Search Results

Search found 17727 results on 710 pages for 'large apps'.

Page 87/710 | < Previous Page | 83 84 85 86 87 88 89 90 91 92 93 94  | Next Page >

  • Does Python work in larger teams?

    - by Kugel
    I read this post last night and it got me thinking. I like python and "batteries", pypi and such. But I've only done python solo. Never tried it in a team. Are the points that Ted mentions valid? If they are how do teams cope with them? Does Python work in teams or even large teams? Or it kills productivity? I personally see the problems he mentions when I come back to my old code. Even when working with other modules sometimes I need to peek inside. I would like to hear people with experience on this.

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Local web apps and W3C standards.

    - by Babiker
    If am writing a local app that will only run using a specific browser, am i setting my self up by slightly ignoring W3C's standards? I ask this question because in this app i am thinking of using custom HTML tags, custom attributes, etc... Thanks in advance guys.

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Indexing large DB's with Lucene/PHP

    - by thebluefox
    Afternoon chaps, Trying to index a 1.7million row table with the Zend port of Lucene. On small tests of a few thousand rows its worked perfectly, but as soon as I try and up the rows to a few tens of thousands, it times out. Obviously, I could increase the time php allows the script to run, but seeing as 360 seconds gets me ~10,000 rows, I'd hate to think how many seconds it'd take to do 1.7million. I've also tried making the script run a few thousand, refresh, and then run the next few thousand, but doing this clears the index each time. Any ideas guys? Thanks :)

    Read the article

  • Cache for large read only database recommendation

    - by paddydub
    I am building site on with Spring, Hibernate and Mysql. The mysql database contains information on coordinates and locations etc, it is never updated only queried. The database contains 15000 rows of coordinates and 48000 rows of coordinate connections. Every time a request is processed, the application needs to read all these coordinates which is taking approx 3-4 seconds. I would like to set up a cache, to allow quick access to the data. I'm researching memcached at the moment, can you please advise if this would be my best option?

    Read the article

  • Pre approve expenditure batch in oracle apps project module

    - by nil
    hi to all i have to crete one pre approve expence batch when i crete batch and then go to india local payble (MHE) but when i run the request Expense Report Import Report then i got following out put hear some error Rejection Reason = no location so my problem is that where i have to define location please give me guidance for that Total Functional Currency Invoice Amount: 100.00 Elecon Engineering Co. Ltd. Expense Report Import Report 17-MAY-10 16:57 Page: 2 Source: Oracle Projects Exceptions Report Supplier Supplier Invoice Invoice Invoice Invoice Name Number Name Number Number Date Currency Amount Rejection Reason ------------ Megha, Nilesh M. 90054 XSAM R17-MAY-1 31-MAY-10 INR 400.00 No Location Megha, Nilesh M. 90054 XT2 R17-MAY-10 31-MAY-10 INR 100.00 No Location Total Expense Reports Rejected: 2 Total Functional Currency Invoice Amount: 500.00 Edited by: user12921822 on May 17, 2010 9:00 PM

    Read the article

  • Flex - weird display behavior on large number of Canvas

    - by itarato
    Hi, I have a Flex app (SDK 3.5 - FP10) that does mindmap trees. Every node is a Canvas (I'm using Canvas specific properties so I needed it). It has a shadow effect, background color and some small ui element on it (like icons, texts...). It works perfectly until it goes over ~700 nodes (Canvas). Over that number it shows grey rectangles: http://yfrog.com/bhw2pj . If I turn off the DropShadowFilter effect for the Canvas, they are also gone, so I assume it's a DropShadowFilter problem: http://yfrog.com/2d9y8j . The effect is simple: private static var _nodeDropShadow:DropShadowFilter = new DropShadowFilter(1, 45, 0x888888, 1, 1, 1); _backgroundComp.filters = _nodeDropShadow; Is it possible that Flex can't handle that much? Thanks in advance

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • Gathering entropy in web apps to create (more) secure random numbers

    - by H M
    after several days of research and discussion i came up with this method to gather entropy from visitors (u can see the history of my research here) when a user visits i run this code: $entropy=sha1(microtime().$pepper.$_SERVER['REMOTE_ADDR'].$_SERVER['REMOTE_PORT']. $_SERVER['HTTP_USER_AGENT'].serialize($_POST).serialize($_GET).serialize($_COOKIE)); note: pepper is a per site/setup random string set by hand. then i execute the following (My)SQL query: $query="update `crypto` set `value`=sha1(concat(`value`, '$entropy')) where name='entropy'"; that means we combine the entropy of the visitor's request with the others' gathered already. that's all. then when we want to generate random numbers we combine the gathered entropy with the output: $query="select `value` from `crypto` where `name`='entropy'"; //... extract(unpack('Nrandom', pack('H*', sha1(mt_rand(0, 0x7FFFFFFF).$entropy.microtime())))); note: the last line is a part of a modified version of the crypt_rand function of the phpseclib. please tell me your opinion about the scheme and other ideas/info regarding entropy gathering/random number generation. ps: i know about randomness sources like /dev/urandom. this system is just an auxiliary system or (when we don't have (access to) these sources) a fallback scheme.

    Read the article

  • How web apps ask location of mobile device?

    - by kikkoman90
    Hello, Many modern mobile phones (google nexus one etc.) have some kind of built in location service. when i go to a some website (eg. google.com) that website asks if I'm willing to share my location with that site. How do you actually ask for mobile device to give out it's location to the site? And in what format is that location given? I've got no clue and didn't find any answers from google, neither.

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Looking for a target that works like "_CopyWebApplication" but for console apps

    - by Rihan Meij
    Hi We all ready have build scripts that creates our web application folders very nicely. We create multiple folders for each environment, and then change the configs in those folders according to the environment. How can we get the same results as what _CopyWebApplication does? Example: <MSBuild Projects="$(SourceCodeCheckoutFolder)\source\UI\$(ProjectName)\$(ProjectName).csproj" Targets="ResolveReferences; ResolveProjectReferences; _CopyWebApplication" ToolsVersion="3.5" StopOnFirstFailure="False" RunEachTargetSeparately="False" </MSBuild

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • Large tables of static data with DBGhost

    - by Paulo Manuel Santos
    We are thinking of restructuring our database development and deployment processes by using DBGhost, we want to move away from the central development database and bring the database to the source control. One of the problems we have is a big table with static data (containing translated language strings), it has close to 200K rows. I know that our best solution is to move these stings into resource files, but until we implement that, will DbGhost be able to maintain all this static data and generate our development and deployment databases in a short time? And if not is there a good alternative to filling up this table whenever we need to?

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • Small cool apps

    - by subSeven
    What small and cool applications that can be helpful for programmer do you know ? I think about programs that not very famous. I know three: http://advsys.net/ken/download.htm EvalDraw - for protoyping games http://www.drpetter.se/project_sfxr.html sfxr - for makeing sound http://www.kloonigames.com/blog/general/timelog timelog - for mangament time of project

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Best way to communicate between 2 .Net apps?

    - by ajl
    If I control both applications, what is the best way to communicate between 2 exe's written in VB.Net. For example, I want to drop an XML file from one app, and pick it up with the other, but I do not want poll for the file. I've heard of named pipes, but I found it was complicated. What's the most effecient way to do this?

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

< Previous Page | 83 84 85 86 87 88 89 90 91 92 93 94  | Next Page >