Search Results

Search found 21466 results on 859 pages for 'current buffer'.

Page 86/859 | < Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >

  • ignore certain buffers using iswitchb

    - by robUK
    Hello, GNU Emacs 23.1 I am using iswitchb. However, when I press c-x b I get a list of buffers. However, I don't want to display one like scratch, Messages, GNU Emacs, etc. Just the buffers I have opened myself. So I am looking for a way to ignore these buffers. This is what I have in my configuration. However, it doesn't ignore the buffers I don't want. Have I done anything wrong? ;; Setup iswitchb to select different buffers, ignore buffers to reduce list (iswitchb-mode 1) (setq iswitchb-buffer-ignore '("*scratch*")) (setq iswitchb-buffer-ignore '("*Messages*")) (setq iswitchb-buffer-ignore '("*GNU Emacs*")) (setq iswitchb-buffer-ignore '("*compilation*")) Many thanks for any suggestions,

    Read the article

  • Is it possible to BitBlt directly on to a GDI+ bitmap?

    - by jnm2
    I am trying to BitBlt from an HBITMAP to a GDI+ bitmap. I tried this, but nothing happens: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); IntPtr hBufferDC = BufferGraphics.GetHdc(); ... BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); EDIT: Apparently the hDC doesn't work if I acquire it and then much later use it with BitBlt. I needed to make sure the hDC was still valid. This is the solution: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); ... IntPtr hBufferDC = BufferGraphics.GetHdc(); BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); BufferGraphics.ReleaseHdc(hBufferDC); Does anyone know why this change is necessary? Why might it not work to use an hDC that was gotten earlier as in the first example?

    Read the article

  • char[] and char* compatibility?

    - by Aerovistae
    In essence, will this code work? And before you say "Run it and see!", I just realized my cygwin didn't come with gcc and it's currently 40 minutes away from completing reinstallation. That being said: char* words[1000]; for(int i = 0; i<1000; i++) words[i] = NULL; char buffer[ 1024 ]; //omit code that places "ADD splash\0" into the buffer if(strncmp (buffer, "ADD ", 4){ char* temp = buffer + 4; printf("Adding: %s", temp); int i = 0; while(words[i] != NULL) i++; words[i] = temp; } I'm mostly uncertain about the line char* temp = buffer + 4, and also whether I can assign words[i] in the manner that I am. Am I going to get type errors when I eventually try to compile this in 40 minutes? Also-- if this works, why don't I need to use malloc() on each element of words[]? Why can I say words[i] = temp, instead of needing to allocate memory for words[i] the length of temp?

    Read the article

  • Faster way to clone.

    - by AngryHacker
    I am trying to optimize a piece of code that clones an object: #region ICloneable public object Clone() { MemoryStream buffer = new MemoryStream(); BinaryFormatter formatter = new BinaryFormatter(); formatter.Serialize(buffer, this); // takes 3.2 seconds buffer.Position = 0; return formatter.Deserialize(buffer); // takes 2.1 seconds } #endregion Pretty standard stuff. The problem is that the object is pretty beefy and it takes 5.4 seconds (according ANTS Profiler - I am sure there is the profiler overhead, but still). Is there a better and faster way to clone?

    Read the article

  • How can two threads access a common array of buffers with minimal blocking ? (c#)

    - by Jelly Amma
    Hello, I'm working on an image processing application where I have two threads on top of my main thread: 1 - CameraThread that captures images from the webcam and writes them into a buffer 2 - ImageProcessingThread that takes the latest image from that buffer for filtering. The reason why this is multithreaded is because speed is critical and I need to have CameraThread to keep grabbing pictures and making the latest capture ready to pick up by ImageProcessingThread while it's still processing the previous image. My problem is about finding a fast and thread-safe way to access that common buffer and I've figured that, ideally, it should be a triple buffer (image[3]) so that if ImageProcessingThread is slow, then CameraThread can keep on writing on the two other images and vice versa. What sort of locking mechanism would be the most appropriate for this to be thread-safe ? I looked at the lock statement but it seems like it would make a thread block-waiting for another one to be finished and that would be against the point of triple buffering. Thanks in advance for any idea or advice. J.

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • PIX_FMT_YUYV422 8 bits conversion ffmpeg

    - by Sridhar
    Hi, I have a raw YUYV422 buffer with 8-bit 4:2:2 Component Y’CbCr format (Y0, Cb, Y1, Cr order). I know that ffmpeg's PIX_FMT_YUYV422 only handle 16-bit buffers.So I am getting Bad memory error when scaling that buffer into YUV420P. Can any one give me a clue, how can I use this buffer with ffmpeg to covert into YUV420. Thanks, Raghu

    Read the article

  • Thread locking issue with FileHelpers between calling engine.ReadNext() method and readign engine.Li

    - by Rad
    I use producer/consumer pattern with FileHelpers library to import data from one file (which can be huge) using multiple threads. Each thread is supposed to import a chunk of that file and I would like to use LineNumber property of the FileHelperAsyncEngine instance that is reading the file as primary key for imported rows. FileHelperAsyncEngine internally has an IEnumerator IEnumerable.GetEnumerator(); which is iterated over using engine.ReadNext() method. That internally sets LineNumber property (which seems is not thread safe). Consumers will have Producers assiciated with them that will supply DataTables to Consumers which will consume them via SqlBulkLoad class which will use IDataReader implementation which will iterate over a collection of DataTables which are internal to a Consumer instance. Each instance of will have one SqlBulkCopy instance associate with it. I have thread locking issue. Below is how I create multiple Producer threads. I start each thread afterwords. Produce method on a producer instance will be called determining which chunk of input file will be processed. It seems that engine.LineNumber is not thread safe and I doesn't import a proper LineNumber in the database. It seems that by the time engine.LineNumber is read some other thread called engine.ReadNext() and changed engine.LineNumber property. I don't want to lock the loop that is supposed to process a chunk of input file because I loose parallelism. How to reorganize the code to solve this threading issue? Thanks Rad for (int i = 0; i < numberOfProducerThreads; i++) DataConsumer consumer = dataConsumers[i]; //create a new producer DataProducer producer = new DataProducer(); //consumer has already being created consumer.Subscribe(producer); FileHelperAsyncEngine orderDetailEngine = new FileHelperAsyncEngine(recordType); orderDetailEngine.Options.RecordCondition.Condition = RecordCondition.ExcludeIfBegins; orderDetailEngine.Options.RecordCondition.Selector = STR_ORDR; int skipLines = i * numberOfBufferTablesToProcess * DataBuffer.MaxBufferRowCount; Thread newThread = new Thread(() => { producer.Produce(consumer, inputFilePath, lineNumberFieldName, dict, orderDetailEngine, skipLines, numberOfBufferTablesToProcess); consumer.SetEndOfData(producer); }); producerThreads.Add(newThread); thread.Start();} public void Produce(DataConsumer consumer, string inputFilePath, string lineNumberFieldName, Dictionary<string, object> dict, FileHelperAsyncEngine engine, int skipLines, int numberOfBufferTablesToProcess) { lock (this) { engine.Options.IgnoreFirstLines = skipLines; engine.BeginReadFile(inputFilePath); } int rowCount = 1; DataTable buffer = consumer.BufferDataTable; while (engine.ReadNext() != null) { lock (this) { dict[lineNumberFieldName] = engine.LineNumber; buffer.Rows.Add(ObjectFieldsDataRowMapper.MapObjectFieldsToDataRow(engine.LastRecord, dict, buffer)); if (rowCount % DataBuffer.MaxBufferRowCount == 0) { consumer.AddBufferDataTable(buffer); buffer = consumer.BufferDataTable; } if (rowCount % (numberOfBufferTablesToProcess * DataBuffer.MaxBufferRowCount) == 0) { break; } rowCount++; } } if (buffer.Rows.Count > 0) { consumer.AddBufferDataTable(buffer); } engine.Close(); }

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • How do you send a named pipe string from umnanaged to managed code space?

    - by billmcf
    I appear to have a named pipes 101 issue. I have a very simple set up to connect a simplex named pipe transmitting from a C++ unmanaged app to a C# managed app. The pipe connects, but I cannot send a "message" through the pipe unless I close the handle which appears to flush the buffer and pass the message through. It's like the message is blocked. I have tried reversing the roles of client/server and invoking them with different Flag combinations without any luck. I can easily send messages in the other direction from C# managed to C++ unmanaged. Does anyone have any insight. Can any of you guys successfully send messages from C++ unmanaged to C# managed? I can find plenty of examples of intra amanged or unmanaged pipes but not inter managed to/from unamanged - just claims to be able to do it. In the listings, I have omitted much of the wrapper stuff for clarity. The key bits I believe that are relevant are the pipe connection/creation/read and write methods. Don't worry too much about blocking/threading here. C# Server side // This runs in its own thread and so it is OK to block private void ConnectToClient() { // This server will listen to the sending client if (m_InPipeStream == null) { m_InPipeStream = new NamedPipeServerStream("TestPipe", PipeDirection.In, 1); } // Wait for client to connect to our server m_InPipeStream.WaitForConnection(); // Verify client is running if (!m_InPipeStream.IsConnected) { return; } // Start listening for messages on the client stream if (m_InPipeStream != null && m_InPipeStream.CanRead) { ReadThread = new Thread(new ParameterizedThreadStart(Read)); ReadThread.Start(m_InPipeStream); } } // This runs in its own thread and so it is OK to block private void Read(object serverObj) { NamedPipeServerStream pipeStream = (NamedPipeServerStream)serverObj; using (StreamReader sr = new StreamReader(pipeStream)) { while (true) { string buffer = "" ; try { // Blocks here until the handle is closed by the client-side!! buffer = sr.ReadLine(); // <<<<<<<<<<<<<< Sticks here } catch { // Read error break; } // Client has disconnected? if (buffer == null || buffer.Length == 0) break; // Fire message received event if message is non-empty if (MessageReceived != null && buffer != "") { MessageReceived(buffer); } } } } C++ client side // Static - running in its own thread. DWORD CNamedPipe::ListenForServer(LPVOID arg) { // The calling app (this) is passed as the parameter CNamedPipe* app = (CNamedPipe*)arg; // Out-Pipe: connect as a client to a waiting server app->m_hOutPipeHandle = CreateFile("\\\\.\\pipe\\TestPipe", GENERIC_WRITE, 0, NULL, OPEN_EXISTING, FILE_ATTRIBUTE_NORMAL, NULL); // Could not create handle if (app->m_hInPipeHandle == NULL || app->m_hInPipeHandle == INVALID_HANDLE_VALUE) { return 1; } return 0; } // Sends a message to the server BOOL CNamedPipe::SendMessage(CString message) { DWORD dwSent; if (m_hOutPipeHandle == NULL || m_hOutPipeHandle == INVALID_HANDLE_VALUE) { return FALSE; } else { BOOL bOK = WriteFile(m_hOutPipeHandle, message, message.GetLength()+1, &dwSent, NULL); //FlushFileBuffers(m_hOutPipeHandle); // <<<<<<< Tried this return (!bOK || (message.GetLength()+1) != dwSent) ? FALSE : TRUE; } } // Somewhere in the Windows C++/MFC code... ... // This write is non-blocking. It just passes through having loaded the pipe. m_pNamedPipe->SendMessage("Hi de hi"); ...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

  • boost.asio error on read from socket.

    - by niXman
    The following code of the client: typedef boost::array<char, 10> header_packet; header_packet header; boost::system::error_code error; ... /** send header */ boost::asio::write( _socket, boost::asio::buffer(header, header.size()), boost::asio::transfer_all(), error ); /** send body */ boost::asio::write( _socket, boost::asio::buffer(buffer, buffer.length()), boost::asio::transfer_all(), error ); of the server: struct header { boost::uint32_t header_length; boost::uint32_t id; boost::uint32_t body_length; }; static header unpack_header(const header_packet& data) { header hdr; sscanf(data.data(), "%02d%04d%04d", &hdr.header_length, &hdr.id, &hdr.body_length); return hdr; } void connection::start() { boost::asio::async_read( _socket, boost::asio::buffer(_header, _header.size()), boost::bind( &connection::read_header_handler, shared_from_this(), boost::asio::placeholders::error ) ); } /***************************************************************************/ void connection::read_header_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed header: " << _header.c_array() << std::endl; std::cout << constants::unpack_header(_header); boost::asio::async_read( _socket, boost::asio::buffer(_body, constants::unpack_header(_header).body_length), boost::bind( &connection::read_body_handler, shared_from_this(), boost::asio::placeholders::error ) ); } else { /** report error */ std::cout << "read header finished with error: " << e.message() << std::endl; } } /***************************************************************************/ void connection::read_body_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed body: " << _body.c_array() << std::endl; start(); } else { /** report error */ std::cout << "read body finished with error: " << e.message() << std::endl; } } On the server side the method read_header_handler() is called, but the method read_body_handler() is never called. Though the client has written down the data in a socket. The header is readed and decoded successfully. What's the error?

    Read the article

  • how to mount partitions from USB drives in Windows using Delphi?

    - by user569556
    Hi. I'm a Delphi programmer. I want to mount all partitions from USB drives in Windows (XP). The OS is doing this automatically but there are situations when such a program is useful. I know how to find if a drive is on USB or not. My code so far is: type STORAGE_QUERY_TYPE = (PropertyStandardQuery = 0, PropertyExistsQuery, PropertyMaskQuery, PropertyQueryMaxDefined); TStorageQueryType = STORAGE_QUERY_TYPE; STORAGE_PROPERTY_ID = (StorageDeviceProperty = 0, StorageAdapterProperty); TStoragePropertyID = STORAGE_PROPERTY_ID; STORAGE_PROPERTY_QUERY = packed record PropertyId: STORAGE_PROPERTY_ID; QueryType: STORAGE_QUERY_TYPE; AdditionalParameters: array[0..9] of AnsiChar; end; TStoragePropertyQuery = STORAGE_PROPERTY_QUERY; STORAGE_BUS_TYPE = (BusTypeUnknown = 0, BusTypeScsi, BusTypeAtapi, BusTypeAta, BusType1394, BusTypeSsa, BusTypeFibre, BusTypeUsb, BusTypeRAID, BusTypeiScsi, BusTypeSas, BusTypeSata, BusTypeMaxReserved = $7F); TStorageBusType = STORAGE_BUS_TYPE; STORAGE_DEVICE_DESCRIPTOR = packed record Version: DWORD; Size: DWORD; DeviceType: Byte; DeviceTypeModifier: Byte; RemovableMedia: Boolean; CommandQueueing: Boolean; VendorIdOffset: DWORD; ProductIdOffset: DWORD; ProductRevisionOffset: DWORD; SerialNumberOffset: DWORD; BusType: STORAGE_BUS_TYPE; RawPropertiesLength: DWORD; RawDeviceProperties: array[0..0] of AnsiChar; end; TStorageDeviceDescriptor = STORAGE_DEVICE_DESCRIPTOR; const IOCTL_STORAGE_QUERY_PROPERTY = $002D1400; var i: Integer; H: THandle; USBDrives: array of Byte; Query: TStoragePropertyQuery; dwBytesReturned: DWORD; Buffer: array[0..1023] of Byte; sdd: TStorageDeviceDescriptor absolute Buffer; begin SetLength(UsbDrives, 0); SetErrorMode(SEM_FAILCRITICALERRORS); for i := 0 to 99 do begin H := CreateFile(PChar('\\.\PhysicalDrive' + IntToStr(i)), 0, FILE_SHARE_READ or FILE_SHARE_WRITE, nil, OPEN_EXISTING, 0, 0); if H <> INVALID_HANDLE_VALUE then begin try dwBytesReturned := 0; FillChar(Query, SizeOf(Query), 0); FillChar(Buffer, SizeOf(Buffer), 0); sdd.Size := SizeOf(Buffer); Query.PropertyId := StorageDeviceProperty; Query.QueryType := PropertyStandardQuery; if DeviceIoControl(H, IOCTL_STORAGE_QUERY_PROPERTY, @Query, SizeOf(Query), @Buffer, SizeOf(Buffer), dwBytesReturned, nil) then if sdd.BusType = BusTypeUsb then begin SetLength(USBDrives, Length(USBDrives) + 1); UsbDrives[High(USBDrives)] := Byte(i); end; finally CloseHandle(H); end; end; end; for i := 0 to High(USBDrives) do begin // end; end. But I don't know how to access partitions on each drive and mounts them. Can you please help me? I searched before I asked and I couldn't find a working code. But if I did not properly then I'm sorry and please show me that topic. Best regards, John

    Read the article

  • Is the C++ compiler optimizer allowed to break my destructor ability to be called multiple times?

    - by sharptooth
    We once had an interview with a very experienced C++ developer who couldn't answer the following question: is it necessary to call the base class destructor from the derived class destructor in C++? Obviously the answer is no, C++ will call the base class destructor automagically anyway. But what if we attempt to do the call? As I see it the result will depend on whether the base class destructor can be called twice without invoking erroneous behavior. For example in this case: class BaseSafe { public: ~BaseSafe() { } private: int data; }; class DerivedSafe { public: ~DerivedSafe() { BaseSafe::~BaseSafe(); } }; everything will be fine - the BaseSafe destructor can be called twice safely and the program will run allright. But in this case: class BaseUnsafe { public: BaseUnsafe() { buffer = new char[100]; } ~BaseUnsafe () { delete[] buffer; } private: char* buffer; }; class DerivedUnsafe { public: ~DerivedUnsafe () { BaseUnsafe::~BaseUnsafe(); } }; the explicic call will run fine, but then the implicit (automagic) call to the destructor will trigger double-delete and undefined behavior. Looks like it is easy to avoid the UB in the second case. Just set buffer to null pointer after delete[]. But will this help? I mean the destructor is expected to only be run once on a fully constructed object, so the optimizer could decide that setting buffer to null pointer makes no sense and eliminate that code exposing the program to double-delete. Is the compiler allowed to do that?

    Read the article

  • What happens when we say "listen to a port" ?

    - by smwikipedia
    Hi, When we start a server application, we always need to speicify the port number it listens to. But how is this "listening mechanism" implemented under the hood? My current imagination is like this: The operating system associate the port number with some buffer. The server application's responsibiligy is to monitor this buffer. If there's no data in this buffer, the server application's listen operation will just block the application. When some data arrives from the wire, the operating system will know that check the data and see if it is targed at this port number. And then it will fill the buffer. And then OS will notify the blocked server application and the server application will get the data and continue to run. Question is: If the above scenario is correct, how could the opearting system know there's data arriving from wire? It cannot be a busy pooling. Is it some kind of interrupt-based mechanism? If there's too much data arriving and the buffer is not big enough, will there be data loss? Is the "listen to a port" operation really a blocking operation? Many thanks.

    Read the article

  • wxPython - How can I display a html formatted string in wx.RichTextCtrl

    - by wxpydon
    Hello, I'm trying to display some string (html formatted) in a Richtext Ctrl. In my code I tried to use it this way (self.txtmain is the RichTextCtrl): out = StringIO() htmlhandler = rt.RichTextHTMLHandler() buffer = self.txtmain.GetBuffer() buffer.AddHandler(htmlhandler) out.write(string) out.seek(0) htmlhandler.LoadStream(buffer, out) self.txtmain.Refresh() No errors are issued, but the RichTextCtrl windows is not updated. What am I missing here?

    Read the article

  • reading and writing QByteArrays

    - by synchronicity
    I'm having trouble reading and writing QByteArray data to a file. My goal is to save QPixmap data into a QByteArray and save that QByteArray to a file (with the ability to read this QByteArray back from the file and into a QPixmap). I want to use following code from the QPixmap documentation: QPixmap pixmap(<image path>); QByteArray bytes; QBuffer buffer(&bytes); buffer.open(QIODevice::WriteOnly); pixmap.save(&buffer, "PNG"); // writes pixmap into bytes in PNG format After writing the buffer to a file, I want to be able to retrieve the QByteArray and load it back into a QPixmap using the QPixmap::loadFromData() function. Please let me know if any further clarification is needed (I'm open to alternative approaches as well, I just need to be able to read and write the QPixmap to a file! :) );

    Read the article

  • public class ImageHandler : IHttpHandler

    - by Ken
    cmd.Parameters.AddWithValue("@id", new system.Guid (imageid)); What using System reference would this require? Here is the handler: using System; using System.Collections.Specialized; using System.Web; using System.Web.Configuration; using System.Web.Security; using System.Globalization; using System.Configuration; using System.Data.SqlClient; using System.Data; using System.IO; using System.Web.Profile; using System.Drawing; public class ImageHandler : IHttpHandler { public void ProcessRequest(HttpContext context) { string imageid; if (context.Request.QueryString["id"] != null) imageid = (context.Request.QueryString["id"]); else throw new ArgumentException("No parameter specified"); context.Response.ContentType = "image/jpeg"; Stream strm = ShowProfileImage(imageid.ToString()); byte[] buffer = new byte[8192]; int byteSeq = strm.Read(buffer, 0, 8192); while (byteSeq > 0) { context.Response.OutputStream.Write(buffer, 0, byteSeq); byteSeq = strm.Read(buffer, 0, 8192); } //context.Response.BinaryWrite(buffer); } public Stream ShowProfileImage(String imageid) { string conn = ConfigurationManager.ConnectionStrings["MyConnectionString1"].ConnectionString; SqlConnection connection = new SqlConnection(conn); string sql = "SELECT image FROM Profile WHERE UserId = @id"; SqlCommand cmd = new SqlCommand(sql, connection); cmd.CommandType = CommandType.Text; cmd.Parameters.AddWithValue("@id", new system.Guid (imageid));//Failing Here!!!! connection.Open(); object img = cmd.ExecuteScalar(); try { return new MemoryStream((byte[])img); } catch { return null; } finally { connection.Close(); } } public bool IsReusable { get { return false; } } }

    Read the article

  • get content from website with utf8 format

    - by zahir
    i want how to get the content from websites with utf8 format,, i have writing the following code is try { String webnames = "http://pathivu.com"; URL url = new URL(webnames); URLConnection urlc = url.openConnection(); //BufferedInputStream buffer = new BufferedInputStream(urlc.getInputStream()); BufferedReader buffer = new BufferedReader(new InputStreamReader(urlc.getInputStream(), "UTF8")); StringBuilder builder = new StringBuilder(); int byteRead; while ((byteRead = buffer.read()) != -1) builder.append((char) byteRead); buffer.close(); String text=builder.toString(); System.out.println(text); } catch (IOException e) { e.printStackTrace(); } but i cant get the correct format... thanks and advance..

    Read the article

  • Performance Cost of a Memcopy in C/C++

    - by Cenoc
    So whenever I write code I always think about the performance implications. I've often wondered, what is the "cost" of using a memcopy relative to other functions in terms of performance? For example, I may be writing a sequence of numbers to a static buffer and concentrate on a frame within the buffer, in order to keep the frame once I get to the end of the buffer, I might memcopy all of it to the beginning OR I can implement an algorithm to amortize the computation.

    Read the article

  • Creating android app Database with big amount of data

    - by Thomas
    Hi all, The database of my application need to be filled with a lot of data, so during onCreate(), it's not only some create table sql instructions, there is a lot of inserts. The solution I chose is to store all this instructions in a sql file located in res/raw and which is loaded with Resources.openRawResource(id). It works well but I face to encoding issue, I have some accentuated caharacters in the sql file which appears bad in my application. This my code to do this : public String getFileContent(Resources resources, int rawId) throws IOException { InputStream is = resources.openRawResource(rawId); int size = is.available(); // Read the entire asset into a local byte buffer. byte[] buffer = new byte[size]; is.read(buffer); is.close(); // Convert the buffer into a string. return new String(buffer); } public void onCreate(SQLiteDatabase db) { try { // get file content String sqlCode = getFileContent(mCtx.getResources(), R.raw.db_create); // execute code for (String sqlStatements : sqlCode.split(";")) { db.execSQL(sqlStatements); } Log.v("Creating database done."); } catch (IOException e) { // Should never happen! Log.e("Error reading sql file " + e.getMessage(), e); throw new RuntimeException(e); } catch (SQLException e) { Log.e("Error executing sql code " + e.getMessage(), e); throw new RuntimeException(e); } The solution I found to avoid this is to load the sql instructions from a huge static final string instead of a file, and all accentutated characters appears well. But Isn't there a more elegant way to load sql instructions than a big static final String attribute with all sql instructions ? Thanks in advance Thomas

    Read the article

  • replacing variables in output in php

    - by Thorpe Obazee
    Right now I have this code. <?php error_reporting(E_ALL); require_once('content_config.php'); function callback($buffer) { // replace all the apples with oranges foreach ($config as $key => $value) { $buffer = str_replace($key, $value, $buffer); } return $buffer; } ob_start("callback"); ?> some content <?php ob_end_flush(); ?> in the content_config.php file: $config['SiteName'] = 'MySiteName'; $config['SiteAuthor'] = 'thatGuy'; What I want to do is that I want to replace the placeholders that with the key of the config array with its value. Right now, it doesn't work :(

    Read the article

  • Preallocating memory with C++ in realtime environment

    - by Elazar Leibovich
    I'm having a function which gets an input buffer of n bytes, and needs an auxillary buffer of n bytes in order to process the given input buffer. (I know vector is allocating memory at runtime, let's say that I'm using a vector which uses static preallocated memory. Imagine this is NOT an STL vector.) The usual approach is void processData(vector<T> &vec) { vector<T> &aux = new vector<T>(vec.size()); //dynamically allocate memory // process data } //usage: processData(v) Since I'm working in a real time environment, I wish to preallocate all the memory I'll ever need in advance. The buffer is allocated only once at startup. I want that whenever I'm allocating a vector, I'll automatically allocate auxillary buffer for my processData function. I can do something similar with a template function static void _processData(vector<T> &vec,vector<T> &aux) { // process data } template<size_t sz> void processData(vector<T> &vec) { static aux_buffer[sz]; vector aux(vec.size(),aux_buffer); // use aux_buffer for the vector _processData(vec,aux); } // usage: processData<V_MAX_SIZE>(v); However working alot with templates is not much fun (now let's recompile everything since I changed a comment!), and it forces me to do some bookkeeping whenever I use this function. Are there any nicer designs around this problem?

    Read the article

< Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >