Search Results

Search found 17727 results on 710 pages for 'large apps'.

Page 88/710 | < Previous Page | 84 85 86 87 88 89 90 91 92 93 94 95  | Next Page >

  • iPhone apps for company-internal use - possible?

    - by Michael Stum
    I hope this is still programming related, as SuperUser doesn't seem the appropriate place. Basically I wonder if it is possible to have Applications that are internal to a company on the iPhone? That is something like a companion Application to an Intranet (when Safari and Mail just don't cut it) which wouldn't make sense on the AppStore (and likely wouldn't get approved anyway). Is something like that possible (without Jailbreaking or doing anything else that Apple doesn't normally want)?

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

  • Gathering entropy in web apps to create (more) secure random numbers

    - by H M
    after several days of research and discussion i came up with this method to gather entropy from visitors (u can see the history of my research here) when a user visits i run this code: $entropy=sha1(microtime().$pepper.$_SERVER['REMOTE_ADDR'].$_SERVER['REMOTE_PORT']. $_SERVER['HTTP_USER_AGENT'].serialize($_POST).serialize($_GET).serialize($_COOKIE)); note: pepper is a per site/setup random string set by hand. then i execute the following (My)SQL query: $query="update `crypto` set `value`=sha1(concat(`value`, '$entropy')) where name='entropy'"; that means we combine the entropy of the visitor's request with the others' gathered already. that's all. then when we want to generate random numbers we combine the gathered entropy with the output: $query="select `value` from `crypto` where `name`='entropy'"; //... extract(unpack('Nrandom', pack('H*', sha1(mt_rand(0, 0x7FFFFFFF).$entropy.microtime())))); note: the last line is a part of a modified version of the crypt_rand function of the phpseclib. please tell me your opinion about the scheme and other ideas/info regarding entropy gathering/random number generation. ps: i know about randomness sources like /dev/urandom. this system is just an auxiliary system or (when we don't have (access to) these sources) a fallback scheme.

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Assigning large UInt32 constants in VB.Net

    - by Kumba
    I inquired on VB's erratic behavior of treating all numerics as signed types back in this question, and from the accepted answer there, was able to get by. Per that answer: Visual Basic Literals Also keep in mind you can add literals to your code in VB.net and explicitly state constants as unsigned. So I tried this: Friend Const POW_1_32 As UInt32 = 4294967296UI And VB.NET throws an Overflow error in the IDE. Pulling out the integer overflow checks doesn't seem to help -- this appears to be a flaw in the IDE itself. This, however, doesn't generate an error: Friend Const POW_1_32 As UInt64 = 4294967296UL So this suggests to me that the IDE isn't properly parsing the code and understanding the difference between Int32 and UInt32. Any suggested workarounds and/or possible clues on when MS will make unsigned data types intrinsic to the framework instead of the hacks they currently are?

    Read the article

  • How to write a large number of nested records in JSON with Python

    - by jamesmcm
    I want to produce a JSON file, containing some initial parameters and then records of data like this: { "measurement" : 15000, "imi" : 0.5, "times" : 30, "recalibrate" : false, { "colorlist" : [234, 431, 134] "speclist" : [0.34, 0.42, 0.45, 0.34, 0.78] } { "colorlist" : [214, 451, 114] "speclist" : [0.44, 0.32, 0.45, 0.37, 0.53] } ... } How can this be achieved using the Python json module? The data records cannot be added by hand as there are very many.

    Read the article

  • Permits in iPhone apps

    - by zp26
    HI, I want to create i file in the iPhone application. I try it but i have a anomaly. In my pc the file is correctly written. In other pc with the same program the file wasn't exist. In the iPhone device the file not exist. But the strange think thing is that i haven't any error for the app in the all case. Do you have a idea? Thanks so much

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Hang during databinding of large amount of data to WPF DataGrid

    - by nihi_l_ist
    Im using WPFToolkit datagrid control and do the binding in such way: <WpfToolkit:DataGrid x:Name="dgGeneral" SelectionMode="Single" SelectionUnit="FullRow" AutoGenerateColumns="False" CanUserAddRows="False" CanUserDeleteRows="False" Grid.Row="1" ItemsSource="{Binding Path=Conversations}" > public List<CONVERSATION> Conversations { get { return conversations; } set { if (conversations != value) { conversations = value; NotifyPropertyChanged("Conversations"); } } } public event PropertyChangedEventHandler PropertyChanged; public void NotifyPropertyChanged(string propertyName) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } public void GenerateData() { BackgroundWorker bw = new BackgroundWorker(); bw.WorkerSupportsCancellation = bw.WorkerReportsProgress = true; List<CONVERSATION> list = new List<CONVERSATION>(); bw.DoWork += delegate { list = RefreshGeneralData(); }; bw.RunWorkerCompleted += delegate { try { Conversations = list; } catch (Exception ex) { CustomException.ExceptionLogCustomMessage(ex); } }; bw.RunWorkerAsync(); } And than in the main window i call GenerateData() after setting DataCotext of the window to instance of the class, containing GenerateData(). RefreshGeneralData() returns some list of data i want and it returns it fast. Overall there are near 2000 records and 6 columns(im not posting the code i used during grid's initialization, because i dont think it can be the reason) and the grid hangs for almost 10 secs!

    Read the article

  • Problem processing large data using Applet-Servlet communication

    - by Marquinio
    Hi everyone. I have an Applet that makes a request to a Servlet. On the servlet it's using the PrintWriter to write the response back to Applet: out.println("Field1|Field2|Field3|Field4|Field5......|Field10"); There are about 15000 records, so the out.println() gets executed about 15000 times. Problem is that when the Applet gets the response from Servlet it takes about 15 minutes to process the records. I placed System.out.println's and processing is paused at around 5000, then after 15 minutes it continues processing and then its done. Has anyone faced a similar problem? The servlet takes about 2 seconds to execute. So seems that the browser/Applet is too slow to process the records. Any ideas appreciated. Thanks.

    Read the article

  • Timeout on Large mySQL Query

    - by Bob Stewart
    I have this query: $theQuery = mysql_query("SELECT phrase, date from wordList WHERE group='nouns'"); while($getWords=mysql_fetch_array($theQuery)) { echo "$getWords[phrase] created on $getWords[date]<br>"; } The data table "wordList" contains 75,000 records in the group "nouns" and every time I load the code I am returned an error. Help!

    Read the article

  • Extract anything that looks like links from large amount of data in python

    - by Riz
    Hi, I have around 5 GB of html data which I want to process to find links to a set of websites and perform some additional filtering. Right now I use simple regexp for each site and iterate over them, searching for matches. In my case links can be outside of "a" tags and be not well formed in many ways(like "\n" in the middle of link) so I try to grab as much "links" as I can and check them later in other scripts(so no BeatifulSoup\lxml\etc). The problem is that my script is pretty slow, so I am thinking about any ways to speed it up. I am writing a set of test to check different approaches, but hope to get some advices :) Right now I am thinking about getting all links without filtering first(maybe using C module or standalone app, which doesn't use regexp but simple search to get start and end of every link) and then using regexp to match ones I need.

    Read the article

  • Google apps API problem with read-only feed?

    - by brandonprry
    Hi all, I am beginning to use the google data api (specifically for the finance app). I can read my portfolio's just fine, so I am authenticating correctly (or so I think). However, when i try and create a portfolio, I get a 'feed is read-only' error. The constructor for the service: public class FinanceService : Service, IService { public FinanceService(string applicationName) : base ("finance", applicationName) { this.RequestFactory = new GDataGAuthRequestFactory("finance", applicationName) { ProtocolMajor = 3 }; } } and saving it is private const string _schema = "http://schemas.google.com/finance/2007"; private const string _feed = "http://finance.google.com/finance/feeds/default/portfolios"; AtomFeed atomFeed = new AtomFeed(new Uri(_feed), this.FinanceService); return this.FinanceService.Insert(atomFeed, this as AtomEntry) as PortfolioEntry; Any idea why the atomFeed would come back ReadOnly? The credentials are legit, and I can get my current portfolios without a problem.

    Read the article

  • filesize of large files in c

    - by endeavormac
    How can I get the filesize of a file in C when the filesize is greater than 4gb? ftell returns a 4 byte signed long, limiting it to two bytes. stat has a variable of type off_t which is also 4 bytes (not sure of sign), so at most it can tell me the size of a 4gb file. What if the file is larger than 4 gb?

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • ActionBar SpinnerAdapter Large Branding followed by selection (spinner)

    - by SatanEnglish
    I'm trying to implement a spinner In the action bar that has brand Name above it. With the ActionBar setListNavigationCallbacks method if possible actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_LIST); actionBar.setListNavigationCallbacks(mSpinnerAdapter, null); Can anyone give me an Idea of how to do this? I would put some code here but I have no idea where to begin as I have not managed to find relevant information yet. Edit: Using V4.0

    Read the article

  • which ad solution is best for iPhone apps

    - by nbojja
    Hi All, i have a iPhone free app downloaded by 3000 users. mostly every one uses my app atleast once in a day. So i am planning to keep ads on my app. Which ad solution is best. and i looked in some sites. No one is giving clear details about CPMs. my direct question is "How much will i get for 1000 impressions using different ad solutions?" thanks

    Read the article

  • Android-Close Other Apps

    - by Luke
    I have some code that will launch a different application using intents but what can I do to close or kill the other app? Here is the launch code (works great): Intent i = new Intent(); i.setAction(Intent.ACTION_MAIN); i.addCategory(Intent.CATEGORY_LAUNCHER); i.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK); i.setComponent( new ComponentName(resolveInfo.activityInfo.applicationInfo.packageName, resolveInfo.activityInfo.name)); I tried to kill the background processes but no luck: ActivityManager activityManager = (ActivityManager) context.getSystemService(context.ACTIVITY_SERVICE); activityManager.killBackgroundProcesses("com.pandora.android"); I also tried this to kill it: context.stopService(new Intent(context, Class.forName("com.bla.bla")));

    Read the article

  • PHP: imagepng is creating inordinately large files

    - by Rafael
    I'm using a simple thumbnailing script I wrote and it's pretty standard: $imgbuffer = imagecreatetruecolor($thumbwidth, $thumbheight); switch($type) { case 1: $image = imagecreatefromgif($img); break; case 2: $image = imagecreatefromjpeg($img); break; case 3: $image = imagecreatefrompng($img); break; case 6: $image = imagecreatefrombmp($img); break; case 15: $image = imagecreatefromwbmp($img); break; default: return log_error("Tried to create thumbnail from $img: not a valid image"); } imagecopyresampled($imgbuffer, $image, 0, 0, 0, 0, $thumbwidth, $thumbheight, $width, $height); $output = imagepng($imgbuffer, "$album/thumbs/$imgname.png", 9); 9 is the lowest quality setting, yet from a 400 x 600 JPEG image (at 56kB) I'm getting a thumbnail 27 kB in size (140 x 140). Using imagejpeg (quality of 80) instead of imagepng it's about 4kB. How can this be, especially at the lowest quality setting for imagepng? I tried using imagecopy instead of imagecopyresampled, and imagecreate instead of the true color version. Unfortunately the images come out mangled somehow. Is there any way to get PNG thumbnails of a reasonably small file size (about 4 kB at 140 x 140)? Or do I have to use JPEG?

    Read the article

  • How to handle large table in MySQL ?

    - by Frantz Miccoli
    I've a database used to store items and properties about these items. The number of properties is extensible, thus there is a join table to store each property associated to an item value. CREATE TABLE `item_property` ( `property_id` int(11) NOT NULL, `item_id` int(11) NOT NULL, `value` double NOT NULL, PRIMARY KEY (`property_id`,`item_id`), KEY `item_id` (`item_id`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci; This database has two goals : storing (which has first priority and has to be very quick, I would like to perform many inserts (hundreds) in few seconds), retrieving data (selects using item_id and property_id) (this is a second priority, it can be slower but not too much because this would ruin my usage of the DB). Currently this table hosts 1.6 billions entries and a simple count can take up to 2 minutes... Inserting isn't fast enough to be usable. I'm using Zend_Db to access my data and would really be happy if you don't suggest me to develop any php side part. Thanks for your advices !

    Read the article

< Previous Page | 84 85 86 87 88 89 90 91 92 93 94 95  | Next Page >