Search Results

Search found 21301 results on 853 pages for 'duplicate values'.

Page 801/853 | < Previous Page | 797 798 799 800 801 802 803 804 805 806 807 808  | Next Page >

  • Find a base case for a recursive void method

    - by Evan S
    I am doing homework. I would like to build a base case for a recursion where ordering given numbers (list2) in ascending order. Purpose of writing this codes is that when all numbers are in ascending order then should stop calling a method called ascending(list2, list1); and all values in list2 should be shipped to list1. For instance, list2 = 6,5,4,3,2,1 then list2 becomes empty and list1 should be 1,2,3,4,5,6. I am trying to compare result with previous one and if matches then stop. But I can't find the base case to stop it. In addition, Both ascending() and fixedPoint() are void method. Anybody has idea? lol Took me 3 days... When I run my code then 6,5,4,3,2,1 5,6,4,3,2,1 4,5,6,3,2,1 3,4,5,6,2,1 2,3,4,5,6,1 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 infinite............. public class Flipper { public static void main(String[] args) { Flipper aFlipper = new Flipper(); List<Integer> content = Arrays.asList(6,5,4,3,2,1); ArrayList<Integer> l1 = new ArrayList<Integer>(content); ArrayList<Integer> l2 = new ArrayList<Integer>(); // empty list aFlipper.fixedPoint(l2,l1); System.out.println("fix l1 is "+l1); System.out.println("fix l2 is "+l2); } public void fixedPoint(ArrayList<Integer> list1, ArrayList<Integer> list2) { // data is in list2 ArrayList<Integer> temp1 = new ArrayList<Integer>(); // empty list if (temp1.equals(list2)) { System.out.println("found!!!"); } else { ascending(list2, list1); // data, null temp1 = list1; // store processed value System.out.println("st list1 is "+list1); System.out.println("st list2 is "+list2); } fixedPoint(list2, list1); // null, processed data }

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Android library to get pitch from WAV file

    - by Sakura
    I have a list of sampled data from the WAV file. I would like to pass in these values into a library and get the frequency of the music played in the WAV file. For now, I will have 1 frequency in the WAV file and I would like to find a library that is compatible with Android. I understand that I need to use FFT to get the frequency domain. Is there any good libraries for that? I found that [KissFFT][1] is quite popular but I am not very sure how compatible it is on Android. Is there an easier and good library that can perform the task I want? EDIT: I tried to use JTransforms to get the FFT of the WAV file but always failed at getting the correct frequency of the file. Currently, the WAV file contains sine curve of 440Hz, music note A4. However, I got the result as 441. Then I tried to get the frequency of G4, I got the result as 882Hz which is incorrect. The frequency of G4 is supposed to be 783Hz. Could it be due to not enough samples? If yes, how much samples should I take? //DFT DoubleFFT_1D fft = new DoubleFFT_1D(numOfFrames); double max_fftval = -1; int max_i = -1; double[] fftData = new double[numOfFrames * 2]; for (int i = 0; i < numOfFrames; i++) { // copying audio data to the fft data buffer, imaginary part is 0 fftData[2 * i] = buffer[i]; fftData[2 * i + 1] = 0; } fft.complexForward(fftData); for (int i = 0; i < fftData.length; i += 2) { // complex numbers -> vectors, so we compute the length of the vector, which is sqrt(realpart^2+imaginarypart^2) double vlen = Math.sqrt((fftData[i] * fftData[i]) + (fftData[i + 1] * fftData[i + 1])); //fd.append(Double.toString(vlen)); // fd.append(","); if (max_fftval < vlen) { // if this length is bigger than our stored biggest length max_fftval = vlen; max_i = i; } } //double dominantFreq = ((double)max_i / fftData.length) * sampleRate; double dominantFreq = (max_i/2.0) * sampleRate / numOfFrames; fd.append(Double.toString(dominantFreq)); Can someone help me out? EDIT2: I manage to fix the problem mentioned above by increasing the number of samples to 100000, however, sometimes I am getting the overtones as the frequency. Any idea how to fix it? Should I use Harmonic Product Frequency or Autocorrelation algorithms?

    Read the article

  • Matlab cell length

    - by AP
    Ok I seem to have got the most of the problem solved, I just need an expert eye to pick my error as I am stuck. I have a file of length [125 X 27] and I want to convert it to a file of length [144 x 27]. Now, I want to replace the missing files (time stamps) rows of zeros. (ideally its a 10 min daily average thus should have file length of 144) Here is the code I am using: fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); %//Make time a datenum of the first column time = datenum(data{1} , 'mm/dd/yyyy HH:MM') %//Find the difference in minutes from each row timeDiff = round(diff(datenum(time)*(24*60))) %//the rest of the data data = cell2mat(data(2:28)); newdata=zeros(144,27); for n=1:length(timeDiff) if timeDiff(n)==10 newdata(n,:)=data(n,:); newdata(n+1,:)=data(n+1,:); else p=timeDiff(n)/10 n=n+p; end end Can somebody please help me to find the error inside my for loop. My output file seems to miss few timestamped values. %*********************************************************************************************************** Can somebody help me to figure out the uiget to read the above file?? i am replacing fid = fopen('test.csv', 'rt'); data = textscan(fid, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); fclose(fid); With [c,pathc]=uigetfile({'*.txt'},'Select the file','C:\data'); file=[pathc c]; file= textscan(c, ['%s' repmat('%f',1,27)], 'HeaderLines', 1, 'Delimiter', ','); And its not working % NEW ADDITION to old question p = 1; %index into destination for n = 1:length(timeDiff) % if timeDiff(n) == 10 % newfile(p,:) = file(n,:); % newfile(p+1,:)=file(n+1,:); % p = p + 1; % else % p = p + (timeDiff(n)/10); % end q=cumsum(timeDiff(n)/10); if q==1 newfile(p,:)=file(n,:); p=p+1; else p = p + (timeDiff(n)/10); end end xlswrite('testnewws11.xls',newfile); even with the cumsum command this code fails when my file has 1,2 time stamps in middle of long missing ones example 8/16/2009 0:00 5.34 8/16/2009 0:10 3.23 8/16/2009 0:20 2.23 8/16/2009 0:30 1.23 8/16/2009 0:50 70 8/16/2009 2:00 5.23 8/16/2009 2:20 544 8/16/2009 2:30 42.23 8/16/2009 3:00 71.23 8/16/2009 3:10 3.23 My output looks like 5.34 3.23 2.23 0 0 0 0 0 0 0 0 0 5.23 544. 42.23 0 0 0 3.23 Any ideas?

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • how to handle a array of objects in a session

    - by Robert
    Hello, In the project I'm working on I have got a list List<Item> with objects that Is saved in a session. Session.Add("SessionName", List); In the Controller I build a viewModel with the data from this session var arrayList = (List<Item>)Session["SessionName"]; var arrayListItems= new List<CartItem>(); foreach (var item in arrayList) { var listItem = new Item { Amount = item.Amount, Variant= item.variant, Id = item.Id }; arrayListItems.Add(listItem); } var viewModel = new DetailViewModel { itemList = arrayListItems } and in my View I loop trough the list of Items and make a form for all of them to be able to remove the item. <table> <%foreach (var Item in Model.itemList) { %> <% using (Html.BeginForm()) { %> <tr> <td><%=Html.Hidden(Settings.Prefix + ".VariantId", Item .Variant.Id)%> <td> <%=Html.TextBox(Settings.Prefix + ".Amount", Item.Amount)%></td> <td> <%=Html.Encode(Item.Amount)%> </td> <td> <input type="submit" value="Remove" /> </td> </tr> <% } %> <% } %> </table> When the post from the submit button is handeld the item is removed from the array and post back exactly the same viewModel (with 1 item less in the itemList). return View("view.ascx", viewModel); When the post is handled and the view has reloaded the value's of the html.Hidden and Html.Textbox are the value's of the removed item. The value of the html.Encode is the correct value. When i reload the page the correct values are in the fields. Both times i build the viewModel the exact same way. I cant find the cause or solution of this error. I would be very happy with any help to solve this problem Thanx in advance for any tips or help

    Read the article

  • Change the Session Variable Output

    - by user567230
    Hello I am using Dreamweaver CS5 with Coldfusion 9 to build a dynamic website. I have a MS Access Database that stores login information which includes ID, FullName, FirstName, LastName, Username, Pawword, AcessLevels. My question is this: I currently have session variable to track the Username when it is entered into the login page. However I would like to use that Username to pull the User's FullName to display throughout the web pages and use for querying data. How do I change the session variable to read that when they are not entering their FullName on the login page but only Username and password. I have listed my login information code below if there is any additional information needed please let me know. This is the path for which the FullName values reside DataSource "Access" Table "Logininfo" Field "FullName" I want the FullName to be unique based on the Username submitted from the Login page. I apologize in advance for any rookie mistake I may have made I am new to this but learning fast! Ha. <cfif IsDefined("FORM.username")> <cfset MM_redirectLoginSuccess="members_page.cfm"> <cfset MM_redirectLoginFailed="sorry.cfm"> <cfquery name="MM_rsUser" datasource="Access"> SELECT FullName, Username,Password,AccessLevels FROM Logininfo WHERE Username=<cfqueryparam value="#FORM.username#" cfsqltype="cf_sql_clob" maxlength="50"> AND Password=<cfqueryparam value="#FORM.password#" cfsqltype="cf_sql_clob" maxlength="50"> </cfquery> <cfif MM_rsUser.RecordCount NEQ 0> <cftry> <cflock scope="Session" timeout="30" type="Exclusive"> <cfset Session.MM_Username=FORM.username> <cfset Session.MM_UserAuthorization=MM_rsUser.AccessLevels[1]> </cflock> <cfif IsDefined("URL.accessdenied") AND false> <cfset MM_redirectLoginSuccess=URL.accessdenied> </cfif> <cflocation url="#MM_redirectLoginSuccess#" addtoken="no"> <cfcatch type="Lock"> <!--- code for handling timeout of cflock ---> </cfcatch> </cftry> </cfif> <cflocation url="#MM_redirectLoginFailed#" addtoken="no"> <cfelse> <cfset MM_LoginAction=CGI.SCRIPT_NAME> <cfif CGI.QUERY_STRING NEQ ""> <cfset MM_LoginAction=MM_LoginAction & "?" & XMLFormat(CGI.QUERY_STRING)> </cfif> </cfif>

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • Perl: Compare and edit underlying structure in hash

    - by Mahfuzur Rahman Pallab
    I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

    Read the article

  • ASP.NET Elements are null when assigning data source

    - by deccks
    For some reason, all of the objects in my ASP.NET markup are now null when I try to assign values to their properties in the code behind. My project was going fine and then now when I try to assign a data source to a GridView, I get a null reference error. I have no idea why it's doing this. I am not doing nothing special. I am just trying to assign a value to a property to an asp.net element in on the page. The intellisense knows that the element is there and I get no errors when I build the project. It's just when I am running the website I get the null reference. I have been trying to fix this issue for a couple weeks now. Please Help. Thanks. Here is the code: protected void Page_PreRender(object sender, EventArgs e) { LoadData(); } private void LoadData() { Entities context = new Entities(); var types = (from t in context.CustomerTypes select t).OrderBy(t => t.TypeName); gvCustomerTypes.DataSource = types; gvCustomerTypes.DataBind(); } and on in the markup the gridview looks like this: <asp:GridView ID="gvCustomerTypes" runat="server" ShowHeader="true" GridLines="Both" AutoGenerateColumns="false" AlternatingRowStyle-BackColor="AliceBlue" Width="100%"> <Columns> <asp:TemplateField HeaderText="Customer Type Name" HeaderStyle-HorizontalAlign="Left" ItemStyle-HorizontalAlign="Left"> <ItemTemplate> <asp:Label ID="lblType" runat="server" Text='<%# Eval("TypeName") %>' /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Edit" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:HyperLink ID="HyperLink1" NavigateUrl='<%#Eval("CustomerTypeID", "CreateEditCustomerType.aspx?ID={0}") %>' Text="Edit" runat="server" /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Delete" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:LinkButton ID="LinkButton1" CommandName='<%#Eval("CustomerTypeID") %>' OnClientClick="javascript:return confirm('Are you sure you want to delete this Customer Type?');" OnCommand="DeleteCustomerType" Text="Delete" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView>

    Read the article

  • Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

    - by Jack Roscoe
    Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

    Read the article

  • How to reduce redundant code when adding new c++0x rvalue reference operator overloads

    - by Inverse
    I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

    Read the article

  • [C#] Problems with implementing generic IEnumerator and IComparable

    - by r0h
    Hi all! I'm working on an AVL Tree. The tree itself seems to be working but I need a iterator to walk through the values of the tree. Therefore I tried to implement the IEnumerator interace. Unfortunately I get a compile time error implementing IEnumerator and IComparable. First the code and below that the error. class AvlTreePreOrderEnumerator<T> : IEnumerator<T> where T :IComparable<T> { private AvlTreeNode<T> current = default(T); private AvlTreeNode<T> tree = null; private Queue<AvlTreeNode<T>> traverseQueue = null; public AvlTreePreOrderEnumerator(AvlTreeNode<T> tree) { this.tree = tree; //Build queue traverseQueue = new Queue<AvlTreeNode<T>>(); visitNode(this.tree.Root); } private void visitNode(AvlTreeNode<T> node) { if (node == null) return; else { traverseQueue.Enqueue(node); visitNode(node.LeftChild); visitNode(node.RightChild); } } public T Current { get { return current.Value; } } object IEnumerator.Current { get { return Current; } } public void Dispose() { current = null; tree = null; } public void Reset() { current = null; } public bool MoveNext() { if (traverseQueue.Count > 0) current = traverseQueue.Dequeue(); else current = null; return (current != null); } } The error given by VS2008: Error 1 The type 'T' cannot be used as type parameter 'T' in the generic type or method 'Opdr2_AvlTreeTest_Final.AvlTreeNode'. There is no boxing conversion or type parameter conversion from 'T' to 'System.IComparable'. For now I've not included the tree and node logic. I anybody thinks is necessary to resolve this probleem, just say so! Thx!

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • Passing password value through URL

    - by Steven Wright
    OK I see a lot of people asking about passing other values, URLS, random stuff through a URL, but don't find anything about sending a password to a password field. Here is my situation: I have a ton of sites I use on a daily basis with my work and oh about 90% require logins. Obviously remembering 80 bajillion logins for each site is dumb, especially when there are more than one user name I use for each site. So to make life easier, I drew up a nifty JSP app that stores all of my logins in a DB table and creates a user interface for the specific page I want to visit. Each page has a button that sends a username, password into the id parameters of the html inputs. Problem: I can get the usernames and other info to show up just dandy, but when I try and send a password to a password field, it seems that nothing gets received by the page I'm trying to hit. Is there some ninja stuff I need to be doing here or is it just not easily possible? Basically this is what I do now: http://addresshere/support?loginname=steveoooo&loginpass=passwordhere and some of my html looks like this: <form name="userform" method="post" action="index.jsp" > <input type="hidden" name="submit_login" value="y"> <table width="100%"> <tr class="main"> <td width="100" nowrap>Username:</td> <td><input type="text" name="loginname" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td>Password: </font></td> <td><input type="password" name="loginpass" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td><center><input type="submit" name="submit" value="Login"></center></td> </tr> </table> </form> Any suggestions?

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • Java Best Practice for type resolution at runtime.

    - by Brian
    I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

    Read the article

< Previous Page | 797 798 799 800 801 802 803 804 805 806 807 808  | Next Page >