Search Results

Search found 12924 results on 517 pages for 'module pattern'.

Page 84/517 | < Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >

  • Why does my Net::Telnet program timeout?

    - by user304852
    I'm written small code to connect to remote server using Perl but observing error messages #!/usr/bin/perl -w use Net::Telnet; $telnet = new Net::Telnet ( Timeout=>60, Errmode=>'die'); $telnet->open('192.168.50.40'); $telnet->waitfor('/login:/'); $telnet->print('queen'); $telnet->waitfor('/password:/'); $telnet->print('kinG!'); $telnet->waitfor('/:/'); $telnet->print('vol >> C:\result.txt'); $telnet->waitfor('/:/'); $telnet->cmd("mkdir vol"); $telnet->print('mkdir vol234'); $telnet->cmd("mkdir vol1"); $telnet->waitfor('/\$ $/i'); $telnet->print('whoamI'); print $output; But while running i'm getting following errors C:\>perl -c E:\test\net.pl E:\test\net.pl syntax OK C:\>perl E:\test\net.pl command timed-out at E:\test\net.pl line 13 C:\> Help me in this regard.. i'm not much aware of perl

    Read the article

  • Drupal image management

    - by vian
    Please suggest how should I approach these requirements. What ready-to-use solutions (modules) are best suited to achieve something like this: What I need is an image library that has searchable, tagged images that are already resized when we publish them. If the author searches the library and the image he needs isn’t there, he can upload one and have it added to the index. The important thing is that images in the library can be sorted into three categories: News images, top story images and feature images so that, over time, we don’t end up with hundreds of images crammed into one folder, thus making browsing a pain (and to prevent someone from something like: Searching for a keyword so they can find an image for the news, picking an image, and then seeing it’s 1600X. 1200). Also, I need something which will assemble thumbnail galleries easily. I don’t want to have to go to the image library, get a URL, go back, paste it in, etc. I should be able to pick, say, 8 images and say “create gallery”. How this objective is achieved is flexible, but I am looking for a shortcut to get around assembling screenshot galleries by hand.

    Read the article

  • How can I write a clean Repository without exposing IQueryable to the rest of my application?

    - by Simucal
    So, I've read all the Q&A's here on SO regarding the subject of whether or not to expose IQueryable to the rest of your project or not (see here, and here), and I've ultimately decided that I don't want to expose IQueryable to anything but my Model. Because IQueryable is tied to certain persistence implementations I don't like the idea of locking myself into this. Similarly, I'm not sure how good I feel about classes further down the call chain modifying the actual query that aren't in the repository. So, does anyone have any suggestions for how to write a clean and concise Repository without doing this? One problem I see, is my Repository will blow up from a ton of methods for various things I need to filter my query off of. Having a bunch of: IEnumerable GetProductsSinceDate(DateTime date); IEnumberable GetProductsByName(string name); IEnumberable GetProductsByID(int ID); If I was allowing IQueryable to be passed around I could easily have a generic repository that looked like: public interface IRepository<T> where T : class { T GetById(int id); IQueryable<T> GetAll(); void InsertOnSubmit(T entity); void DeleteOnSubmit(T entity); void SubmitChanges(); } However, if you aren't using IQueryable then methods like GetAll() aren't really practical since lazy evaluation won't be taking place down the line. I don't want to return 10,000 records only to use 10 of them later. What is the answer here? In Conery's MVC Storefront he created another layer called the "Service" layer which received IQueryable results from the respository and was responsible for applying various filters. Is this what I should do, or something similar? Have my repository return IQueryable but restrict access to it by hiding it behind a bunch of filter classes like GetProductByName, which will return a concrete type like IList or IEnumerable?

    Read the article

  • Using C# and Repository Factory and the error: The requested database is not defined in configurati

    - by odiseh
    hi I am using Repository factory for visual studio 2008 for a personal project. It generated a class called ProductRepository which inherits from Repository. The ProductRepository has a constructor which gets a database name as string and passes it to its base (I mean Repository ). So when I try to debug my project step by step, I pass my database name to ProductRepository but it raises the following error: The requested database is not defined in configuration. What's wrong?

    Read the article

  • Very simple regex not working

    - by Thomas Wanner
    I have read that to match a word inside of a string using Regular expressions (in .NET), I can use the word boundary specifier (\b) within the regex. However, none of these calls result in any matches Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\b@p1\b"); Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\bINSERT\b"); Is there anything I am doing wrong ?

    Read the article

  • running a command in remote machine by using perl

    - by Bharath Kumar
    Hi All, I'm using following code to connect to a remote machine and try to execute one simple command on remote machine. cat tt.pl !/usr/bin/perl use strict; use warnings; use Net::Telnet; $telnet = new Net::Telnet ( Timeout=2, Errmode='die'); $telnet-open('172.168.12.58'); $telnet-waitfor('/login:\s*/'); $telnet-print('admin'); $telnet-waitfor('/password:\s*/'); $telnet-print('Blue'); $telnet-cmd('ver C:\log.txt'); $telnet-cmd('mkdir gy'); You have new mail in /var/spool/mail/root [root@localhost]# But when i'm executing this script it is throwing error messages [root@localhost]# perl tt.pl command timed-out at tt.pl line 12 [root@localhost]# Please help me in this

    Read the article

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • how to do this in shell

    - by user150674
    I have a very large file, named 'ColCheckMe', tab-delimited, that you are asked to process. You are told that each line in 'ColCheckMe' has 7 columns, and that the values in the 5th column are integers. Using shell functions indicate how you would verify that these conditions are satisfied in 'ColCheckMe' if In the same file, each value in column 1 is unique. How would I verify that? Also how to write a shell function that counts the number of occurrences of the word “SpecStr” in the file 'ColCheckMe' I tried the first part which checks for the valid number of field and checks the 5th field being integer field. nawk ' NF != 7 { printf("[%d] has invalid [%d] number of fields\n", FNR, NF) } $5 !~ /^[0-9]+$/ { printf("[%d] 5th field is invalid [%s]\n", FNR, $5) }' ColCheckMe now i wanna verify in the same file if the value in column 1 is unique. Also is there a way to write a shell function to count the occurrences of the world "SpecStr" in the file 'ColCheckMe' Thanks a lot

    Read the article

  • How to populate object dependencies with routing bapi

    - by Ben V
    I'm using BAPI_ROUTING_CREATE to interface routing creation/changes from an external system. There doesn't seem to be a way to pass VC object dependencies for each operation. Does anyone know of a way to programmatically update object dependencies? I'd prefer to avoid BDCs if possible.

    Read the article

  • Regex to parse a multiline HTML

    - by dreamer
    am trying to parse a multi-line html file using regex. HTML code: < td>Details< /td> < /tr> < tr class=d1> < td>uss_vod_translator< /td> Regex Expression: if ($line =~ m/Details<\/td>\s*<\/tr>\s*<tr\s*class=d1>\s*<td>(\w*)<\/td>/) { print "$1"; } I am using /s* (space) for multi-line, but it is not working. I searched about it, even used /\? for multi-line but that too did not work. Can any one please suggest me how to parse a multiline HTML?

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Self logging modules without Moose

    - by stephenmm
    I have the same question as was asked here but unfortunately I cannot install Moose and I think the solution described there was particular to Moose. Can someone tell me how to the same in old school "use base" speak? To reiterate the question, I would like to have my base classes to have an automatic logging mechanism so if the user does not do anything I get some reasonable logging but if the user of my class needs/wants to overwrite it they can.

    Read the article

  • drupal what if we have designed a content type with existing fields

    - by rakeshakurathi
    i have small problem.... i have one content type say cars with various fields, say more than 30 , user can create the content types... now i would like to show only few fields in different phases,is there any possibility to do that. more explantaion:- user may enter the car model and car details in the first page and upload images in second page.(say a popup in the block) is this is possible ? i m newbie to drupal, i would like to do this kind of data updation, i though with designing a one more content type with the existing fields, can any one explain this issue... what if i design a content type car1 with same fields say(file uplaod) in car content type.

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • ASP-style tags for Perl web development?

    - by Alex R
    I feel like I'm traveling 10 years back in time by asking this, but... Are there any modules, patches, or any "new" version of Perl (released in the last 10 years) to enable writing web-oriented Perl scripts using ASP-style tags? e.g. from ASP/JSP some html <% some code %> more HTML e.g. from PHP some html <? some code ?> more HTML Please don't worry about "why" I'm asking this... It's related to programming language research.

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

< Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >