Search Results

Search found 24037 results on 962 pages for 'every'.

Page 8/962 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • 'inode table usage' spiking every morning at 8am

    - by Harry Wood
    I installed munin on my ubuntu server. It's showing my 'inode table usage' spiking every morning at 8am. It then rapidly curves down and settles over the course of several hours. What might cause this? I thought it might be something running in /etc/cron.daily but this was set to run at 6a.m. and I've changed it to 4am. The spike remains at 8am. I also enabled cron logging, but can't see anything getting launched at 8a.m. It's a virtual server hosted by memset. Could it be caused by something happening on the virtual host?

    Read the article

  • S3200SH error 5220 every boot (CMOS/NVRAM Cleared by jumper)

    - by TechAUmNu
    I have a S3200SH Intel server board with a Intel Xeon 3220 Quad Core. Every time I boot it, I get error 5220 (CMOS/NVRAM Cleared by jumper). The jumper is not installed and I have replaced the lithium battery. The board overheated once, although still seems to work fine apart from this error. Also if I leave the board sitting in the bios for a while it sometimes randomly turns off, with all 4 diagnostic LED's red. I have moved the 2GB DIMM to another slot, which seems to have fixed this problem. Any ideas would be greatly appreciated.

    Read the article

  • Hanging page loads every n loads

    - by Christian
    Hi Guys I recently moved my site to a new server (Apache 2, PHP5, MySQL5). The site is an Invision based forum. Every few posts / topics it just hangs. The data has been written because if you stop and reload, the post / thread is there. I thought it was a write issue initially, but nope. So, the data is written but the page load never completes. It doesn't leave the page where the data has been input. Whats the best way to trouble shoot this issue? The only thing I have done recently is reduce my MySQL timeouts, but I can't see that being an issue as the values are still big enough and there are no mentions of timeouts in the MySQL log. (For the record there is nothing in PHP's error log either) Thanks in advance!

    Read the article

  • bash/sed/awk/etc remove every other newline

    - by carillonator
    a bash commands outputs this: Runtime Name: vmhba2:C0:T3:L14 Group State: active Runtime Name: vmhba3:C0:T0:L14 Group State: active unoptimized Runtime Name: vmhba2:C0:T1:L14 Group State: active unoptimized Runtime Name: vmhba3:C0:T3:L14 Group State: active Runtime Name: vmhba2:C0:T2:L14 Group State: active I'd like to pipe it to something to make it look like this: Runtime Name: vmhba2:C0:T1:L14 Group State: active Runtime Name: vmhba3:C0:T3:L14 Group State: active unoptimized Runtime Name: vmhba2:C0:T2:L14 Group State: active [...] i.e. remove every other newline I tried ... |tr "\nGroup" " " but it removed all newlines and ate up some other letters as well. thanks

    Read the article

  • System halts for a fraction of second after every 2-3 seconds

    - by iSam
    I'm using Windows 7 on my HP ProBook 4250s. The problem I face is that my system halts for a fraction of second after every 2-3 seconds. These jerks are not letting me concentrate or work properly. This happens even when I'm just typing in notepad while no other application is running. I tried to install every driver from HP's website and there's no item in device manager marked with yellow icon. Following are my system specs: Machine: HP ProBook 4250s OS: Windows 7 professional RAM: 2GB Processor: Intel Core i3 2.27GHz Following is my HijackThis Log: **Logfile of HijackThis v1.99.1** Scan saved at 9:34:03 PM, on 11/13/2012 Platform: Unknown Windows (WinNT 6.01.3504) MSIE: Internet Explorer v9.00 (9.00.8112.16450) **Running processes:** C:\Windows\system32\taskhost.exe C:\Windows\System32\rundll32.exe C:\Windows\system32\Dwm.exe C:\Windows\Explorer.EXE C:\Windows\System32\igfxtray.exe C:\Windows\System32\hkcmd.exe C:\Windows\System32\igfxpers.exe C:\Program Files\Synaptics\SynTP\SynTPEnh.exe C:\Program Files\PowerISO\PWRISOVM.EXE C:\Program Files\AVAST Software\Avast\AvastUI.exe C:\Program Files\Free Download Manager\fdm.exe C:\Windows\system32\wuauclt.exe C:\Program Files\Windows Media Player\wmplayer.exe C:\Program Files\Microsoft Office\Office12\WINWORD.EXE C:\HijackThis\HijackThis.exe R1 - HKCU\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKCU\Software\Microsoft\Internet Explorer\Main,Start Page = http://bing.com/ R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Page_URL = http://go.microsoft.com/fwlink/?LinkId=69157 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Search_URL = http://go.microsoft.com/fwlink/?LinkId=54896 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKLM\Software\Microsoft\Internet Explorer\Main,Start Page = http://go.microsoft.com/fwlink/?LinkId=69157 R0 - HKLM\Software\Microsoft\Internet Explorer\Search,SearchAssistant = R0 - HKLM\Software\Microsoft\Internet Explorer\Search,CustomizeSearch = R0 - HKCU\Software\Microsoft\Internet Explorer\Toolbar,LinksFolderName = R3 - URLSearchHook: (no name) - {7473b6bd-4691-4744-a82b-7854eb3d70b6} - (no file) O2 - BHO: Adobe PDF Reader Link Helper - {06849E9F-C8D7-4D59-B87D-784B7D6BE0B3} - C:\Program Files\Common Files\Adobe\Acrobat\ActiveX\AcroIEHelper.dll O2 - BHO: Babylon toolbar helper - {2EECD738-5844-4a99-B4B6-146BF802613B} - (no file) O2 - BHO: MrFroggy - {856E12B5-22D7-4E22-9ACA-EA9A008DD65B} - C:\Program Files\Minibar\Froggy.dll O2 - BHO: avast! WebRep - {8E5E2654-AD2D-48bf-AC2D-D17F00898D06} - C:\Program Files\AVAST Software\Avast\aswWebRepIE.dll O2 - BHO: Windows Live ID Sign-in Helper - {9030D464-4C02-4ABF-8ECC-5164760863C6} - C:\Program Files\Common Files\Microsoft Shared\Windows Live\WindowsLiveLogin.dll O2 - BHO: Minibar BHO - {AA74D58F-ACD0-450D-A85E-6C04B171C044} - C:\Program Files\Minibar\Kango.dll O2 - BHO: Free Download Manager - {CC59E0F9-7E43-44FA-9FAA-8377850BF205} - C:\Program Files\Free Download Manager\iefdm2.dll O2 - BHO: HP Network Check Helper - {E76FD755-C1BA-4DCB-9F13-99BD91223ADE} - C:\Program Files\Hewlett-Packard\HP Support Framework\Resources\HPNetworkCheck\HPNetworkCheckPlugin.dll O3 - Toolbar: (no name) - {98889811-442D-49dd-99D7-DC866BE87DBC} - (no file) O3 - Toolbar: avast! WebRep - {8E5E2654-AD2D-48bf-AC2D-D17F00898D06} - C:\Program Files\AVAST Software\Avast\aswWebRepIE.dll O4 - HKLM\..\Run: [IgfxTray] C:\Windows\system32\igfxtray.exe O4 - HKLM\..\Run: [HotKeysCmds] C:\Windows\system32\hkcmd.exe O4 - HKLM\..\Run: [Persistence] C:\Windows\system32\igfxpers.exe O4 - HKLM\..\Run: [SynTPEnh] %ProgramFiles%\Synaptics\SynTP\SynTPEnh.exe O4 - HKLM\..\Run: [PWRISOVM.EXE] C:\Program Files\PowerISO\PWRISOVM.EXE -startup O4 - HKLM\..\Run: [AdobeAAMUpdater-1.0] "C:\Program Files\Common Files\Adobe\OOBE\PDApp\UWA\UpdaterStartupUtility.exe" O4 - HKLM\..\Run: [AdobeCS6ServiceManager] "C:\Program Files\Common Files\Adobe\CS6ServiceManager\CS6ServiceManager.exe" -launchedbylogin O4 - HKLM\..\Run: [SwitchBoard] C:\Program Files\Common Files\Adobe\SwitchBoard\SwitchBoard.exe O4 - HKLM\..\Run: [ROC_roc_ssl_v12] "C:\Program Files\AVG Secure Search\ROC_roc_ssl_v12.exe" / /PROMPT /CMPID=roc_ssl_v12 O4 - HKLM\..\Run: [avast] "C:\Program Files\AVAST Software\Avast\avastUI.exe" /nogui O4 - HKLM\..\Run: [Wordinn English to Urdu Dictionary] "C:\Program Files\Wordinn\Urdu Dictionary\bin\Lugat.exe" -h O4 - HKLM\..\Run: [Adobe Reader Speed Launcher] "C:\Program Files\Adobe\Reader 8.0\Reader\Reader_sl.exe" O4 - HKCU\..\Run: [Comparator Fast] "C:\Program Files\Interdesigner Software\Comparator Fast\ComparatorFast.exe" /STARTUP O4 - HKCU\..\Run: [Free Download Manager] "C:\Program Files\Free Download Manager\fdm.exe" -autorun O8 - Extra context menu item: Download all with Free Download Manager - file://C:\Program Files\Free Download Manager\dlall.htm O8 - Extra context menu item: Download selected with Free Download Manager - file://C:\Program Files\Free Download Manager\dlselected.htm O8 - Extra context menu item: Download video with Free Download Manager - file://C:\Program Files\Free Download Manager\dlfvideo.htm O8 - Extra context menu item: Download with Free Download Manager - file://C:\Program Files\Free Download Manager\dllink.htm O8 - Extra context menu item: E&xport to Microsoft Excel - res://C:\PROGRA~1\MICROS~2\Office12\EXCEL.EXE/3000 O9 - Extra button: @C:\Program Files\Hewlett-Packard\HP Support Framework\Resources\HPNetworkCheck\HPNetworkCheckPlugin.dll,-103 - {25510184-5A38-4A99-B273-DCA8EEF6CD08} - C:\Program Files\Hewlett-Packard\HP Support Framework\Resources\HPNetworkCheck\NCLauncherFromIE.exe O9 - Extra 'Tools' menuitem: @C:\Program Files\Hewlett-Packard\HP Support Framework\Resources\HPNetworkCheck\HPNetworkCheckPlugin.dll,-102 - {25510184-5A38-4A99-B273-DCA8EEF6CD08} - C:\Program Files\Hewlett-Packard\HP Support Framework\Resources\HPNetworkCheck\NCLauncherFromIE.exe O9 - Extra button: Research - {92780B25-18CC-41C8-B9BE-3C9C571A8263} - C:\PROGRA~1\MICROS~2\Office12\REFIEBAR.DLL O9 - Extra button: Change your facebook look - {AAA38851-3CFF-475F-B5E0-720D3645E4A5} - C:\Program Files\Minibar\MinibarButton.dll O10 - Unknown file in Winsock LSP: c:\windows\system32\nlaapi.dll O10 - Unknown file in Winsock LSP: c:\windows\system32\napinsp.dll O10 - Unknown file in Winsock LSP: c:\program files\common files\microsoft shared\windows live\wlidnsp.dll O10 - Unknown file in Winsock LSP: c:\program files\common files\microsoft shared\windows live\wlidnsp.dll O11 - Options group: [ACCELERATED_GRAPHICS] Accelerated graphics O11 - Options group: [INTERNATIONAL] International O13 - Gopher Prefix: O17 - HKLM\System\CCS\Services\Tcpip\..\{920289D7-5F75-4181-9A37-5627EAA163E3}: NameServer = 8.8.8.8,8.8.4.4 O17 - HKLM\System\CCS\Services\Tcpip\..\{AE83ED2F-EF14-4066-ACE2-C4ED07A68EAA}: NameServer = 9.9.9.9,8.8.8.8 O18 - Protocol: ms-help - {314111C7-A502-11D2-BBCA-00C04F8EC294} - C:\Program Files\Common Files\Microsoft Shared\Help\hxds.dll O18 - Protocol: skype4com - {FFC8B962-9B40-4DFF-9458-1830C7DD7F5D} - C:\PROGRA~1\COMMON~1\Skype\SKYPE4~1.DLL O18 - Protocol: wlpg - {E43EF6CD-A37A-4A9B-9E6F-83F89B8E6324} - C:\Program Files\Windows Live\Photo Gallery\AlbumDownloadProtocolHandler.dll O18 - Filter hijack: text/xml - {807563E5-5146-11D5-A672-00B0D022E945} - C:\PROGRA~1\COMMON~1\MICROS~1\OFFICE12\MSOXMLMF.DLL O20 - AppInit_DLLs: c:\progra~2\browse~1\23787~1.43\{16cdf~1\browse~1.dll c:\progra~2\browse~1\22630~1.40\{16cdf~1\browse~1.dll O20 - Winlogon Notify: igfxcui - C:\Windows\SYSTEM32\igfxdev.dll O23 - Service: avast! Antivirus - AVAST Software - C:\Program Files\AVAST Software\Avast\AvastSvc.exe O23 - Service: Google Software Updater (gusvc) - Google - C:\Program Files\Google\Common\Google Updater\GoogleUpdaterService.exe O23 - Service: HP Support Assistant Service - Hewlett-Packard Company - C:\Program Files\Hewlett-Packard\HP Support Framework\hpsa_service.exe O23 - Service: HP Quick Synchronization Service (HPDrvMntSvc.exe) - Hewlett-Packard Company - C:\Program Files\Hewlett-Packard\Shared\HPDrvMntSvc.exe O23 - Service: HP Software Framework Service (hpqwmiex) - Hewlett-Packard Company - C:\Program Files\Hewlett-Packard\Shared\hpqWmiEx.exe O23 - Service: HP Service (hpsrv) - Hewlett-Packard Company - C:\Windows\system32\Hpservice.exe O23 - Service: Intel(R) Management and Security Application Local Management Service (LMS) - Intel Corporation - C:\Program Files\Intel\Intel(R) Management Engine Components\LMS\LMS.exe O23 - Service: Mozilla Maintenance Service (MozillaMaintenance) - Mozilla Foundation - C:\Program Files\Mozilla Maintenance Service\maintenanceservice.exe O23 - Service: @%SystemRoot%\system32\qwave.dll,-1 (QWAVE) - Unknown owner - %windir%\system32\svchost.exe (file missing) O23 - Service: @%SystemRoot%\system32\seclogon.dll,-7001 (seclogon) - Unknown owner - %windir%\system32\svchost.exe (file missing) O23 - Service: Skype Updater (SkypeUpdate) - Skype Technologies - C:\Program Files\Skype\Updater\Updater.exe O23 - Service: Adobe SwitchBoard (SwitchBoard) - Adobe Systems Incorporated - C:\Program Files\Common Files\Adobe\SwitchBoard\SwitchBoard.exe O23 - Service: Intel(R) Management & Security Application User Notification Service (UNS) - Intel Corporation - C:\Program Files\Intel\Intel(R) Management Engine Components\UNS\UNS.exe O23 - Service: @%PROGRAMFILES%\Windows Media Player\wmpnetwk.exe,-101 (WMPNetworkSvc) - Unknown owner - %PROGRAMFILES%\Windows Media Player\wmpnetwk.exe (file missing)

    Read the article

  • Join .doc files into one .doc (with keeping the original format of every document)

    - by Shiki
    I have about ~50 .doc files, that look perfect (they are extracted with Able2Extract). Now I want to join these 50 files into one huge .doc. I've tried using Word's in-built "Insert" feature, but that messed up the whole format. I want to keep everything I have. Like just document1 - document2 - document3. Nothing "intelligent" or "smart" needed during the conversion, just the capability of joining them. (Thus making them all searchable, that's the ultimate aim.) I don't mind if the method/solution applies a single blank page at every document end either.

    Read the article

  • Google Chrome calling nypost.com every ~5 seconds

    - by TonyM
    I'm using Chrome 21.0.1180.49 beta on Mac OS X 10.7.4. Did some Googling and can't figure this out. I visited a page on nypost.com earlier this morning. Just noticed that Little Snitch is reporting that nypost.com is being called every 4-6 seconds or so. I closed the tab after reading the story, a few hours ago. I created a rule in Little Snitch denying access to nypost.com, but Chrome is apparently still connecting to it. (1) Why? and (2) How can I put an end to this? Thanks in advance for any thoughts.

    Read the article

  • Does every SmartCard have unique ID?

    - by mr.b
    Does anyone knows if every SmartCard has some unique identifying number that can be read by using ordinary card reader? Number format doesn't matter at all (or string format), just the fact that it exists and that it's readable is enough. I know that new smartcards can be programmed to my liking, and that I can issue unique IDs to them in the process, but I'm more interested in reading unique ID from credit cards, phone calling cards, stuff like that. I should probably mention what is intended purpose for this, before I get incinerated. I want to find easy way to uniquely identify walk-in customers, most of people have at least one smartcard in their pocket...

    Read the article

  • Changing IP every sec with Firefox

    - by Carol
    I looking for ip changer what is faster than PROXY (i tried Elite Proxy Switcher + Firefox add-on, but it's too slow. I set automatic switching to 4 sec and yes he change the ip every 4 sec however it's not enough because it loads pages very slowly.) Secondly I tried the TOR Project but this is not good..because the TOR would be nice and working good however he needs more than 10 seconds, a new identity and it's not to good for me because i want to change my ip lass than 10 sec. So I find the solution. This is IPfucker alias ipFlood (https://addons.mozilla.org/en-us/firefox.../ipflood/) But it does not work on all sites unfortunately...because this is just simulation "Simulate the use of a series of proxy changing at each new connection.". Anyone knows a solution to the problem? Is there an alternative (VPS, Proxy, TOR)? Thanks in advice.

    Read the article

  • Java 6.0 Virtual Machine re-caches application on every load

    - by David Neale
    I have a Java application which is loaded and cached by the JRE and for most users it only needs to cache once unless the application software has changed. However, I have one computer that caches the entire application every time they load it. It is not the version of the JRE, I have that running on other machines. It also works on this machine if logged in as a local admin, just not as a standard user. Does anybody have any ideas on what might be causing this?

    Read the article

  • Domain Outlook user is asked for password every time despite checking the 'remember password' button

    - by MrVimes
    We have a windows 2003 domain. All users have roaming profiles. We have a couple of users who, when they log into outlook, are asked for their password every time, despite selecting the 'remember my password' option. Our email is externally hosted exchange email. I've tried several fixes found on google such as deleting 'protect' folder in the user's profile, and deleting protect key in the registry but none work. I tried storing the password in windows' password/credentials manager, didn't work. It happens on any PC the users log into so it's not a machine specific problem. Any ideas? OS is Windows XP pro. Outlook is 2007.

    Read the article

  • Sharepoint Server 2007 generates event log entry every 5 minutes - "The SSP Timer Job Distribution L

    - by Teevus
    I get the following error logged into the Event Log every 5 minutes: The SSP Timer Job Distribution List Import Job was not run. Reason: Logon failure: the user has not been granted the requested logon type at this computer In addition, OWSTimer.exe periodically gets into a state where its consuming almost all the CPU and only killing the process or restarting the Sharepoint services fixes it (although I'm not sure if this is a related or seperate issue). I have tried the following (based on various suggestions floating around the web), all to no avail: iisreset (no affect) Added the Sharepoint and Sharepoint Search service accounts to Log on as a batch job and Log on as a service policies in the Group Policies for the domain. I went into the Local Computer Policy on the Sharepoint server and verified that those policies had actually been applied Verified that the Sharepoint and Sharepoint Search service accounts are both in the WSS_WPG group Verified in dcomcnfg that the WSS_WPG group (and indeed the Sharepoint and Sharepoint search service accounts) has local activation rights for SPSearch. Any more suggestions would be valued. Thanks

    Read the article

  • Copying single files into a folder that changes name every time the batch file is executed

    - by Daniel Jochem
    Can you please help, I am using this to put the text files made by the batch file into the folder created by the batch file as well. but my problem is that the name is changed of the new folder every time because it is named by the date and time it was created. This is the code: @echo off for /F " tokens=1,2,3* delims=/, " %%i IN ('date /T') DO ( set CUR_DAY_OF_WEEK=%%i set CUR_MONTH=%%j set CUR_DAY=%%k set CUR_YEAR=%%l) for /F " tokens=1,2,3* delims=:, " %%i IN ('time /T') DO ( set CUR_HOUR=%%i set CUR_MIN=%%j set AM_PM=%%k) if not exist E:\Private goto :F cd E:\Private md "E:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :F if not exist F:\Private goto :G cd F:\Private md "F:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :G cd G:\Private md "G:\Private\%CUR_HOUR%.%CUR_MIN%%AM_PM% %j%%CUR_MONTH%-%CUR_DAY%-%CUR_YEAR%" goto :start :start start /min A /stext A.txt start /min B /stext B.txt start /min C /stext C.txt start /min D /stext D.txt (As the directory (E:-G:) changes, how can I check all without an error? And once that is found, then put all these text files into the date folder.

    Read the article

  • OOM-Killer called every now and then..

    - by SpyrosP
    Hello there, i have a dedicated server where i've installed apache2, as well as Rails Passenger. Although i have 2GBs of RAM and most times about 1,5GB is free, there are some random times when i lose ssh and generic connectivity because oom-killer is killing processes. I suppose there is a memory leak but i cannot find out where it comes from. oom-killer kills apache2, mysql, passenger, whatever. Yesterday, i did a "cat syslog | grep -c oom-killer" and got 57 occurences ! It seems that something seriously destroys the memory. Once i reboot, everything comes back to normal. I suspect that it can be related to Passenger, but i'm still trying to figure it out. Can you think of anything else, or do you have anything to suggest that will make the leak identification procedure easier ? (i was even thinking of writing a bash script, to be run with cron for like every 5 minutes).

    Read the article

  • automatically switch from display 1 to display 2 every x minutes

    - by Jean-Pierre
    I am not that good with programmation, but I guess you are. we are planning to install 2 display monitor in the back of the other one. There will be 1 computer that will display a different application on each display monitor. I want to be able to switch display 1 to 2 and display 2 to display 1 to show what is on the other monitor without having to move themselve on the back of the monitor to see the opposite monitor. I need a script that will switch display every x times. How can I do that ?

    Read the article

  • Cron Script to Delete Folder Contents Every 5 Minutes on Media Temple

    - by Brian Iannone
    I'm not familiar with server-side scripting, but I'm currently using a PHP application on Media Temple to cache JPEGs from four webcams hosted on a server located in the middle of the Indian Ocean. (Hence my reason for caching them in the US.) The webcams are updated every five minutes. The PHP application stores the cached images in http://static.rigic.co/cache/. I would like to create a cron script to automatically delete the contents of "cache" (not the folder itself; just the files inside) at a regular interval.

    Read the article

  • Why does VirtualBox want my attention every morning?

    - by Ken
    I'm running Vista 64-bit Ultimate on this PC. On it, I've installed VirtualBox, and in that I'm running Linux. Everything's working great. I leave it running all the time. When I come in in the morning, every time, the "Sun VirtualBox" item in the Windows taskbar is bright orange, like it's trying to get my attention. What would cause this? I'm curious both if somebody has an idea of something VirtualBox might do that warrants this attention-grab, or what to look for in the VB logs to find out what causes this. I'm sure it's harmless, but I'd like to stop it if I can.

    Read the article

  • IIS needs to be restarted every morning

    - by Kevin
    In one of my Application and DB Server , SSIS package runs at night. Every morning i need to reset IIS to work the Application Fast and smoothly. One day i tried to SKIP the SSIS Package and next day i hvnt Done the IIS reset. What could be the problem. Is there any alternate Solution for IIS reset. How can i schedule and make sure the IIS is RESTARTED through Batch File / s. Application is developed in .NET and DB is SQL latest version. The application is hostes on cloud server. Your prompt reply will be helpful for me.

    Read the article

  • OS X Terminal using default ANSI colours for every theme

    - by FrogBot
    For some reason, every theme I palette I've had installed for the OS X Terminal.app has reverted to using the default ANSI colours. The themes have been working fine up until this point and I can't seem to determine what could have caused them to revert in this way. For reference, my standard Solarized Dark colour scheme should look like this … … but it currently looks like this: A quick look in the preferences panel shows that all the colours are correct save for the ANSI colours which have reverted to their defaults. I don't know what other information would be helpful but if you need any other info to help me troubleshoot just ask and I'll update as quickly as I can.

    Read the article

  • Losing partitions after every reboot

    - by Winston Smith
    I have an Acer laptop with one hard disk, which up until yesterday had 4 partitions: Recovery Partition (13GB) C: (140GB) D: (130GB) OEM Partition (10GB) I read that the OEM partition has all the stuff needed to restore the laptop to the factory settings, but since I'd already created restore disks and I needed the space, I wanted to get rid of it. Yesterday, I used diskpart to do that. In diskpart, I selected the OEM partition and issued the delete partition override command which removed it. Then I extended the D: partition into the unused space using windows disk management. Everything worked fine, until I rebooted my laptop, at which point the D: drive vanished. Looking in windows disk management again, I can see that there's an OEM partition of 140GB, which is obviously my D: drive. So I used EASEUS Partition Master and assigned a drive letter to the 'OEM' partition and I was able to access my files again. However, every time I reboot, it reverts back. How do I fix this permanently?

    Read the article

  • Help me find the offending process waking my Windows 7 PC from hibernate every night

    - by DavidGugick
    Recently my Windows 7 64-bit PC has started waking every night from hibernation around 3:30am. I have done the following to try and figure out what is causing the issue with no luck: Examined the Windows Event logs. Nothing is noted Ran powercfg -lastwake and that reports nothing c:\powercfg -lastwake Wake History Count - 1 Wake History [0] Wake Source Count - 0 Ran powercfg to find what devices are armed for wake. Interestingly, this reports two items (I've already unchecked the "Allow this device to wake the computer" in device manager): The keyboard and something called the "eHome Infrared Receiver (USBCIR)". This is a desktop PC and it does not have an Infrared received, so I'm not sure what that device is. Suffice to say it does not have the option to "Allow device to wake..." available in Device Manager. C:\powercfg -devicequery wake_armed eHome Infrared Receiver (USBCIR) HID Keyboard Device My next step is to disable the Keyboard from wake, but I'm not convined that's the problem. This is on a Dell XPS435 if that helps anyone.

    Read the article

  • My laptop can connect to every wireless network except fios

    - by going crazy
    I have always been able to connect to every wireless router secured or unsecured wep or wpa. I had Fios installed and could not connect. Verizon suggested it was my computer and gave me an outside wirless drive to use, it worked. I got rid of fios and went back to comcast and threw out the drive, but now 2 years later, I am sitting at my friends house haveing the same problem. My tech savy friend told me it is a firewall setting or something in my antivirus software, but I disabled them both and still nothing works........Funny it is only FIOS

    Read the article

  • Make backups of Dropbox folder every week

    - by ilansch
    I have a Dropbox folder which is shared by couple of users. I would like to make a backup of this folder that will occur every week and store this backup on another hard drive. I can simply copy the entire folder each time and this will be the backup, but I would like to copy only the files that have been changed or created during that week. I thought of creating a batch script that will check each file in the Dropbox folder recursively and see its modified date. If that date is later then a given one (current backup date) it will copy the file to a folder named BackUP[Date]. Do you think this solution is OK?

    Read the article

  • Green bar on top of every (web) video, distorted colors too

    - by Walter Maier-Murdnelch
    Hey since a few days I have a problem with some videos I watch on the web (youtube, vimeo etc). There is a green bar on the top of the video and the colors are distorted, it looks like they are somehow shifted. I am not sure since when this problem appeared, I guess it might have been an update for the flash player. Anyways, I found a workaround. Disabling the hardware acceleration helps. right click on video - settings - disable hardware acceleration. After reloading of the page the green bar is gone. The problem is taht this setting doesn't seem to be persistent and so I have to disable it again on every other video. How can I make this setting permanent or how to get rid of the green bar alltogether? (I will add a screenshot later)

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >