Search Results

Search found 24037 results on 962 pages for 'every'.

Page 9/962 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Make backups of Dropbox folder every week

    - by ilansch
    I have a Dropbox folder which is shared by couple of users. I would like to make a backup of this folder that will occur every week and store this backup on another hard drive. I can simply copy the entire folder each time and this will be the backup, but I would like to copy only the files that have been changed or created during that week. I thought of creating a batch script that will check each file in the Dropbox folder recursively and see its modified date. If that date is later then a given one (current backup date) it will copy the file to a folder named BackUP[Date]. Do you think this solution is OK?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • My laptop can connect to every wireless network except fios

    - by going crazy
    I have always been able to connect to every wireless router secured or unsecured wep or wpa. I had Fios installed and could not connect. Verizon suggested it was my computer and gave me an outside wirless drive to use, it worked. I got rid of fios and went back to comcast and threw out the drive, but now 2 years later, I am sitting at my friends house haveing the same problem. My tech savy friend told me it is a firewall setting or something in my antivirus software, but I disabled them both and still nothing works........Funny it is only FIOS

    Read the article

  • CPanel: Every url is being redirected to http://:2083

    - by Frank
    On my cpanel server, I restored about 50 accounts from crashed cpanel server. All of the sites were working fine, but suddenly without changing anything, every site started to get redirected to url "http://:2083/"., There is nothing in logs, no errors. when i do wget it says: wget grinfeld.com.br --2012-09-04 13:18:23-- http://grinfeld.com.br/ Resolving grinfeld.com.br... 198.101.221.254 Connecting to grinfeld.com.br|198.101.221.254|:80... connected. HTTP request sent, awaiting response... 301 Moved Location: https://:2083/ [following] https://:2083/: Invalid host name.

    Read the article

  • How do I schedule a task to run every hour indefinitely on Server 2003

    - by JMK
    I am moving a scheduled task from a Windows 7 machine to a Windows Server 2003 machine. On Windows 7 I can configure my task to run every hour indefinitely by setting up a custom trigger like so: On Windows Server 2003, I assume I need to use the advanced schedule options, and I have got this far: Whether I choose duration or time, my task seems to have an expiry date, how do I get this to run indefinitely? The only thing I can think of at the minute is to setup 24 schedules for my task, one for each hour but there has to be a more elegant way. Thanks

    Read the article

  • Server responses "bus error" to every command

    - by Temnovit
    I have a linux machine dedicated to MySQL server with a pretty high load. Today I woke up and was terrified to see, that database server is down. I could connect to it via SSH, but it was responding with bus error to each and every command. [root@r1304 home]# ls Bus error [root@r1304 home]# tail /var/log/messages Bus error [root@r1304 home]# reboot Bus error [root@r1304 home]# free -m Bus error [root@r1304 home]# chkdisk Bus error I went to Data Center and did a hard reset, which seemed to help, but after a half an hour situation reapeated and now I can't even connet via SSH anymore. Any ideas what this could be? how to diagnose such a problem and what are possible fixes? Server has 32 GB RAM, 2xSSD drives with software RAID UPDATE According to Zabbix, when MySQL died, number of processes stated to increase drammaticaly, until I did a hard reset. What could those be? Number of processes

    Read the article

  • Folders disappear every timeWindows XP starts up

    - by Reebz
    Whenever my Windows XP machine starts up, subfolders disappear from the first top-level folder, listed alphabetically (eg. from "C:\AA Backups"). The first time it happened I suspected user error (such as an unintentional delete or copy). But I then found it happens on every start-up, sometimes affecting huge numbers of files. Renaming the affected folder (eg to "ZZ Backups") just means that a different folder is affected the next time. Avast found no virus or malware that would seem to be responsible. The missing files are not visible to an undelete utility such as NTFSUndelete. Running "chkdsk/f" found no problems and did not fix the problem. File permissions also appear corrupted - a few files which should be accessible are missing "read" permission. What's happened to this machine?? Any ideas or reports of similar experiences would be most welcome.

    Read the article

  • What does "every two minutes" mean in cron?

    - by Ambrose
    I've got two scripts in cron set to run every two minutes: */2 -- the thing is, they're out of step. One runs at 1,3,5,7,9 minutes, etc. and the other at 0,2,4,6,8. This is not a mission-critical problem, but means I've got two status reports, one a bit stale compared to the other. What does cron do exactly? Run the first one in crontab document order, waiting till it's finished to run the second one? Is there any way I can make the run at the same time, or as close as possible?

    Read the article

  • In Windows Vista, when starting any and every program, a "bad image" error is generated

    - by Mark Hatton
    I have a problem where any program is started under Windows Vista, the following error message is generated Bad Image C;\PROGRA~1\Google\GOOGLE~3\GOEC62~1.DLL is either not designed to run on Windows or it contains an error.Try installing the program again using the original installation media or contact your system administrator or the software vendor for support. This happens for every program started, including those that start automatically at boot time. My Google-fu is failing to solve this for me. I have already tried an "sfc /scannow" which did find some problems, but it said that it could not correct them. What might cause this problem? How might it be resolved?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • create a view to show the backup status in every 10 mins

    - by user2853141
    I have a question, my table have following data: userID, startTime, EndTime ————————————— 101, 04/11/2013 11:00:00, 04/11/2013 11:55:00 102, 04/11/2013 11:00:00, 04/11/2013 11:24:00 103, 04/11/2013 11:20:00, 04/11/2013 11:45:00 104, 04/11/2013 11:30:00, 04/11/2013 11:35:00 105, 04/11/2013 11:40:00, 04/11/2013 11:55:00 can I use the view to show the backup status in every 10 mins? I wonder the result as following: time, count —————————— 04/11/2013 11:00:00, 2 04/11/2013 11:10:00, 2 04/11/2013 11:20:00, 3 04/11/2013 11:30:00, 3 04/11/2013 11:40:00, 3 04/11/2013 11:50:00, 2 04/11/2013 12:00:00, 0 04/11/2013 11:00:00 – 04/11/2013 11:09:59 have 2 jobs, 101 & 102 04/11/2013 11:10:00 – 04/11/2013 11:19:59 have 2 jobs, 101 & 102 04/11/2013 11:20:00 – 04/11/2013 11:29:59 have 3 jobs, 101 & 102 & 103 … 04/11/2013 11:50:00 – 04/11/2013 11:59:59 have 2 jobs, 101 & 105 04/11/2013 12:00:00 – 04/11/2013 12:09:59 have 0 job I wonder if you can give me a help……thanks a lot

    Read the article

  • Using nginx as a reverse proxy for tomcat results in new jsessionids for every ssl request

    - by user439407
    I am using nginx as a reverse proxy for a tomcat setup, and everything works fine for the MOST part, the only issue I am having is that every request to an http address results in a new JSESSION ID being created(this doesn't happen in http), here is the relevant part of the NGINX configuration: location / { proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header Host $http_host; proxy_set_header X-Real-IP $remote_addr; proxy_set_header X-Forwarded-Proto https; proxy_redirect off; proxy_connect_timeout 240; proxy_send_timeout 240; proxy_read_timeout 240; proxy_pass http://localhost:8080; } Any idea why I am constantly genning new jsessionids?

    Read the article

  • Unix printing a banner page on every print job

    - by yum_tacos4u
    I have a Data General server on unix that is printing a banner page on every print. I originally thought that the banner page was comming from the printer. As this is an HP printer, I used telnet to get to the jetadmin and then proceded to disable the banner page, but this did not solve the issue. I then went into the sysadm program to see if the TCPIP printing was set to print a banner page on print jobs, but I did not see any options to print a banner page. Any help or ideas on how to disable the banner page from printing in unix? Here is a banner page example print

    Read the article

  • Shortcut key to skip cursor from left/right of every typed word

    - by user176368
    I want to know if it is even possible to jump my cursor from left/right of every typed word using Vimperator, a Firefox addon that behaves like Vim, including its shortcut keys. So a good example would be: I took a marvelous dump right before bed and I so happen to sleep better.- Now if my cursor is at the end of that sentence (hence the dash) how can I jump my cursor right before the word better by just using a shortcut key? by default Ctrl+A & Ctrl+E are shortcut keys that brings your cursor to beginning/end of the current line your on.

    Read the article

  • Linux freezes every few seconds

    - by Zeppomedio
    We're having an issue where one our Linux boxes (Ubuntu 10.04 LTS, running on EC2 with a quadruple-large size, 68GB of RAM and 8 virtual cores with 3.25GHz each) freezes up every few seconds. Typing in an ssh session will freeze, and running strace on one of the Postgresql processes that's running usually shows: 02:37:41.567990 semop(7831581, {{3, -1, 0}}, 1 for a few seconds before it proceeds (it always gets stuck at that semop). OProfile shows that most of the time is spent in the kernel (60%) versus 37% in Postgresql. The result of these halts (which began suddenly a day ago) is that load on the box has gone from 0.7 to 10+, and causes our entire stack to slow done. Any ideas on how to track down what's going on? iostat doesn't show the disks being particularly slow or overloaded, and top shows user cpu % spike from 8% to about 40% whenever these back-ups happen.

    Read the article

  • VPS stops responding every now and again

    - by Or W
    I have a Linode vps that I use to host some of my websites on. It's Ubuntu based and it's up to date in terms of all packages. I don't have any cron jobs scheduled or any automatic processes. I host a few (up to date) wordpress blogs there that have very little traffic altogether. Every day (at a different time) my server stops responding, I can't SSH to it, web access is getting timed out and it just dies until I reboot it through the Linode manager. On the linode dashboard I can see that the CPU is not very high (2-3%) Incoming/Outgoing traffic is on 0 and the IO count has a spike just before the server stops responding (SWAP IO is at 2k and IO Rate is at 5k). When I reboot the server everything is just fine. I'm trying to figure out a way to analyze what's going on at these random times where the server freezes up. How can I determine the problem?

    Read the article

  • Replacing every 10th pipe with new line in unix

    - by user327958
    Lets say I have fields: name, number, id I have a data file: name1|number1|id1|name2|number2|id2...etc I want to replace every 3rd pipe with a new line or '\n' so I get: name1|number1|id1 name2|number2|id2 I'm having no luck with awk or sed. I've tried the following, and variations of: awk '/"\|"/{c++;if(c==10){sub("\|","\n");c=0}}1' inputfile.txt sed 's/"|"/"\n"/2' inputfile.txt It tells me awk: syntax error near line 1 awk: illegal statement near line 1 awk: syntax error near line 1 awk: bailing out near line 1 Any help is greatly appreciated! EDIT: Thank you!

    Read the article

  • Sql database dumps failing every night

    - by chaseman36
    Hey guys, I have sql05 and my maintenance plan which backs up a database to an external storage SAN, has been failing every night. Here is my error: Executing the query "BACKUP DATABASE [master] TO DISK = N'\\192.168.x.x\vmbackup\server\dbbackup\master_backup_201004222300.bak' WITH NOFORMAT, NOINIT, NAME = N'master_backup_20100422230002', SKIP, REWIND, NOUNLOAD, STATS = 10 " failed with the following error: "Cannot open backup device '\\192.168.x.x\vmbackup\server\dbbackup\master_backup_201004222300.bak'. Operating system error 5(Access is denied.). BACKUP DATABASE is terminating abnormally.". Possible failure reasons: Problems with the query, "ResultSet" property not set correctly, parameters not set correctly, or connection not established correctly. I googled this error and tried adding permissions to the backup device for network service as recommended at experts exchange, no dice. Does anyone have any ideas?

    Read the article

  • My wireless network slows down every 7.5 minutes when my desktop is switched on

    - by Dog Ears
    My network has lag spikes lasting for a few seconds every 7.5 mins. The spikes also effect any other computer connected connected to my wirless router at the time. My wife has to connect her laptop via a cable to prevent the lag causing problems when she's VPNing into her work. If I switch my PC off the problem goes away! I've got an Edimax 7728ln 802.11n wireless card and Speedtouch 585v7 (I'm with Be) I've Tried... Updated the drivers from Edimax website: 2.0.3.0 (it does say 3.0.2.0 in devices properties though) WLAN Optimizer doesn't seem to be helping What can I do?

    Read the article

  • Putting a django login form on every page

    - by asciitaxi
    I'd like the login form (AuthenticationForm from django.contrib.auth) to appear on every page in my site if the user is not logged in. When the user logs in, they will be redirected to the same page. If there is an error, the error will be shown on the same page with the form. I suppose you'd need a context processor to provide the form to every template. But, then you'd also need every view to handle the posted form? Does this mean you need to create some middleware? I'm a bit lost. Is there an accepted way of doing this?

    Read the article

  • Hold i ajax call in every minute calling section

    - by gowri
    i am calling ajax every second in page.. Here the server page returns randomly generated number,using this number(converted into seconds) i am triggering another function in ajax success .it works My problem suppose random number = 5 means trigger() function called after 5 seconds using setTimeout,but rember ajax call is triggering every 1 second so trigger function also called many time. i want to make ajax call wait untill trigger function execution.Which means i wanna pause that ajax call untill 5 seconds after that resume How can i do this ? My coding //this ajax is called every minute $.ajax({ type: "POST", url: 'serverpage', data: ({pid:1}), success: function(msg) { var array = msg.split('/'); if(array[0]==1){ setTimeout(function() { trigger(msg); },array[1]+'000'); } } }); //and my trigger function function trigger(value) { alert("i am triggered !"); } server response maybe 1/2 or 1/5 or 1/ 10 or 1/1 here 1/3(this is converted into seconds)

    Read the article

  • oracle display for every stored procedure the execution time

    - by CC
    Hi all. I'm working on a stored procedure. Inside this one, there are many call to the other stored procedures. There are a bunch of them. I was wondering if there is a option to be able to have the execution time of every stored procedure involved, every function (with a start and end time, ior something like that). The idea is that I need to optimise it and I should touch every part, and since I not sure where is the longest execution time, is a bit difficult. And after a modification I would like the see the hole process if it's shorter or not. If I call the procedure from unix, using sql plus, I have no log. If I call it from TOAD, it's blocked until the end. Any idea? I'm not a dba, so I don't have many rights on the database, I'm just a regular user. Thanks for any advice. C.C.

    Read the article

  • My computer loses network connectivity every 30 minutes

    - by Logan Garland
    My LAN connected PC loses network connectivity every 30 minutes. It has a static IP address and I've checked to make sure there aren't any IP conflicts on my network. If I'm streaming from that PC to my Xbox the stream will be interrupted and it normally takes about a minute to come back online. The same happens if I'm actually on the PC and just browsing the web. I'm looking for suggestions on how to track down this issue. I've tried checking the available logs on my router to see if there is an issue with DCHP but have been unsuccessful in finding any evidence. Any suggestions would be helpful. I can't think of any recent changes to my network, PC or software installations that may have caused this. I am a software developer and have intermediate networking knowledge. EDIT: During one outage I told windows to troubleshoot the network problem and it said that it could automatically fix the problem by changing DCHP info. It basically said my network adapter from static to automatically obtain. This did fix the issue quicker than just waiting it out, but the outage occurred again 30 minutes later even when leaving those settings.

    Read the article

  • Server high memory usage at same time every day

    - by Sam Parmenter
    Right, we moved one of our main sites onto a new AWS box with plenty of grunt as it would allow us more control that we had before and future proof ourselves. About a month ago we started running into issues with high memory usage at the same time every day. In the morning an export is run to export data to a file which is the FTPed to a local machine for processing. The issues were co-inciding with the rough time of the export but when we didn't run the export one day, the server still ran into the same issues. The export has been run at other times in the day since to monitor memory usage to see if it spikes. The conclusion is that the export is fine and barely touches the sides memory wise. No noticeable change in memory usage. When the issue happens, its effect is to kill mysql and require us to restart the process. We think it might be a mysql memory issue, but might just be that mysql is just the first to feel it. Looking at the logs there is no particular query run before the memory usage hits 90%. When it strikes at about 9:20am, the memory usage spikes from a near constant 25% to 98% and very quickly kills mysql to save itself. It usually takes about 3-4 minutes to die. There are no cron jobs running at that time of the day and we haven't noticed a spike in traffic over the period of the issues. Any help would be massively appreciated! thanks.

    Read the article

  • Windows clients unable to access Samba share on AD joined Linux box every 7 days

    - by Hassle2
    The problem: Every 7 days, 2 Windows Servers are unable to access a SMB/CIFS share. It will start working after a handful of hours. The environment: OpenFiler Linux box joined to 2003 AD Domain Foreground app on Win2003 server access the SMB/CIFS share with windows credentials Another process on Win2008 access the share via SQL Server with windows credentials The Samba version on the Linux box is 3.4.5. Security is set to ADS wbinfo and getent return back expected users and groups Does not look to be a double hop issue as it's always the 2 accounts, regardless of the calling user. There is a DNS entry in both forward and reverse lookup zone for the linux box The linux box's computer object in active directory shows that it was modified around/at the same time that the two clients started failing to access the share Trying to access the share via IP works when by name does not Rebooting the Windows server takes care of it (it's production and only restarted it once) Restarting smbd, winbind, nmbd had no effect Error in samba log for the client in question: smbd/sesssetup.c:342(reply_spnego_kerberos) Failed to verify incoming ticket with error NT_STATUS_LOGON_FAILURE! The Question: Does this look like the machine account password is changing (hence the AD object showing the updated modified date) or are the two windows clients unable to request a new ticket that works against this linux box?

    Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >