr> <td><%=Html.Hidden(Settings.Prefix + ".VariantId", Item .Variant.Id)%> <td> <%=Html.TextBox(Settings.Prefix + ".Amount", Item.Amount)%></td> <td> <%=Html.Encode(Item.Amount)%> </td> <td> <input type="submit" value="Remove" /> </td> </tr> <% } %> <% } %> </table> When the post from the submit button is handeld the item is removed from the array and post back exactly the same viewModel (with 1 item less in the itemList). return View("view.ascx", viewModel); When the post is handled and the view has reloaded the value's of the html.Hidden and Html.Textbox are the value's of the removed item. The value of the html.Encode is the correct value. When i reload the page the correct values are in the fields. Both times i build the viewModel the exact same way. I cant find the cause or solution of this error. I would be very happy with any help to solve this problem Thanx in advance for any tips or help

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Is this a legitimate implementation of a 'remember me' function for my web app?

    - by user246114
    Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

    Read the article

  • Matlab cell length

    - by AP
    Ok I seem to have got the most of the problem solved, I just need an expert eye to pick my error as I am stuck. I have a file of length [125 X 27] and I want to convert it to a file of length [144 x 27]. Now, I want to replace the missing files (time stamps) rows of zeros. (ideally its a 10 min daily average thus should have file length of 144) Here is the code I am using: fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); %//Make time a datenum of the first column time = datenum(data{1} , 'mm/dd/yyyy HH:MM') %//Find the difference in minutes from each row timeDiff = round(diff(datenum(time)*(24*60))) %//the rest of the data data = cell2mat(data(2:28)); newdata=zeros(144,27); for n=1:length(timeDiff) if timeDiff(n)==10 newdata(n,:)=data(n,:); newdata(n+1,:)=data(n+1,:); else p=timeDiff(n)/10 n=n+p; end end Can somebody please help me to find the error inside my for loop. My output file seems to miss few timestamped values. %*********************************************************************************************************** Can somebody help me to figure out the uiget to read the above file?? i am replacing fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); With [c,pathc]=uigetfile({'*.txt'},'Select the file','C:\data'); file=[pathc c]; file= textscan(c, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); And its not working % NEW ADDITION to old question p = 1; %index into destination for n = 1:length(timeDiff) % if timeDiff(n) == 10 % newfile(p,:) = file(n,:); % newfile(p+1,:)=file(n+1,:); % p = p + 1; % else % p = p + (timeDiff(n)/10); % end q=cumsum(timeDiff(n)/10); if q==1 newfile(p,:)=file(n,:); p=p+1; else p = p + (timeDiff(n)/10); end end xlswrite('testnewws11.xls',newfile); even with the cumsum command this code fails when my file has 1,2 time stamps in middle of long missing ones example 8/16/2009 0:00 5.34 8/16/2009 0:10 3.23 8/16/2009 0:20 2.23 8/16/2009 0:30 1.23 8/16/2009 0:50 70 8/16/2009 2:00 5.23 8/16/2009 2:20 544 8/16/2009 2:30 42.23 8/16/2009 3:00 71.23 8/16/2009 3:10 3.23 My output looks like 5.34 3.23 2.23 0 0 0 0 0 0 0 0 0 5.23 544. 42.23 0 0 0 3.23 Any ideas?

    Read the article

  • Is there a recommended approach to handle saving data in response to within-site navigation without

    - by Carvell Fenton
    Hello all, Preamble to scope my question: I have a web app (or site, this is an internal LAN site) that uses jQuery and AJAX extensively to dynamically load the content section of the UI in the browser. A user navigates the app using a navigation menu. Clicking an item in the navigation menu makes an AJAX call to php, and php then returns the content that is used to populate the central content section. One of the pages served back by php has a table form, set up like a spreadsheet, that the user enters values into. This table is always kept in sync with data in the database. So, when the table is created, is it populated with the relevant database data. Then when the user makes a change in a "cell", that change immediately is written back to the database so the table and database are always in sync. This approach was take to reassure users that the data they entered has been saved (long story...), and to alleviate them from having to click a save button of some kind. So, this always in sync idea is great, except that a user can enter a value in a cell, not take focus out of the cell, and then take any number of actions that would cause that last value to be lost: e.g. navigate to another section of the site via the navigation menu, log out of the app, close the browser, etc. End of preamble, on to the issue: I initially thought that wasn't a problem, because I would just track what data was "dirty" or not saved, and then in the onunload event I would do a final write to the database. Herein lies the rub: because of my clever (or not so clever, not sure) use of AJAX and dynamically loading the content section, the user never actually leaves the original url, or page, when the above actions are taken, with the exception of closing the browser. Therefore, the onunload event does not fire, and I am back to losing the last data again. My question, is there a recommended way to handle figuring out if a person is navigating away from a "section" of your app when content is dynamically loaded this way? I can come up with a solution I think, that involves globals and tracking the currently viewed page, but I thought I would check if there might be a more elegant solution out there, or a change I could make in my design, that would make this work. Thanks in advance as always!

    Read the article

  • How to created filtered reports in WPF?

    - by Michael Goyote
    Creating reports in WPF. I have two related tables. Table A-Customer: CustomerID(PK) Names Phone Number Customer Num Table B-Items: Products Price CustomerID I want to be able to generate a report like this: CustomerA Items Price Item A 10 Item B 10 Item C 10 --------------- Total 30 So this is what I have done: <Window x:Class="ReportViewerWPF.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:rv="clr-namespace:Microsoft.Reporting.WinForms; assembly=Microsoft.ReportViewer.WinForms" Title="Customer Report" Height="300" Width="400"> <Grid> <WindowsFormsHost Name="windowsFormsHost1"> <rv:ReportViewer x:Name="reportViewer1"/> </WindowsFormsHost> </Grid> Then I created a dataset and loaded the two tables, followed by a report wizard (dragged all the available fields and dropped them to the Values pane). The code behind the WPF window is this: public partial class CustomerReport : Window { public CustomerReport() { InitializeComponent(); _reportViewer.Load += ReportViewer_Load; } private bool _isReportViewerLoaded; private void ReportViewer_Load(object sender, EventArgs e) { if (!_isReportViewerLoaded) { Microsoft.Reporting.WinForms.ReportDataSource reportDataSource1 = new Microsoft.Reporting.WinForms.ReportDataSource(); HM2DataSet dataset = new HM2DataSet(); dataset.BeginInit(); reportDataSource1.Name = "DataSet";//This is the dataset name reportDataSource1.Value = dataset.CustomerTable; this.reportViewer1.LocalReport.DataSources.Add(reportDataSource1); this.reportViewer1.LocalReport.ReportPath = "../../Report3.rdlc"; dataset.EndInit(); HM2DataSetTableAdapters.CustomerTableAdapter funcTableAdapter = new HM2DataSetTableAdapters.CustomerTableAdapter(); funcTableAdapter.ClearBeforeFill = true; funcTableAdapter.Fill(dataset.CustomerTable); _reportViewer.RefreshReport(); _isReportViewerLoaded = true; } } As you might have guessed this loaded this list of customer with items and price: Customer Items Price Customer A Items A 10 Customer A Items B 10 Customer B Items D 10 Customer B Items C 10 How can I fine-tune this report to look like the one above, where the user can filter the customer he wants displayed on the report? Thanks in advance for the help. I would have preferred to use LINQ whenever filtering data

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • how to develop a program to minimize errors in human transcription of hand written surveys

    - by Alex. S.
    I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • Core Plot: x-axis labels not plotted when using scaleToFitPlots

    - by AlexR
    Problem: I can't get Core Plot (1.1) to plot automatic labels for my x-axis when using autoscaling ([plotSpace scaleToFitPlots:[graph allPlots]). What I have tried: I changed the values for the offsets and paddings, but this did not change the result. However, when turning autoscale off (not using [plotSpace scaleToFitPlots:[graph allPlots]]and setting the y scale automatically, the automatic labeling of the x-axis works. Question: Is there a bug in Core Plot or what did I do wrong? I would appreciate any help! Thank you! This is how I have set up my chart: CPTBarPlot *barPlot = [CPTBarPlot tubularBarPlotWithColor:[CPTColor blueColor] horizontalBars:NO]; barPlot.baseValue = CPTDecimalFromInt(0); barPlot.barOffset = CPTDecimalFromFloat(0.0f); // CPTDecimalFromFloat(0.5f); barPlot.barWidth = CPTDecimalFromFloat(0.4f); barPlot.barCornerRadius = 4; barPlot.labelOffset = 5; barPlot.dataSource = self; barPlot.delegate = self; graph = [[CPTXYGraph alloc]initWithFrame:self.view.bounds]; self.hostView.hostedGraph = graph; graph.paddingLeft = 40.0f; graph.paddingTop = 30.0f; graph.paddingRight = 30.0f; graph.paddingBottom = 50.0f; [graph addPlot:barPlot]; graph.plotAreaFrame.masksToBorder = NO; graph.plotAreaFrame.cornerRadius = 0.0f; graph.plotAreaFrame.borderLineStyle = borderLineStyle; double xAxisStart = 0; CPTXYAxisSet *xyAxisSet = (CPTXYAxisSet *)graph.axisSet; CPTXYAxis *xAxis = xyAxisSet.xAxis; CPTMutableLineStyle *lineStyle = [xAxis.axisLineStyle mutableCopy]; lineStyle.lineCap = kCGLineCapButt; xAxis.axisLineStyle = lineStyle; xAxis.majorTickLength = 10; xAxis.orthogonalCoordinateDecimal = CPTDecimalFromDouble(yAxisStart); xAxis.paddingBottom = 5; xyAxisSet.delegate = self; xAxis.delegate = self; xAxis.labelOffset = 0; xAxis.labelingPolicy = CPTAxisLabelingPolicyAutomatic; [plotSpace scaleToFitPlots:[graph allPlots]]; CPTMutablePlotRange *yRange = plotSpace.yRange.mutableCopy; [yRange expandRangeByFactor:CPTDecimalFromDouble(1.3)]; plotSpace.yRange = yRange; NSInteger xLength = CPTDecimalIntegerValue(plotSpace.xRange.length) + 1; plotSpace.xRange = [CPTPlotRange plotRangeWithLocation:CPTDecimalFromDouble(xAxisStart) length:CPTDecimalFromDouble(xLength)] ;

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • ASP.NET Elements are null when assigning data source

    - by deccks
    For some reason, all of the objects in my ASP.NET markup are now null when I try to assign values to their properties in the code behind. My project was going fine and then now when I try to assign a data source to a GridView, I get a null reference error. I have no idea why it's doing this. I am not doing nothing special. I am just trying to assign a value to a property to an asp.net element in on the page. The intellisense knows that the element is there and I get no errors when I build the project. It's just when I am running the website I get the null reference. I have been trying to fix this issue for a couple weeks now. Please Help. Thanks. Here is the code: protected void Page_PreRender(object sender, EventArgs e) { LoadData(); } private void LoadData() { Entities context = new Entities(); var types = (from t in context.CustomerTypes select t).OrderBy(t => t.TypeName); gvCustomerTypes.DataSource = types; gvCustomerTypes.DataBind(); } and on in the markup the gridview looks like this: <asp:GridView ID="gvCustomerTypes" runat="server" ShowHeader="true" GridLines="Both" AutoGenerateColumns="false" AlternatingRowStyle-BackColor="AliceBlue" Width="100%"> <Columns> <asp:TemplateField HeaderText="Customer Type Name" HeaderStyle-HorizontalAlign="Left" ItemStyle-HorizontalAlign="Left"> <ItemTemplate> <asp:Label ID="lblType" runat="server" Text='<%# Eval("TypeName") %>' /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Edit" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:HyperLink ID="HyperLink1" NavigateUrl='<%#Eval("CustomerTypeID", "CreateEditCustomerType.aspx?ID={0}") %>' Text="Edit" runat="server" /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Delete" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:LinkButton ID="LinkButton1" CommandName='<%#Eval("CustomerTypeID") %>' OnClientClick="javascript:return confirm('Are you sure you want to delete this Customer Type?');" OnCommand="DeleteCustomerType" Text="Delete" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView>

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

    - by Jack Roscoe
    Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • [C#] Problems with implementing generic IEnumerator and IComparable

    - by r0h
    Hi all! I'm working on an AVL Tree. The tree itself seems to be working but I need a iterator to walk through the values of the tree. Therefore I tried to implement the IEnumerator interace. Unfortunately I get a compile time error implementing IEnumerator and IComparable. First the code and below that the error. class AvlTreePreOrderEnumerator<T> : IEnumerator<T> where T :IComparable<T> { private AvlTreeNode<T> current = default(T); private AvlTreeNode<T> tree = null; private Queue<AvlTreeNode<T>> traverseQueue = null; public AvlTreePreOrderEnumerator(AvlTreeNode<T> tree) { this.tree = tree; //Build queue traverseQueue = new Queue<AvlTreeNode<T>>(); visitNode(this.tree.Root); } private void visitNode(AvlTreeNode<T> node) { if (node == null) return; else { traverseQueue.Enqueue(node); visitNode(node.LeftChild); visitNode(node.RightChild); } } public T Current { get { return current.Value; } } object IEnumerator.Current { get { return Current; } } public void Dispose() { current = null; tree = null; } public void Reset() { current = null; } public bool MoveNext() { if (traverseQueue.Count > 0) current = traverseQueue.Dequeue(); else current = null; return (current != null); } } The error given by VS2008: Error 1 The type 'T' cannot be used as type parameter 'T' in the generic type or method 'Opdr2_AvlTreeTest_Final.AvlTreeNode'. There is no boxing conversion or type parameter conversion from 'T' to 'System.IComparable'. For now I've not included the tree and node logic. I anybody thinks is necessary to resolve this probleem, just say so! Thx!

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • Linux, GNU GCC, ld, version scripts and the ELF binary format -- How does it work??

    - by themoondothshine
    Hey all, I'm trying to learn more about library versioning in Linux and how to put it all to work. Here's the context: -- I have two versions of a dynamic library which expose the same set of interfaces, say libsome1.so and libsome2.so. -- An application is linked against libsome1.so. -- This application uses libdl.so to dynamically load another module, say libmagic.so. -- Now libmagic.so is linked against libsome2.so. Obviously, without using linker scripts to hide symbols in libmagic.so, at run-time all calls to interfaces in libsome2.so are resolved to libsome1.so. This can be confirmed by checking the value returned by libVersion() against the value of the macro LIB_VERSION. -- So I try next to compile and link libmagic.so with a linker script which hides all symbols except 3 which are defined in libmagic.so and are exported by it. This works... Or at least libVersion() and LIB_VERSION values match (and it reports version 2 not 1). -- However, when some data structures are serialized to disk, I noticed some corruption. In the application's directory if I delete libsome1.so and create a soft link in its place to point to libsome2.so, everything works as expected and the same corruption does not happen. I can't help but think that this may be caused due to some conflict in the run-time linker's resolution of symbols. I've tried many things, like trying to link libsome2.so so that all symbols are alised to symbol@@VER_2 (which I am still confused about because the command nm -CD libsome2.so still lists symbols as symbol and not symbol@@VER_2)... Nothing seems to work!!! Help!!!!!! Edit: I should have mentioned it earlier, but the app in question is Firefox, and libsome1.so is libsqlite3.so shipped with it. I don't quite have the option of recompiling them. Also, using version scripts to hide symbols seems to be the only solution right now. So what really happens when symbols are hidden? Do they become 'local' to the SO? Does rtld have no knowledge of their existence? What happens when an exported function refers to a hidden symbol?

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • Correlation formula explanation needed d3.js

    - by divakar
    function getCorrelation(xArray, yArray) { alert(xArray); alert(yArray); function sum(m, v) {return m + v;} function sumSquares(m, v) {return m + v * v;} function filterNaN(m, v, i) {isNaN(v) ? null : m.push(i); return m;} // clean the data (because we know that some values are missing) var xNaN = _.reduce(xArray, filterNaN , []); var yNaN = _.reduce(yArray, filterNaN , []); var include = _.intersection(xNaN, yNaN); var fX = _.map(include, function(d) {return xArray[d];}); var fY = _.map(include, function(d) {return yArray[d];}); var sumX = _.reduce(fX, sum, 0); var sumY = _.reduce(fY, sum, 0); var sumX2 = _.reduce(fX, sumSquares, 0); var sumY2 = _.reduce(fY, sumSquares, 0); var sumXY = _.reduce(fX, function(m, v, i) {return m + v * fY[i];}, 0); var n = fX.length; var ntor = ( ( sumXY ) - ( sumX * sumY / n) ); var dtorX = sumX2 - ( sumX * sumX / n); var dtorY = sumY2 - ( sumY * sumY / n); var r = ntor / (Math.sqrt( dtorX * dtorY )); // Pearson ( http://www.stat.wmich.edu/s216/book/node122.html ) var m = ntor / dtorX; // y = mx + b var b = ( sumY - m * sumX ) / n; // console.log(r, m, b); return {r: r, m: m, b: b}; } I have finding correlation between the points i plot using this function which is not written by me. my xarray=[120,110,130,132,120,118,134,105,120,0,0,0,0,137,125,120,127,120,160,120,148] yarray=[80,70,70,80,70,62,69,70,70,62,90,42,80,72,0,0,0,0,78,82,68,60,58,82,60,76,86,82,70] I can t able to understand the function perfectly. Can anybody explain it with the data i pasted here. I also wanted to remove the zeros getting calculated from this function.

    Read the article

  • Passing password value through URL

    - by Steven Wright
    OK I see a lot of people asking about passing other values, URLS, random stuff through a URL, but don't find anything about sending a password to a password field. Here is my situation: I have a ton of sites I use on a daily basis with my work and oh about 90% require logins. Obviously remembering 80 bajillion logins for each site is dumb, especially when there are more than one user name I use for each site. So to make life easier, I drew up a nifty JSP app that stores all of my logins in a DB table and creates a user interface for the specific page I want to visit. Each page has a button that sends a username, password into the id parameters of the html inputs. Problem: I can get the usernames and other info to show up just dandy, but when I try and send a password to a password field, it seems that nothing gets received by the page I'm trying to hit. Is there some ninja stuff I need to be doing here or is it just not easily possible? Basically this is what I do now: http://addresshere/support?loginname=steveoooo&loginpass=passwordhere and some of my html looks like this: <form name="userform" method="post" action="index.jsp" > <input type="hidden" name="submit_login" value="y"> <table width="100%"> <tr class="main"> <td width="100" nowrap>Username:</td> <td><input type="text" name="loginname" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td>Password: </font></td> <td><input type="password" name="loginpass" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td><center><input type="submit" name="submit" value="Login"></center></td> </tr> </table> </form> Any suggestions?

    Read the article

  • How to reduce redundant code when adding new c++0x rvalue reference operator overloads

    - by Inverse
    I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

    Read the article

< Previous Page | 797 798 799 800 801 802 803 804 805 806 807 808  | Next Page >