Search Results

Search found 18841 results on 754 pages for 'path finding'.

Page 90/754 | < Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >

  • jQuery: Finding file size and adding it to the link

    - by Ricardo
    Let me start by saying that I'm not a jQuery guru by any means and I genuinely know this is over my head, that's why I've come to SO. Is there a way with jQuery to find the file size of a link on a page and then inject/add the text of the file size next to the link? Here's my problem On one of my pages, I have a link to my resume which is a PDF file and to improve usability it's proper to have the file type and file size next to the link so the users have the option to decide if they want to click on that link or not. So the link would read something like "Download my resume (PDF / 80KB)" The problem is that I'm constantly updating my resume and uploading a new PDF file which, of course, has a different file size so I'm always going back to the HTML and changing the text to reflect the new file size. Is there a way to automate this with jQuery... or plain JavaScript for that matter? I found this script and made a demo here in Codepen but it doesn't seem to work. Any help with this would be greatly appreciated.

    Read the article

  • Controlling youtube traffic path ingoing to multihoming network

    - by Hamdy Ali
    Scenario: I've network multihoming (dual ISP) setup. each ISP bandwidth 500Mbps Currently ISP-A link bandwidth almost fully utilized then the second ISP-B link From our investigation, it is because youtube server cache response to link ISP-A. Some time the utilization of link ISP B increased because at that time youtube server cached is response to ISP B. My question how/Why did this happen? how do I force youtube cache server using ISP link B?

    Read the article

  • finding middle element of an array

    - by senthil
    Hi all, I came cross a question in my interview. Question: Array of integers will be given as the input and you should find out the middle element when sorted , but without sorting. For Example. Input: 1,3,5,4,2 Output: 3 When you sort the given input array, it will be 1,2,3,4,5 where middle element is 3. You should find this in one pass without sorting. Any solutions for this?

    Read the article

  • Return current web path in PHP

    - by BenTheDesigner
    Hi All Currently developing a PHP framework and have ran into my first problem. I need to be able to drop the framework into any folder on a server, no matter how many folders deep, and need to find that directory to use as a base URL. For example, it currently works if I put the framework in the root of the server (http://cms.dev/), but if I were to put it in http://cms.dev/folder/ it does not work. Please advise, any comments welcome. BenTheDesigner

    Read the article

  • Finding users near other user

    - by Bunny Rabbit
    what algorithms should I explore to implement a feature which lets a user find other user located near him , the latitude and the longitudes of all the user are known in advance and are fixed [not dynamic]. Also i believe that there should be a better way to store such data then simply storing the lat , long of the user against his user id in a database.What are the efficient ways to handle this ?

    Read the article

  • Help Needed Finding a Programmer

    - by ssean
    Good Morning, I am trying to find a programmer to code a piece of custom software for my business. I plan on using this software to manage my business, and possibly sell it to other companies (in the same industry) at a later date. I've never hired a programmer before, so I'm not sure what to expect or where to begin. I know exactly what features I need, and how I want it laid out, I just need someone who can take my ideas and make it happen. This software will be used to manage customer information, and keep track of orders. What I think I need: * SQL Server or similar database that will be located at our office. * Desktop Application, that connects via LAN to the database server (cannot be browser based) * Multiple User Support (Simultaneous users accesing the system) * Needs to be scalable (currently we have 5 employees, but who knows what the future will bring) * Multi-Platform Support (Windows, Linux) I posted a job offer through elance, which seems to raise more questions than answers. How do I decide what language(s) will work best for my situation? (I have received offers for C#, Eclipse, .NET, Powerbuilder, etc. - I want to make sure that I choose the best one now, so I don't run into problems later) Does the programmer hold any rights to the software? (I plan to offer the software for sale at a later date) Any help or insight would be appreciated, and I'd be happy to clarify anything if it helps. Thanks in advance!

    Read the article

  • Django template Path

    - by user74283
    Hi I m following the tutorial on http://docs.djangoproject.com/en/dev/intro/tutorial02/#intro-tutorial02 in windows 7 envoirement. my settings file is TEMPLATE_DIRS = ( 'C:/django-project/myapp/mytemplates/admin' ) i got the base_template from the template admin/base_site.html from within the default Django admin template directory in the source code of Django itself (django/contrib/admin/templates) into an admin subdirectory of myapp directory as the tutorial instructed. It doesn't seem to take affect for some reason. Any clue of what might be the problem? Do i have to do a sync db ?

    Read the article

  • Finding 'free' times in MySQL

    - by James Inman
    Hi, I've got a table as follows: mysql> DESCRIBE student_lectures; +------------------+----------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+----------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | course_module_id | int(11) | YES | MUL | NULL | | | day | int(11) | YES | | NULL | | | start | datetime | YES | | NULL | | | end | datetime | YES | | NULL | | | cancelled_at | datetime | YES | | NULL | | | lecture_type_id | int(11) | YES | | NULL | | | lecture_id | int(11) | YES | | NULL | | | student_id | int(11) | YES | | NULL | | | created_at | datetime | YES | | NULL | | | updated_at | datetime | YES | | NULL | | +------------------+----------+------+-----+---------+----------------+ I'm essentially wanting to find times when a lecture doesn't happen - so to do this I'm thinking a query to group overlapping lectures together (so, for example, 9am-10am and 10am-11am lectures will be shown as a single 9am-11am lecture). There may be more than two lectures back-to-back. I've currently got this: SELECT l.start, l2.end FROM student_lectures l LEFT JOIN student_lectures l2 ON ( l2.start = l.end ) WHERE l.student_id = 1 AND l.start >= '2010-04-26 09:00:00' AND l.end <= '2010-04-30 19:00:00' AND l2.end IS NOT NULL AND l2.end != l.start GROUP BY l.start, l2.end ORDER BY l.start, l2.start Which returns: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 11:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 12:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 14:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 15:15:00 | 2010-04-26 17:15:00 | | 2010-04-26 16:15:00 | 2010-04-26 18:15:00 | ...etc... The output I'm looking for from this would be: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 18:15:00 | Any help appreciated, thanks!

    Read the article

  • Mongo: Finding from multiple queries

    - by waxical
    New to Mongo here. I'm using the PHP lib and trying to work out how I can find in a collection from multiple queries. I could do this by repeating the query with a different query, but I wondered if it can be done in one. I.e. $idsToLookFor = array(2124,4241,5553); $query = $db->thisCollection->find(array('id' => $idsToLookFor)); That's what I'd like to do. However it doesn't work. What I'm trying to do is find a set of results for all the id's at one time. Possible or just do a findOne on each with a foreach/for?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Python finding repeating sequence in list of integers?

    - by tijko
    I have a list of lists and each list has a repeating sequence. I'm trying to count the length of repeated sequence of integers in the list: list_a = [111,0,3,1,111,0,3,1,111,0,3,1] list_b = [67,4,67,4,67,4,67,4,2,9,0] list_c = [1,2,3,4,5,6,7,8,9,0,1,2,3,4,5,6,7,8,9,0,23,18,10] Which would return: list_a count = 4 (for [111,0,3,1]) list_b count = 2 (for [67,4]) list_c count = 10 (for [1,2,3,4,5,6,7,8,9,0]) Any advice or tips would be welcome. I'm trying to work it out with re.compile right now but, its not quite right.

    Read the article

  • Finding minimum value in a Map

    - by Sunny
    I have a map and I want to find the minimum value (right hand side) in the map. Right now here is how I did it bool compare(std::pair<std::string ,int> i, pair<std::string, int> j) { return i.second < j.second; } //////////////////////////////////////////////////// std::map<std::string, int> mymap; mymap["key1"] = 50; mymap["key2"] = 20; mymap["key3"] = 100; std::pair<char, int> min = *min_element(mymap.begin(), mymap.end(), compare); std::cout << "min " << min.second<< " " << std::endl; This works fine and I'm able to get the minimum value the problem is when I put this code inside my class it doesn't seem to work int MyClass::getMin(std::map<std::string, int> mymap) { std::pair<std::string, int> min = *min_element(mymap.begin(), mymap.end(), (*this).compare); //error probably due to this return min.second; } bool MyClass::compare( std::pair<std::string, int> i, std::pair<std::string, int> j) { return i.second < j.second; } Also is there a better solution not involving to writing the additional compare function

    Read the article

  • SQLite Asp.net Path Problem

    - by drorhan
    when using data source=|DataDirectory|\mydb.sqlite in visual studio 2008 i can not see the tables in query builder and in dataset designer. How can i fix this? it is a web application for .net 3.5 thanks a lot

    Read the article

  • Finding records within a 5 min time interval in SQL

    - by Mellonjollie
    I have a table with over 100,000 rows that contain the following columns: ID, Time, and Boolean. The time column tracks time down to the second. I need a query that will find all instances of Boolean = 1 for every 5 minute interval of time from the start of the table to the end, then group the count by time interval. The table represents 4 hours of data, so I should get 48 rows of results. I'm using MS SQL Server. I've tried a few approaches, but the time interval logic is giving me a hard time.

    Read the article

  • Finding object count where a field is unique in Django

    - by Johnd
    I have a model that is something like this: class Input(models.Model): details = models.CharField(max_length=1000) user = models.ForeignKey(User) class Case(Input): title = models.CharField(max_length=200) views = models.IntegerField() class Argument(Input): case = models.ForeignKey(Case) side = models.BooleanField() A user can submit many arguments, per case. I want to be able to say how many users have submitted side=true arguments. I mean if 1 user had 10 arguments and another user had 2 arguments (both side=true) I'd want the count to be 2, not 12.

    Read the article

  • Finding existing tickets before opening new ones on trac

    - by Jens Jansson
    We're using Trac as the task management tool at the project we work in. However, Trac search is maybe not the most intuitive search out there, and we end up having multiple duplicates as the reporters can't effectively find if there already is a reported ticket of the question he or she found. Stack Overflow's "Related Questions" concept is great and works magnificently! I was wondering if someone has heard of some similar plugin to Trac, or if you have solved this problem some other way.

    Read the article

  • Architecture of finding movable geotagged objects

    - by itsme
    I currently have a Postgres DB filled with approx. 300.000 data-sets of moving vehicles all over the world. My very frequently repeated query is: Give me all vehicles in a 5/10/20mile radius. Currently I spend around 600 to 1200 ms in the DB to prepare the set of located vehicle-objects. I am looking to vastly improve this time by ideally one or two orders of magnitude if possible. I am working in a Ruby on Rails 3.0beta environment if this is relevant. Any ideas how to architect the whole system to accelerate this query? Any NoSQL database able to deliver this kind of geolocation performance? I know of MongoDB working on an extension to facilitate this scenario but haven't tried it yet. Any intelligent use of Redis to achieve this? One problem with SQL-DBs here seems to be that I can't possibly use indexes because my vehicles are mostly moving around, meaning I had to constantly created DB indexes which, by itself, is probably more expensive than just doing the searching without index. Looking forward to your thoughs, Thanks!

    Read the article

  • Finding whether a point lies inside a rectangle or not

    - by avd
    The rectangle can be oriented in any way...need not be axis aligned. Now I want to find whether a point lies inside the rectangle or not. One method I could think of was to rotate the rectangle and point coordinates to make the rectangle axis aligned and then by simply testing the coordinates of point whether they lies within that of rectangle's or not. The above method requires rotation and hence floating point operations. Is there any other efficient way to do this??

    Read the article

< Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >