Search Results

Search found 23102 results on 925 pages for 'browser width'.

Page 876/925 | < Previous Page | 872 873 874 875 876 877 878 879 880 881 882 883  | Next Page >

  • Problems with creating and using of delegate-protocols

    - by Flocked
    Hello, I have the problem that I have created a delegate protocol, but the necessary methods are not executed, although I have implemented the protocol in my header file. Here are the detailed explanation: I created an instance of my ViewController (TimeLineViewController), which will be displayed. This ViewController contains a UITableView, which in turn receives the individual Cells / Rows from one instance of my TableViewCell. So the ViewController creates an instance of TableCellView. The TableViewCell contains a UITextView, which contains web links. Now I want, that not safari opens the links, but my own built-in browser. Unfortunately TableViewCell can not open a new ViewController with a WebView, so I decided to create a delegate protocol. The whole thing looks like this: WebViewTableCellDelegate.h: @protocol WebViewTableCellDelegate -(void)loadWeb; @end Then I created a instance WebViewDelegate in the TableViewCell: id <WebViewTableCellDelegate> _delegate; In the .m of the TableViewCell: @interface UITextView (Override) @end @class WebView, WebFrame; @protocol WebPolicyDecisionListener; @implementation UITextView (Override) - (void)webView:(WebView *)webView decidePolicyForNavigationAction:(NSDictionary *)actionInformation request:(NSURLRequest *)request frame:(WebFrame *)frame decisionListener:(id < WebPolicyDecisionListener >)listener { NSLog(@"request: %@", request); [_delegate loadWeb]; } @end - (void)setDelegate:(id <WebViewTableCellDelegate>)delegate{ _delegate = delegate;} And in my TimeLineViewController I implemented the protocol with < and the loadWeb-metode: - (void)loadWeb{ WebViewController *web = [[WebViewController alloc] initWithNibName:nil bundle:nil]; web.modalTransitionStyle = UIModalTransitionStyleFlipHorizontal; [self presentModalViewController: web animated:YES]; [web release]; } And when the instance of the TableViewCell will be created in the TimelineViewController: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *MyIdentifier = @"MyIdentifier"; MyIdentifier = @"tableCell"; TableViewCell *cell = (TableViewCell *)[tableView dequeueReusableCellWithIdentifier:MyIdentifier]; if(cell == nil) { [[NSBundle mainBundle] loadNibNamed:@"TableViewCell" owner:self options:nil]; cell = tableCell;} [cell setDelegate:self]; //… } It is the first time I created a own delegate-protocol, so maybe there are stupid mistakes. Also I´m learnung Objective-C and programming generally only for 4 weeks. Thanks for your help! EDIT: I think i found the problem, but I dont know how to resolve it. I try to use [_delegate loadWeb]; in the subclass of the UITextView (because that is the only way i can react on the weblinks) and the subclass can´t use [_delegate loadWeb];. I tried this in a other methode and it worked.

    Read the article

  • Why the vertical scroll bar moves automatically ?

    - by Misha Moroshko
    I don't understand why the vertical scroll bar moves automatically to the most top position when "Line 9" clicked, for example. Further clicks does not move the scroll bar. Could anyone explain why, and how to fix this ? I work with Firefox 3.6.3. <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <body> <div> <table> <tr row='0'><td class='column1'>Line 0</td></tr> <tr row='1'><td class='column1'>Line 1</td></tr> <tr row='2'><td class='column1'>Line 2</td></tr> <tr row='3'><td class='column1'>Line 3</td></tr> <tr row='4'><td class='column1'>Line 4</td></tr> <tr row='5'><td class='column1'>Line 5</td></tr> <tr row='6'><td class='column1'>Line 6</td></tr> <tr row='7'><td class='column1'>Line 7</td></tr> <tr row='8'><td class='column1'>Line 8</td></tr> <tr row='9'><td class='column1'>Line 9</td></tr> </table> </div> </body> $(document).ready(function() { $(".column1").each(function(index) { $(this).after("<td class='column2'>Details " + index + "</td>"); $(this).toggle(function() { $("[row='" + index + "'] .column2").fadeIn("fast") }, function() { $("[row='" + index + "'] .column2").fadeOut("fast") }); }); }); div { overflow: auto; height: 100px; width: 300px; border: 1px solid blue; } .column1 { cursor: pointer; } .column2 { display: none; }

    Read the article

  • Sliding panel in the middle of the page. Z-index given not working

    - by Nehal Rupani
    Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • Keep div:hover open when changing nested select box

    - by JMC Creative
    This is an IE-only problem. .toolTip becomes visible when it's parent element is :hovered over. Inside of .toolTip is a select box. When the user opens the select box to make a selection, the parent element is being "un-hovered", if you will. To put it another way, when I try to select something from the dropdown, the whole thing hides itself again. I'm sure it has something to do with the way IE interprets the stylesheet, but I don't know what or where. Here is some relevant code (edited for clarity): #toolBar .toolTip { position: absolute; display:none; background: #fff; line-height: 1em; font-size: .8em; min-width: 300px; bottom: 47px; left: -5px; padding: 0 ; } #toolBar div:hover .toolTip { display:block; } and <div id="toolBar"> <div class="socialIcon"> <a href=""><img src="/im/social/nytimes.png" alt="NY Times Bestsellers" /></a> <span class="toolTip"> <h1>NY Times Bestsellers Lists</h1> <div id="nyTimesBestsellers"> <?php include('/ny-times-bestseller-feed.php') ?> </div> <p><img src="/im/social/nytimes.png" alt="NY Times Bestseller Lists" /> Change List <select id="nyTimesChangeCurrentList" name="nyTimesChangeCurrentList"> <option value="hardcover-fiction">Hardcover Fiction</option> <option value="hardcover-nonfiction">Hardcover Nonfiction</option> <option value="hardcover-advice">Hardcover Advice</option> </select> </p> </span> </div> </div>

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • ASP.NET Elements are null when assigning data source

    - by deccks
    For some reason, all of the objects in my ASP.NET markup are now null when I try to assign values to their properties in the code behind. My project was going fine and then now when I try to assign a data source to a GridView, I get a null reference error. I have no idea why it's doing this. I am not doing nothing special. I am just trying to assign a value to a property to an asp.net element in on the page. The intellisense knows that the element is there and I get no errors when I build the project. It's just when I am running the website I get the null reference. I have been trying to fix this issue for a couple weeks now. Please Help. Thanks. Here is the code: protected void Page_PreRender(object sender, EventArgs e) { LoadData(); } private void LoadData() { Entities context = new Entities(); var types = (from t in context.CustomerTypes select t).OrderBy(t => t.TypeName); gvCustomerTypes.DataSource = types; gvCustomerTypes.DataBind(); } and on in the markup the gridview looks like this: <asp:GridView ID="gvCustomerTypes" runat="server" ShowHeader="true" GridLines="Both" AutoGenerateColumns="false" AlternatingRowStyle-BackColor="AliceBlue" Width="100%"> <Columns> <asp:TemplateField HeaderText="Customer Type Name" HeaderStyle-HorizontalAlign="Left" ItemStyle-HorizontalAlign="Left"> <ItemTemplate> <asp:Label ID="lblType" runat="server" Text='<%# Eval("TypeName") %>' /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Edit" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:HyperLink ID="HyperLink1" NavigateUrl='<%#Eval("CustomerTypeID", "CreateEditCustomerType.aspx?ID={0}") %>' Text="Edit" runat="server" /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Delete" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:LinkButton ID="LinkButton1" CommandName='<%#Eval("CustomerTypeID") %>' OnClientClick="javascript:return confirm('Are you sure you want to delete this Customer Type?');" OnCommand="DeleteCustomerType" Text="Delete" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView>

    Read the article

  • Why i get everytime the error-message that i've already sent the headers

    - by mikep
    Hey, i've another question about web-programming. I programmed a login script, but everytime when i try to login it says that i've send the header informations already. Here are the 2 files: <?php if($_GET['logout'] == 1) { setcookie('authorized', 1, time()-3600); } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Login - photoAdminSite</title> </head> <style type="text/css"> body { text-align: center; font-family: helvetica; } #loginForm { padding: 1em; background: #e3e3e3; width: 260px; margin: 3em auto 0; text-align: left; } </style> <body> <div id="loginForm"> <form method="post" action="confirm_login_credentials.php"> <h2>LOGIN</h2> <p>Username: <input type="text" name="username" /></p> <p>Password: <input type="password" name="password" /></p> <p><input type="submit" value="Login" name="submit" /></p> </form> </div> </body> </html> <?php $username = $_POST['username']; $password = $_POST['password']; require 'database.php'; $q = "SELECT id FROM users_photoadminsite WHERE user_name = '$username' AND password = '$password'"; $result = $mysqli->query($q) or die(mysqli_error()); if (mysqli_num_rows($result) == 1) { setcookie('authorized', 1, 0); header("Location: index.php"); } else { header("Location: login.php"); } ?> i would be really happy about some helpful answers.

    Read the article

  • jQuery toggling divs, expand collapse all and keep first item selected when page loads

    - by hollyb
    Hi, I have a question about some functionality I'm trying to add to my jQuery to enable a button or text to expand/contract all the divs on click... and I'd like to figure out how to keep the first div open when the page loads. Here is the jQuery: (document).ready(function(){ //Hides containers on load $(".toggle_container").hide(); //Switch "Open" and "Close" state on click $("h2.trigger").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); //Slide up and down on click $("h2.trigger").click(function(){ $(this).next(".toggle_container").slideToggle("slow"); }); }); And the css: // uses a background image with an on (+) and off (-) state stacked on top of each other h2.trigger { background: url(buttonBG.gif) no-repeat;height: 46px;line-height: 46px;width: 300px;font-size: 2em;font-weight: normal;} h2.trigger a {color: #fff;text-decoration: none; display: block;} h2.active {background-position: left bottom;} .toggle_container { overflow: hidden; } .toggle_container .block {padding: 20px;} And the html <h2 class="trigger"><a href="#">Heading</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> <h2 class="trigger"><a href="#">Heading 2</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> So it works great and looks great. However, when I try to get it to keep the first instance open, the background image that should adjust show the (-) state doesn't change. The code I used to this was: $(".toggle_container:first").show(); So, my question is, does anyone know of an easier way to show the first instance of this as open without having to created specials rules/class for the first item? Also, any ideas about how to make an open all/close all link? Thanks!

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • How do I get the current time in a Windows 7 gadget?

    - by norlando02
    For my first windows gadget I'm trying to make one that displays the current time and date. The code below is what I have, but I can't figure out why the javascript is not running. Any ideas? <html> <head> http-equiv="Content-Type" content="text/html; charset=Unicode" /> <title>Clock</title> <style type="text/css"> body { width: 130px; height: 60px; margin: 1 1 1 2; } body { font-family: Segoe UI, Arial; font-size: 11px; font-weight: bold; white-space: nowrap; } </style> <script type="text/javascript"> var background; var interval; var connection_id; var timeZone; var now; function load() { try { interval = 1000; connection_id = 0; timeZone = System.Time.currentTimeZone; update(); } catch(e){} } function update() { try { now = new Date(Date.parse(System.Time.getLocalTime(timeZone))); curDate.innerHTML = now.format('M jS, Y'); curTime.innerHTML = now.format('h:i:s A'); clearTimeout(connection_id); connection_id = setTimeout("update()", interval); } catch(e) {} </script> </head> <body onload="load()"> <div id="curDate"> </div> <div id="curTime"> </div> </body> </html>

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Can't insert a number into a C++ custom streambuf/ostream

    - by 0xbe5077ed
    I have written a custom std::basic_streambuf and std::basic_ostream because I want an output stream that I can get a JNI string from in a manner similar to how you can call std::ostringstream::str(). These classes are quite simple. namespace myns { class jni_utf16_streambuf : public std::basic_streambuf<char16_t> { JNIEnv * d_env; std::vector<char16_t> d_buf; virtual int_type overflow(int_type); public: jni_utf16_streambuf(JNIEnv *); jstring jstr() const; }; typedef std::basic_ostream<char16_t, std::char_traits<char16_t>> utf16_ostream; class jni_utf16_ostream : public utf16_ostream { jni_utf16_streambuf d_buf; public: jni_utf16_ostream(JNIEnv *); jstring jstr() const; }; // ... } // namespace myns In addition, I have made four overloads of operator<<, all in the same namespace: namespace myns { // ... utf16_ostream& operator<<(utf16_ostream&, jstring) throw(std::bad_cast); utf16_ostream& operator<<(utf16_ostream&, const char *); utf16_ostream& operator<<(utf16_ostream&, const jni_utf16_string_region&); jni_utf16_ostream& operator<<(jni_utf16_ostream&, jstring); // ... } // namespace myns The implementation of jni_utf16_streambuf::overflow(int_type) is trivial. It just doubles the buffer width, puts the requested character, and sets the base, put, and end pointers correctly. It is tested and I am quite sure it works. The jni_utf16_ostream works fine inserting unicode characters. For example, this works fine and results in the stream containing "hello, world": myns::jni_utf16_ostream o(env); o << u"hello, wor" << u'l' << u'd'; My problem is as soon as I try to insert an integer value, the stream's bad bit gets set, for example: myns::jni_utf16_ostream o(env); if (o.badbit()) throw "bad bit before"; // does not throw int32_t x(5); o << x; if (o.badbit()) throw "bad bit after"; // throws :( I don't understand why this is happening! Is there some other method on std::basic_streambuf I need to be implementing????

    Read the article

  • Rails 3 Atom Feed

    - by scud bomb
    Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • JQuery $.ajax doesn't return anything, but only in Google Chrome!?

    - by Shawson
    Hi All, I'm hoping someone can help me with this as I'm at a loss. I'm trying to simply load a plain text file into a page at runtime using jquery- everything works fine in IE8 (8.0.7600.16385), Firefox 3.6.3, however in Google Chrome 5.0.375.55 the "data" comes back as nothing- i get an empty alert box. This is the code i'm using; <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Animation Test</title> <script type="text/javascript" language="javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" language="javascript"> $(document).ready(function () { $.ajax({ url: 'level1.txt', success: function (data) { alert(data); }, async: true, type: 'GET' }); }); </script> </head> <body> <canvas id="canvas" width="640" height="480"> Unsupported Browser </canvas> </body> </html> The file I'm loading in is a plain text file containing this; Central Cavern 100 O.........1.C....C...........1.O O................1.............O O..............................O O..............................O O......................B1..B...O O=============~~~~=~~~~========O O.............................1O O===...........................O O............A..OOO.B..........O O====...<<<<<<<<<<<<<<<<<<<<...O O............................==O O..............................O O..........B........OOO.....===O O....===============...........O O%............................XO O==============================O (Yes- it's the first level from Manic Miner! I'm making a javascript version using the html5 canvas to get my head around using it.) I'm at a total loss- it can't be the code because it runs in the other 2 browsers- is there an issue with jquery and this version of Chrome? Thanks for reading!! Shaw.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • jQuery fadeIn is not working in Internet Explorer

    - by Nazaf
    I have the following HTML DIV which does not work using FadeIn in IE: $(".tip").fadeIn("slow"); /* Is not working in IE. */ $(".tip").show(); /* Works well in IE, that's weird. */ <div class="tip" style="width: 220px; display: none;"> <div class="tip-header"> <span><b>Title</b></span> <div class="right close"><a href="javascript:void(0);">close</a> <img alt="" src="/Images/close-normal.png"/></div> </div> <div class="tip-content">EBody comes here.</div> </div> .tip { display: block; z-index: 99999; position: fixed; background-color: #ffffff; -moz-box-shadow: 2px 2px 10px 2px rgba(0, 0, 0, 0.6); -webkit-box-shadow: 2px 2px 10px 2px rgba(0, 0, 0, 0.6); border:solid 1px #82C2FA; -moz-border-radius: 8px; -webkit-border-radius: 8px; } .tip-header { padding: 8px; min-height: 10px; -moz-border-radius-topleft: 8px; -moz-border-radius-topright: 8px; -webkit-border-radius-topright: 8px; -webkit-border-radius-topleft: 8px; background-color: #CFE6FD; border-bottom: 1px solid #82C2FA; } .tip-header span { font-size: 14px; color: #666666; } .tip-content { padding: 8px; text-align: left; font-size: 12px; } .close, .whats-this { cursor: pointer; } .close a { color: #085FBC; text-decoration: none; } .close img { vertical-align: bottom; }

    Read the article

  • Why doesn't TextBlock databinding call ToString() on a property whose compile-time type is an interf

    - by Jay
    This started with weird behaviour that I thought was tied to my implementation of ToString(), and I asked this question: http://stackoverflow.com/questions/2916068/why-wont-wpf-databindings-show-text-when-tostring-has-a-collaborating-object It turns out to have nothing to do with collaborators and is reproducible. When I bind Label.Content to a property of the DataContext that is declared as an interface type, ToString() is called on the runtime object and the label displays the result. When I bind TextBlock.Text to the same property, ToString() is never called and nothing is displayed. But, if I change the declared property to a concrete implementation of the interface, it works as expected. Is this somehow by design? If so, any idea why? To reproduce: Create a new WPF Application (.NET 3.5 SP1) Add the following classes: public interface IFoo { string foo_part1 { get; set; } string foo_part2 { get; set; } } public class Foo : IFoo { public string foo_part1 { get; set; } public string foo_part2 { get; set; } public override string ToString() { return foo_part1 + " - " + foo_part2; } } public class Bar { public IFoo foo { get { return new Foo {foo_part1 = "first", foo_part2 = "second"}; } } } Set the XAML of Window1 to: <Window x:Class="WpfApplication1.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="Window1" Height="300" Width="300"> <StackPanel> <Label Content="{Binding foo, Mode=Default}"/> <TextBlock Text="{Binding foo, Mode=Default}"/> </StackPanel> </Window> in Window1.xaml.cs: public partial class Window1 : Window { public Window1() { InitializeComponent(); DataContext = new Bar(); } } When you run this application, you'll see the text only once (at the top, in the label). If you change the type of foo property on Bar class to Foo (instead of IFoo) and run the application again, you'll see the text in both controls.

    Read the article

  • Combobox INotifyPropertyChanged event not raised!!!

    - by nagiah
    I created a combobox and set observable collection as the itemsource and implemented INotifyPropertyChanged on the observable collection item. Even after that, when I select different item in the combobox, the OnPropertyChange method is not invoked. I think I am not making the binding properly. Could any one please correct me/ suggest me in this regard. ---------------------------------MainPage.xaml--------------------------------------------------- <StackPanel Width="300"> <ComboBox Name="cboName"></ComboBox> <TextBox Name="tbxName" Text="{Binding Path=name,Mode=TwoWay,ElementName=cboName}" ></TextBox> </StackPanel> ---------------------------MainPage.xaml.cs----------------------------------------------- using System; using System.Collections.Generic; using System.Linq; using System.Net; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; using System.Collections.ObjectModel; using System.Collections.Specialized; using System.ComponentModel; namespace MasterDetailsUpdate { public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); Loaded += new RoutedEventHandler(MainPage_Loaded); } void MainPage_Loaded(object sender, RoutedEventArgs e) { ObservableCollection<Person> persons = new ObservableCollection<Person>(); persons.Add(new Person { city = "c1", name = "n1" }); persons.Add(new Person { city = "c2", name = "n2" }); persons.Add(new Person { city = "c3", name = "" }); persons.Add(new Person { city = "c4", name = "" }); persons.Add(new Person { city = "c5", name = "n1" }); cboName.ItemsSource = persons; cboName.DisplayMemberPath = "name"; } } public class Person : INotifyPropertyChanged { private string _name; private string _city; public string name { set { _name = value; OnPropertyChanged("name"); } get { return _name; } } public string city { set { _city = value; OnPropertyChanged("city"); } get { return _city; } } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; private void OnPropertyChanged(string propertyName) { if (PropertyChanged != null) { this.PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } } Thank You

    Read the article

  • buttons inside scrollviewer problem

    - by Miroslav Valchev
    Hello, everyone. I couldn't find a solution to my problem eventhough I believe that others have come across this too. Basically, there are like twenty buttons in a wrap panel, which is inside a scrollviewer. The problem is that when I want to scroll the list, the click event fires the triggers. Really would appreciate help on this one. <ScrollViewer> <ScrollViewer.Content> <toolkit:WrapPanel Orientation="Horizontal" HorizontalAlignment="Left" VerticalAlignment="Top" Width="420"> <Button Style="{StaticResource imageButtonStyle}" > <i:Interaction.Triggers> <i:EventTrigger EventName="Click"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="1" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="Click"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="2" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="MouseEnter"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="3" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> <Button Style="{StaticResource imageButtonStyle}"> <i:Interaction.Triggers> <i:EventTrigger EventName="MouseEnter"> <cmd2:EventToCommand Command="{Binding SelectCommand, Mode=OneWay}" CommandParameterValue="4" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> </toolkit:WrapPanel> </ScrollViewer.Content>

    Read the article

  • How to set background in OpenGL captured image from OpenCV

    - by user325487
    Hey All, i'm relatively new to Artoolkitplus and openGL i'm having a tough time getting the image i capture through openCV to be set as the background image in OpenGL ... I also cannot convert the image i take through the camera using opencv to be scaled to 320x280 from 640x480 .. i also have to save my image and load if for things to work... here's my code //////////// int findMarker() { IplImage* image = cvQueryFrame( capture ); if( !capture ) { fprintf( stderr, "ERROR: capture is NULL \n" ); getchar(); return -1; } if( !image ) { fprintf( stderr, "ERROR: frame is null...\n" ); getchar(); } //cvShowImage( "Capture", frame ); //image = cvCloneImage( frame ); try{ if(!cvSaveImage("immagineTmp.jpg",image)) printf("Could not save\n"); } catch(void*) {} image = cvLoadImage("immagineTmp.jpg", 1); cvShowImage( "Image", image ); glLoadIdentity(); ////////////// glDisable(GL_DEPTH_TEST); glOrtho(0,640,0,480,-1,1); glGenTextures(1, &bgid); glBindTexture(GL_TEXTURE_2D, bgid); // Create Linear Filtered Texture glBindTexture(GL_TEXTURE_2D, bgid); glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_MAG_FILTER,GL_LINEAR); glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_MIN_FILTER,GL_LINEAR); glTexImage2D(GL_TEXTURE_2D, 0, 3, image-width, image-height, 0, GL_RGB, GL_UNSIGNED_BYTE, image-imageData); glBindTexture(GL_TEXTURE_2D, bgid); glBegin(GL_QUADS); glTexCoord2f(0.0f, 0.0f); glVertex3f(-1.2f, -1.0f, -2.0f); glTexCoord2f(1.0f, 0.0f); glVertex3f( 1.2f, -1.0f, -2.0f); glTexCoord2f(1.0f, 1.0f); glVertex3f( 1.2f, 1.0f, -2.0f); glTexCoord2f(0.0f, 1.0f); glVertex3f(-1.2f, 1.0f, -2.0f); glEnd(); glEnable(GL_DEPTH_TEST); glLoadIdentity(); //////////// // do the OpenGL camera setup glMatrixMode(GL_PROJECTION); glLoadMatrixf(tracker-getProjectionMatrix()); int markerId = tracker-calc((unsigned char *)(image-imageData)); float conf = tracker-getConfidence(); // use the result of calc() to setup the OpenGL transformation glMatrixMode(GL_MODELVIEW); glLoadMatrixf(tracker-getModelViewMatrix()); if(markerId!=-1) { printf("\n\nFound marker %d (confidence %d%%)\n\nPose-Matrix:\n ", markerId, (int(conf*100.0f))); for(int i=0; i<16; i++) printf("%.2f %s", tracker-getModelViewMatrix()[i], (i%4==3)?"\n " : ""); } cvReleaseImage(&image); return 0; }

    Read the article

< Previous Page | 872 873 874 875 876 877 878 879 880 881 882 883  | Next Page >