Search Results

Search found 22641 results on 906 pages for 'use case'.

Page 840/906 | < Previous Page | 836 837 838 839 840 841 842 843 844 845 846 847  | Next Page >

  • Asp.net MVC jquery-ajax dont render html

    - by Troublesum
    Hi, Im trying to use jqeury ajax with MVC i can get it to post back to the action i want and it returns the ViewData objects with updated Data but never renders the HTML. I have i View which contains some MVC User Controls and i want them to update on a timer. Here is my View Markup <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/PageWithSummaryViewAndTabs.Master" Inherits="System.Web.Mvc.ViewPage" %> <asp:Content ID="FullCaseTitle" ContentPlaceHolderID="TitleContent" runat="server"> </asp:Content> <asp:Content ID="FullCaseContent" ContentPlaceHolderID="MainContent" runat="server"> <script type="text/javascript"> window.setInterval(test, 5000); function test() { jQuery.get("/PatientCase/RefreshEPRF", function(response) { }); } </script> <div id="loadingDiv" style="display:none">Updating</div> <input id="refreshPatientCaseIndexButton" type="submit" visible="true" title="refresh" value="Refresh" /> <h2>Full Case</h2> <div id="EPRFContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> </div> <div id="ImageContent"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionImagery.ascx"); % On postback i call a Action Called RefreshEPRF which loads just the required user controls again <%@ Page Language="C#" Inherits="System.Web.Mvc.ViewPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <%Html.RenderPartial(@"~/Views/PatientCase/SectionEPRF.ascx"); %> <%Html.RenderPartial(@"~/Views/PatientCase/SectionDrugs.ascx"); %> And finaly the marpup in the control <table id="detailstable"> <tr><td id="detailslablecolumn">Patient Name : </td><td> <% foreach (var item in (List<STS_Lite.Models.PatinetCase.EPRFItem>)ViewData["EPRF"]) { if (item.datumItemId == 46) { if (item.Stroke) { %> <img src="/PatientCaseIndex/InkImageData/GetInkImage/<%=ViewData["PatientCaseId"]%>/<%=ViewData["TemplateInstanceId"]%>/<%=item.TemplateItemId %>" /> <% } else {%> <%=item.Value.ToString()%> <%} break; } } %></td></tr><table> When i step through this code the ViewData in the user control has the new updated values but the page comes back with no new values. I have tried the jquery.get and ajax but with no luck. Any help would be great thanks

    Read the article

  • Android Bluetooth Fails to Pair

    - by CaseyB
    I am having a problem getting my devices to pair in Android. If I go into the settings and pair them manually I can get them to connect using the following code: Server // Make sure the device it discoverable mServerSocket = mAdapter.listenUsingRfcommWithServiceRecord("Moo Productions Bluetooth Server", mUUID); mState = State.ACCEPTING; BluetoothSocket socket = mServerSocket.accept(); mServerSocket.close(); connected(socket); Client Set<BluetoothDevice> pairedDevices = mAdapter.getBondedDevices(); BluetoothSocket socket = null; // Search the list of paired devices for the right one for(BluetoothDevice device : pairedDevices) { try { mState = State.SEARCHING; socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); connected(socket); break; } catch (IOException e) { socket = null; continue; } } But if the devices hadn't already been paired it gets out of the foreach without connecting to a valid socket. In that case I start discovering. // If that didn't work, discover if(socket == null) { mState = State.SEARCHING; mReceiver = new SocketReceiver(); mContext.registerReceiver(mReceiver, new IntentFilter(BluetoothDevice.ACTION_FOUND)); mAdapter.startDiscovery(); } // ... Later ... private class SocketReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if(BluetoothDevice.ACTION_FOUND.equals(intent.getAction())) { try { // Get the device and try to open a socket BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); BluetoothSocket socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); // This is our boy, so stop looking mAdapter.cancelDiscovery(); mContext.unregisterReceiver(mReceiver); connected(socket); } catch (IOException ioe) { ioe.printStackTrace(); } } } } But it will never find the other device. I never get a pairing dialog and when I step through I see that it discovers the correct device, but it fails to connect with this exception java.io.IOException: Service discovery failed. Any ideas as to what I'm missing?

    Read the article

  • How to navigate to another html page?

    - by newbie
    In my application there's a usual login page sending username and password to the server script, where it needs to be authenticated, and in case of an authentic user, the server should redirect to a page student.html. This is my code var ports = 3000; var portt = 3001; var express = require('express'); var student = require('express')(); var teacher = require('express')(); var server_s = require('http').createServer(student); var server_t = require('http').createServer(teacher); var ios = require('socket.io').listen(server_s); var iot = require('socket.io').listen(server_t); var path = require('path'); server_s.listen(ports); server_t.listen(portt); student.use(express.static(path.join(__dirname, 'public'))); student.get('/', function(req,res){ res.sendfile(__dirname + '/login.html'); }); teacher.use(express.static(path.join(__dirname, 'public'))); teacher.get('/', function(req,res){ res.sendfile(__dirname + '/mytry.html'); }); ios.sockets.on('connection', function(socket){ var username, password; socket.on('check',function(data){ username = data[0]; password = data[1]; //************* Database connection and query ************* var mysql = require('mysql'); var connection = mysql.createConnection({ host : 'localhost', user : 'user', password: '*******', database: 'my_db' }); connection.connect(); var qstring = 'SELECT s_id FROM login_student WHERE username='+username+'AND password='+password; connection.query(qstring, function(err, rows, fields) { if (err) { console.log('ERROR: ' + err); socket.emit('login_failure','DB error'); return; } console.log('The solution is: ', rows[0].solution); if (rows>0) //***** Here i want redirection to another page ****** else socket.emit('login_failure','Invalid Username or password'); }); connection.end(); }); }); iot.sockets.on('connection', function(socket){ ; }); }); Can anyone suggest what should I do?

    Read the article

  • How can I create a Base64-Encoded string from an GDI+ Image in C++?

    - by Schnapple
    I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

    Read the article

  • SQL/Schema comparison and upgrade

    - by Workshop Alex
    I have a simple situation. A large organisation is using several different versions of some (desktop) application and each version has it's own database structure. There are about 200 offices and each office will have it's own version, which can be one of 7 different ones. The company wants to upgrade all applications to the latest versions, which will be version 8. The problem is that they don't have a separate database for each version. Nor do they have a separate database for each office. They have one single database which is handled by a dedicated server, thus keeping things like management and backups easier. Every office has it's own database schema and within the schema there's the whole database structure for their specific application version. As a result, I'm dealing with 200 different schema's which need to be upgraded, each with 7 possible versions. Fortunately, every schema knows the proper version so checking the version isn't difficult. But my problem is that I need to create upgrade scripts which can upgrade from version 1 to version 2 to version 3 to etc... Basically, all schema's need to be bumped up one version until they're all version 8. Writing the code that will do this is no problem. the challenge is how to create the upgrade script from one version to the other? Preferably with some automated tool. I've examined RedGate's SQL Compare and Altova's DatabaseSpy but they're not practical. Altova is way too slow. RedGate requires too much processing afterwards, since the generated SQL Script still has a few errors and it refers to the schema name. Furthermore, the code needs to become part of a stored procedure and the code generated by RedGate doesn't really fit inside a single procedure. (Plus, it's doing too much transaction-handling, while I need everything within a single transaction. I have been considering using another SQL Comparison tool but it seems to me that my case is just too different from what standard tools can deliver. So I'm going to write my own comparison tool. To do this, I'll be using ADOX with Delphi to read the catalogues for every schema version in the database, then use this to write the SQL Statements that will need to upgrade these schema's to their next version. (Comparing 1 with 2, 2 with 3, 3 with 4, etc.) I'm not unfamiliar with generating SQL-Script-Generators so I don't expect too many problems. And I'll only be upgrading the table structures, not any of the other database objects. So, does anyone have some good tips and tricks to apply when doing this kind of comparisons? Things to be aware of? Practical tips to increase speed?

    Read the article

  • GHC.Generics and Type Families

    - by jberryman
    This is a question related to my module here, and is simplified a bit. It's also related to this previous question, in which I oversimplified my problem and didn't get the answer I was looking for. I hope this isn't too specific, and please change the title if you can think if a better one. Background My module uses a concurrent chan, split into a read side and write side. I use a special class with an associated type synonym to support polymorphic channel "joins": {-# LANGUAGE TypeFamilies #-} class Sources s where type Joined s newJoinedChan :: IO (s, Messages (Joined s)) -- NOT EXPORTED --output and input sides of channel: data Messages a -- NOT EXPORTED data Mailbox a instance Sources (Mailbox a) where type Joined (Mailbox a) = a newJoinedChan = undefined instance (Sources a, Sources b)=> Sources (a,b) where type Joined (a,b) = (Joined a, Joined b) newJoinedChan = undefined -- and so on for tuples of 3,4,5... The code above allows us to do this kind of thing: example = do (mb , msgsA) <- newJoinedChan ((mb1, mb2), msgsB) <- newJoinedChan --say that: msgsA, msgsB :: Messages (Int,Int) --and: mb :: Mailbox (Int,Int) -- mb1,mb2 :: Mailbox Int We have a recursive action called a Behavior that we can run on the messages we pull out of the "read" end of the channel: newtype Behavior a = Behavior (a -> IO (Behavior a)) runBehaviorOn :: Behavior a -> Messages a -> IO () -- NOT EXPORTED This would allow us to run a Behavior (Int,Int) on either of msgsA or msgsB, where in the second case both Ints in the tuple it receives actually came through separate Mailboxes. This is all tied together for the user in the exposed spawn function spawn :: (Sources s) => Behavior (Joined s) -> IO s ...which calls newJoinedChan and runBehaviorOn, and returns the input Sources. What I'd like to do I'd like users to be able to create a Behavior of arbitrary product type (not just tuples) , so for instance we could run a Behavior (Pair Int Int) on the example Messages above. I'd like to do this with GHC.Generics while still having a polymorphic Sources, but can't manage to make it work. spawn :: (Sources s, Generic (Joined s), Rep (Joined s) ~ ??) => Behavior (Joined s) -> IO s The parts of the above example that are actually exposed in the API are the fst of the newJoinedChan action, and Behaviors, so an acceptable solution can modify one or all of runBehaviorOn or the snd of newJoinedChan. I'll also be extending the API above to support sums (not implemented yet) like Behavior (Either a b) so I hoped GHC.Generics would work for me. Questions Is there a way I can extend the API above to support arbitrary Generic a=> Behavior a? If not using GHC's Generics, are there other ways I can get the API I want with minimal end-user pain (i.e. they just have to add a deriving clause to their type)?

    Read the article

  • Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

    - by Ian Leslie
    I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

    Read the article

  • How to efficently build an interpreter (lexer+parser) in C?

    - by Rizo
    I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

    Read the article

  • using AsyncTask class for parallel operationand displaying a progress bar

    - by Kumar
    I am displaying a progress bar using Async task class and simulatneously in parallel operation , i want to retrieve a string array from a function of another class that takes some time to return the string array. The problem is that when i place the function call in doing backgroung function of AsyncTask class , it gives an error in Doing Background and gives the message as cant change the UI in doing Background .. Therefore , i placed the function call in post Execute method of Asynctask class . It doesnot give an error but after the progress bar has reached 100% , then the screen goes black and takes some time to start the new activity. How can i display the progress bar and make the function call simultaneously.??plz help , m in distress here is the code package com.integrated.mpr; import android.app.Activity; import android.app.ProgressDialog; import android.content.Intent; import android.os.AsyncTask; import android.os.Bundle; import android.os.Handler; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class Progess extends Activity implements OnClickListener{ static String[] display = new String[Choose.n]; Button bprogress; @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.progress); bprogress = (Button) findViewById(R.id.bProgress); bprogress.setOnClickListener(this); } @Override public void onClick(View v) { // TODO Auto-generated method stub switch(v.getId()){ case R.id.bProgress: String x ="abc"; new loadSomeStuff().execute(x); break; } } public class loadSomeStuff extends AsyncTask<String , Integer , String>{ ProgressDialog dialog; protected void onPreExecute(){ dialog = new ProgressDialog(Progess.this); dialog.setProgressStyle(ProgressDialog.STYLE_HORIZONTAL); dialog.setMax(100); dialog.show(); } @Override protected String doInBackground(String... arg0) { // TODO Auto-generated method stub for(int i = 0 ;i<40;i++){ publishProgress(5); try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } dialog.dismiss(); String y ="abc"; return y; } protected void onProgressUpdate(Integer...progress){ dialog.incrementProgressBy(progress[0]); } protected void onPostExecute(String result){ display = new Logic().finaldata(); Intent openList = new Intent("com.integrated.mpr.SENSITIVELIST"); startActivity(openList); } } }

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • When to call glEnable(GL_FRAMEBUFFER_SRGB)?

    - by Steven Lu
    I have a rendering system where I draw to an FBO with a multisampled renderbuffer, then blit it to another FBO with a texture in order to resolve the samples in order to read off the texture to perform post-processing shading while drawing to the backbuffer (FBO index 0). Now I'd like to get some correct sRGB output... The problem is the behavior of the program is rather inconsistent between when I run it on OS X and Windows and this also changes depending on the machine: On Windows with the Intel HD 3000 it will not apply the sRGB nonlinearity but on my other machine with a Nvidia GTX 670 it does. On the Intel HD 3000 in OS X it will also apply it. So this probably means that I'm not setting my GL_FRAMEBUFFER_SRGB enable state at the right points in the program. However I can't seem to find any tutorials that actually tell me when I ought to enable it, they only ever mention that it's dead easy and comes at no performance cost. I am currently not loading in any textures so I haven't had a need to deal with linearizing their colors yet. To force the program to not simply spit back out the linear color values, what I have tried is simply comment out my glDisable(GL_FRAMEBUFFER_SRGB) line, which effectively means this setting is enabled for the entire pipeline, and I actually redundantly force it back on every frame. I don't know if this is correct or not. It certainly does apply a nonlinearization to the colors but I can't tell if this is getting applied twice (which would be bad). It could apply the gamma as I render to my first FBO. It could do it when I blit the first FBO to the second FBO. Why not? I've gone so far as to take screen shots of my final frame and compare raw pixel color values to the colors I set them to in the program: I set the input color to RGB(1,2,3) and the output is RGB(13,22,28). That seems like quite a lot of color compression at the low end and leads me to question if the gamma is getting applied multiple times. I have just now gone through the sRGB equation and I can verify that the conversion seems to be only applied once as linear 1/255, 2/255, and 3/255 do indeed map to sRGB 13/255, 22/255, and 28/255 using the equation 1.055*C^(1/2.4)+0.055. Given that the expansion is so large for these low color values it really should be obvious if the sRGB color transform is getting applied more than once. So, I still haven't determined what the right thing to do is. does glEnable(GL_FRAMEBUFFER_SRGB) only apply to the final framebuffer values, in which case I can just set this during my GL init routine and forget about it hereafter?

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • Passing objects to a UITypeEditor

    - by Kath
    I am currently hoping to use a PropertyGrid to allow users to edit some of my classes, however I've hit a wall with passing objects to the UITypeEditor(s) they use. When the user presses the drop down I want to show a listbox of already loaded textures to choose from, if they want to use a texture the application hasn't loaded yet they can click a button to choose one from a file dialog. In case I make no sense here a mock of the form: . My problem: To fill the listbox I need access to the class that manages the list of resources from the UITypeEditor. Now I've solved this problem for my own classes by giving them a reference on creation to their managing object. In the UITypeEditor I then use that reference to access what I need. However I can't do this for classes I haven't written, such as the XNA Texture2D class. Here are what the classes I'm using look like: class StaticGeometryChunk { // Geometry data to draw with. Contains a reference to its managing // class for use in its UITypeEditor. public GeometryData { get; set; } .... } class Material { // These are XNA classes. I can't just add a reference to its managing // class (I think?). public Texture2D Texture1 { get; set; } public Texture2D Texture2 { get; set; } .... } I've been looking at my options and they seem to be: Make the managing classes static. I don't really want to do this. There are several managing classes as each resource is loaded differently. There are also classes that need to be created before these and are passed in. Make the managing classes singletons. I don't really want to do this either. It seems like a quick and dirty way to "hide" the problem instead of "solve" it. I also might want the option of having several managing classes in the future which the singletons eliminate. Create a wrapper class which holds the reference to a managing class and its target (such as the XNA Texture2D). This is currently what I'm thinking of doing. Its would be quite simple and quick to do but something about it nags me but I don't know what. Any thoughts on the above or other methods to pass what I need into the UITypeEditor? Thank you for reading.

    Read the article

  • How do I update with a newly-created detached entity using NHibernate?

    - by Daniel T.
    Explanation: Let's say I have an object graph that's nested several levels deep and each entity has a bi-directional relationship with each other. A -> B -> C -> D -> E Or in other words, A has a collection of B and B has a reference back to A, and B has a collection of C and C has a reference back to B, etc... Now let's say I want to edit some data for an instance ofC. In Winforms, I would use something like this: var instanceOfC; using (var session = SessionFactory.OpenSession()) { // get the instance of C with Id = 3 instanceOfC = session.Linq<C>().Where(x => x.Id == 3); } SendToUIAndLetUserUpdateData(instanceOfC); using (var session = SessionFactory.OpenSession()) { // re-attach the detached entity and update it session.Update(instanceOfC); } In plain English, we grab a persistent instance out of the database, detach it, give it to the UI layer for editing, then re-attach it and save it back to the database. Problem: This works fine for Winform applications because we're using the same entity all throughout, the only difference being that it goes from persistent to detached to persistent again. The problem occurs when I'm using a web service and a browser, sending over JSON data. In this case, the data that comes back is no longer a detached entity, but rather a transient one that just happens to have the same ID as the persistent one. If I use this entity to update, it will wipe out the relationship to B and D unless I sent the entire object graph over to the UI and got it back in one piece. Question: My question is, how do I serialize detached entities over the web, receive them back, and save them, while preserving any relationships that I didn't explicitly change? I know about ISession.SaveOrUpdateCopy and ISession.Merge() (they seem to do the same thing?), but this will still wipe out the relationships if I don't explicitly set them. I could copy the fields from the transient entity to the persistent entity one by one, but this doesn't work too well when it comes to relationships and I'd have to handle version comparisons manually.

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Backtracking infinite loop

    - by Greenhorn
    This is Exercise 28.1.2 from HtDP. I've successfully implemented the neighbors function and all test cases pass. (define Graph (list (list 'A (list 'B 'E)) (list 'B (list 'E 'F)) (list 'C (list 'D)) (list 'D empty) (list 'E (list 'C 'F)) (list 'F (list 'D 'G)) (list 'G empty))) (define (first-line n alist) (cond [(symbol=? (first alist) n) alist] [else empty])) ;; returns empty if node is not in graph (define (neighbors n g) (cond [(empty? g) empty] [(cons? (first g)) (cond [(symbol=? (first (first g)) n) (first-line n (first g))] [else (neighbors n (rest g))])])) ; test cases (equal? (neighbors 'A Graph) (list 'A (list 'B 'E))) (equal? (neighbors 'B Graph) (list 'B (list 'E 'F))) (equal? (neighbors 'C Graph) (list 'C (list 'D))) (equal? (neighbors 'D Graph) (list 'D empty)) (equal? (neighbors 'E Graph) (list 'E (list 'C 'F))) (equal? (neighbors 'F Graph) (list 'F (list 'D 'G))) (equal? (neighbors 'G Graph) (list 'G empty)) (equal? (neighbors 'H Graph) empty) The problem comes when I copy-paste the code from Figure 77 of the text. It is supposed to determine whether a destination node is reachable from an origin node. However it appears that the code goes into an infinite loop except for the most trivial case where the origin and destination nodes are the same. ;; find-route : node node graph -> (listof node) or false ;; to create a path from origination to destination in G ;; if there is no path, the function produces false (define (find-route origination destination G) (cond [(symbol=? origination destination) (list destination)] [else (local ((define possible-route (find-route/list (neighbors origination G) destination G))) (cond [(boolean? possible-route) false] [else (cons origination possible-route)]))])) ;; find-route/list : (listof node) node graph -> (listof node) or false ;; to create a path from some node on lo-Os to D ;; if there is no path, the function produces false (define (find-route/list lo-Os D G) (cond [(empty? lo-Os) false] [else (local ((define possible-route (find-route (first lo-Os) D G))) (cond [(boolean? possible-route) (find-route/list (rest lo-Os) D G)] [else possible-route]))])) Does the problem lie in my code? Thank you.

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • A NSMutableArray is destroying my life!

    - by camilo
    EDITED to show the relevant part of the code Hi. There's a strange problem with an NSMutableArray which I'm just not understanding... Explaining: I have a NSMutableArray, defined as a property (nonatomic, retain), synthesized, and initialized with 29 elements. realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; After the initialization, I can insert elements as I wish and everything seems to be working fine. While I'm running the application, however, if I insert a new element in the array, I can print the array in the function where I inserted the element, and everything seems ok. However, when I select a row in the table, and I need to read that array, my application crashes. In fact, it cannot even print the array anymore. Is there any "magical and logical trick" everybody should know when using a NSMutableArray that a beginner like myself can be missing? Thanks a lot. I declare my array as realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; I insert objects in my array with [realSectionNames addObject:[category categoryFirstLetter]]; although I know i can also insert it with [realSectionNames insertObject:[category categoryFirstLetter] atIndex:i]; where the "i" is the first non-occupied position. After the insertion, I reload the data of my tableView. Printing the array before or after reloading the data shows it has the desired information. After that, selecting a row at the table makes the application crash. This realSectionNames is used in several UITableViewDelegate functions, but for the case it doesn't matter. What truly matters is that printing the array in the beginning of the didSelectRowAtIndexPath function crashes everything (and of course, doesn't print anything). I'm pretty sure it's in that line, for printing anything he line before works (example): NSLog(@"Anything"); NSLog(@"%@", realSectionNames); gives the output: 2010-03-24 15:16:04.146 myApplicationExperience[3527:207] Anything [Session started at 2010-03-24 15:16:04 +0000.] GNU gdb 6.3.50-20050815 (Apple version gdb-967) (Tue Jul 14 02:11:58 UTC 2009) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 3527. Still not understanding what kind of stupidity I've done this time... maybe it's not too late to follow the career of brain surgeon?

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • markdown to HTML with customised WMD editor

    - by spirytus
    For my application I customized slightly the way WMD behaves so when user enters empty lines, these are reflected in HTML output as <br />'s. Now I came to a point when I should store it somewhere at backend and so after going thru SO posts for a while I'm not sure what is the best way to do it. I have few options and if you could point out which their pros/cons that would be much appreciated. send to server and store as markdown rather than HTML. To me obvious advantage would be keeping exactly same formatting as user originally entered. But then how can I convert it back to HTML for display to a client? It seems very troublesome to convert it on client side as even if it would be possible what would happen if JS would be disabled? If I wanted to do it on the server, then standard server side implementations of markup to HTML might be resource expensive. Would that be an issue in your opinion? Even if it wouldn't be the case then as I mentioned my WMD implementation is customised and those server side solutions wouldn't probably do the right conversion to markdown anyway and there always would be a risk that something would convert wrong. Send to server as converted HTML. Same as above.. conversion on client side would be difficult, server side same with possibility of getting it wrong. send original markdown and converted HTML and store both. No performance issues related to converting markdown to HTML on client side, nor on server side. Users would have always same markdown they originally entered and same HTML they originally saw in preview (possibly sanitized in php though). It would have to take twice that much storage space though and that is my biggest worry. I tend to lean towards 3rd solution as it seems simplest, but there is a worry of doubled storage space needed for this solution. Please bear in mind that my implementation of WMD is slightly modified and also I'm going with PHP/MySql server side implementation. So apart from 3 options I listed above, are there any other possible solutions to my problem? Did I miss anything important that would make one of the options above better then the rest? And what other pros/cons would apply to each solution I listed? Also how is it implemented on SO? I read somwhere that they using option 3, and so if its good enough for SO would be good enough for me :) but not sure if its true anyway, so how is it done? Also please forgive me, but at least for once I got to say that StackOverflow IS THE BEST DAMN RESOURCE ON THE WEB and I truly appreciate all the people trying to help others here! The site and users here are simply amazing!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Emulating Button Press Using Kinect/SimpleOpenNI + Processing Depth

    - by Alex Lu
    I am using Kinect with Simple OpenNI and Processing, and I was trying to use the Z position of a hand to emulate a button press. So far when I try it using one hand it works really well, however, when I try to get it to work with a second hand, only one of the hands work. (I know it can be more efficient by moving everything except the fill out of the if statements, but I kept those in there just in case I want to change the sizes or something.) irz and ilz are the initial Z positions of the hands when they are first recognized by onCreateHands and rz and lz are the current Z positions. As of now, the code works fine with one hand, but the other hand will either stay pressed or unpressed. If i comment one of the sections out, it works fine as well. if (rz - irz > 0) { pushStyle(); fill(60); ellipse(rx, ry, 10, 10); popStyle(); rpressed = true; } else { pushStyle(); noFill(); ellipse(rx, ry, 10, 10); popStyle(); rpressed = false; } if (lz - ilz > 0) { pushStyle(); fill(60); ellipse(lx, ly, 10, 10); popStyle(); lpressed = true; } else { pushStyle(); noFill(); ellipse(lx, ly, 10, 10); popStyle(); lpressed = false; } I tried outputting the values of rz - irz and lz - ilz and the numbers range from small negative values to small positive values (around -8 to 8) for lz - ilz. But rz - irz outputs numbers from around 8-30 depending on each time I run it and is never consistent. Also, when I comment out the code for the lz-ilz, the values for rz-irz look just fine and it operates as intended. Is there a reason tracking both Z positions throws off one hand? And is there a way to get it to work? Thanks!

    Read the article

  • Hibernate MappingException Unknown entity: $Proxy2

    - by slynn1324
    I'm using Hibernate annotations and have a VERY basic data object: import java.io.Serializable; import javax.persistence.Entity; import javax.persistence.Id; @Entity public class State implements Serializable { /** * */ private static final long serialVersionUID = 1L; @Id private String stateCode; private String stateFullName; public String getStateCode() { return stateCode; } public void setStateCode(String stateCode) { this.stateCode = stateCode; } public String getStateFullName() { return stateFullName; } public void setStateFullName(String stateFullName) { this.stateFullName = stateFullName; } } and am trying to run the following test case: public void testCreateState(){ Session s = HibernateUtil.getSessionFactory().getCurrentSession(); Transaction t = s.beginTransaction(); State state = new State(); state.setStateCode("NE"); state.setStateFullName("Nebraska"); s.save(s); t.commit(); } and get an org.hibernate.MappingException: Unknown entity: $Proxy2 at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.event.def.AbstractSaveEventListener.saveWithGeneratedId(AbstractSaveEventListener.java:121) .... I haven't been able to find anything referencing the $Proxy part of the error - and am at a loss.. Any pointers to what I'm missing would be greatly appreciated. hibernate.cfg.xml <property name="hibernate.connection.driver_class">org.hsqldb.jdbcDriver</property> <property name="connection.url">jdbc:hsqldb:hsql://localhost/xdb</property> <property name="connection.username">sa</property> <property name="connection.password"></property> <property name="current_session_context_class">thread</property> <property name="dialect">org.hibernate.dialect.HSQLDialect</property> <property name="show_sql">true</property> <property name="hbm2ddl.auto">update</property> <property name="hibernate.transaction.factory_class">org.hibernate.transaction.JDBCTransactionFactory</property> <mapping class="com.test.domain.State"/> in HibernateUtil.java public static SessionFactory getSessionFactory(boolean testing ) { if ( sessionFactory == null ){ try { String configPath = HIBERNATE_CFG; AnnotationConfiguration config = new AnnotationConfiguration(); config.configure(configPath); sessionFactory = config.buildSessionFactory(); } catch (Exception e){ e.printStackTrace(); throw new ExceptionInInitializerError(e); } } return sessionFactory; }

    Read the article

  • Multiple instances of this carousel on a single page - can't get it to work

    - by Andy
    This code comes from a tutorial so it's not originally my own work. What I am trying to do is implement this several times on a single page. I have tried and so far failed - by numbering the id "carousel" and so forth. Any help would be seriously appreciated. I'm tearing my hair out. http://jsfiddle.net/AndyMP/zcKDV/5/ For completeness.. this is the carousel JQuery as it stands. //rotation speed and timer var speed = 5000; var run = setInterval('rotate()', speed); //grab the width and calculate left value var item_width = $('#slides li').outerWidth(); var left_value = item_width * (-1); //move the last item before first item, just in case user click prev button $('#slides li:first').before($('#slides li:last')); //set the default item to the correct position $('#slides ul').css({'left' : left_value}); //if user clicked on prev button $('#prev').click(function() { //get the right position var left_indent = parseInt($('#slides ul').css('left')) + item_width; //slide the item $('#slides ul').animate({'left' : left_indent}, 200,function(){ //move the last item and put it as first item $('#slides li:first').before($('#slides li:last')); //set the default item to correct position $('#slides ul').css({'left' : left_value}); }); //cancel the link behavior return false; }); //if user clicked on next button $('#next').click(function() { //get the right position var left_indent = parseInt($('#slides ul').css('left')) - item_width; //slide the item $('#slides ul').animate({'left' : left_indent}, 200, function () { //move the first item and put it as last item $('#slides li:last').after($('#slides li:first')); //set the default item to correct position $('#slides ul').css({'left' : left_value}); }); //cancel the link behavior return false; }); //if mouse hover, pause the auto rotation, otherwise rotate it $('#slides').hover( function() { clearInterval(run); }, function() { run = setInterval('rotate()', speed); } ); //a simple function to click next link //a timer will call this function, and the rotation will begin :) function rotate() { $('#next').click(); }

    Read the article

  • Specializating a template function that takes a universal reference parameter

    - by David Stone
    How do I specialize a template function that takes a universal reference parameter? foo.hpp: template<typename T> void foo(T && t) // universal reference parameter foo.cpp template<> void foo<Class>(Class && class) { // do something complicated } Here, Class is no longer a deduced type and thus is Class exactly; it cannot possibly be Class &, so reference collapsing rules will not help me here. I could perhaps create another specialization that takes a Class & parameter (I'm not sure), but that implies duplicating all of the code contained within foo for every possible combination of rvalue / lvalue references for all parameters, which is what universal references are supposed to avoid. Is there some way to accomplish this? To be more specific about my problem in case there is a better way to solve it: I have a program that can connect to multiple game servers, and each server, for the most part, calls everything by the same name. However, they have slightly different versions for a few things. There are a few different categories that these things can be: a move, an item, etc. I have written a generic sort of "move string to move enum" set of functions for internal code to call, and my server interface code has similar functions. However, some servers have their own internal ID that they communicate with, some use strings, and some use both in different situations. Now what I want to do is make this a little more generic. I want to be able to call something like ServerNamespace::server_cast<Destination>(source). This would allow me to cast from a Move to a std::string or ServerMoveID. Internally, I may need to make a copy (or move from) because some servers require that I keep a history of messages sent. Universal references seem to be the obvious solution to this problem. The header file I'm thinking of right now would expose simply this: namespace ServerNamespace { template<typename Destination, typename Source> Destination server_cast(Source && source); } And the implementation file would define all legal conversions as template specializations.

    Read the article

< Previous Page | 836 837 838 839 840 841 842 843 844 845 846 847  | Next Page >