Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 909/1408 | < Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >

  • mysqli_stmt_bind_param SQL Injection

    - by profitphp
    Is there still an injection risk when using prepared statements and mysqli_stmt_bind_param? For example: $malicious_input = 'bob"; drop table users'; mysqli_stmt_bind_param($stmt, 's', $malicious_input); Behind the scenes does mysqli_stmt_bind_param pass this query string to mysql: SET @username = "bob"; drop table users"; Or does it perform the SET command through the API, or use some type of protection to keep this from happening?

    Read the article

  • Is there value in unit testing auto implemented properties

    - by ahsteele
    It seems exceptionally heavy handed but going by the rule anything publicly available should be tested should auto-implemented properties be tested? Customer Class public class Customer { public string EmailAddr { get; set; } } Tested by [TestClass] public class CustomerTests : TestClassBase { [TestMethod] public void CanSetCustomerEmailAddress() { //Arrange Customer customer = new Customer(); //Act customer.EmailAddr = "[email protected]"; //Assert Assert.AreEqual("[email protected]", customer.EmailAddr); } }

    Read the article

  • Read from a file into an array and stop if a ":" is found in ruby

    - by Minky
    Hi! How can I in Ruby read a string from a file into an array and only read and save in the array until I get a certain marker such as ":" and stop reading? Any help would be much appreciated =) For example: 10.199.198.10:111 test/testing/testing (EST-08532522) 10.199.198.12:111 test/testing/testing (EST-08532522) 10.199.198.13:111 test/testing/testing (EST-08532522) Should only read the following and be contained in the array: 10.199.198.10 10.199.198.12 10.199.198.13

    Read the article

  • Namespace constant in C#

    - by pm_2
    Is there any way to define a contsant variable for an entire namespace, rather than just within a class? For example: namespace MyNamespace { public const string MY_CONST = "Test"; static class Program { } } Gives a compile error as follows: Expected class, delegate, enum, interface, or struct

    Read the article

  • How to mix two arrays in Java?

    - by roddik
    Hello. I have some String[] arrays, for example: ['a1', 'a2'] ['b1', 'b2', 'b3', 'b4'] ['c1'] How can I mix them, so that I get ['a1', 'b1', 'c1', 'a2', 'b2', 'b3', 'b4'] (0 element of a, then b, c, 1 element of a, b, c and so on)? Thanks

    Read the article

  • Java: file write on finalize method

    - by sowrov
    In my understanding a singleton object will destroy only when the application is about to terminate. So in C++ I write a Singleton class to log my application and in that Singleton logger's destructor I log the time when my application was terminated. Things worked perfectly in C++. Now I want to have that same logger in Java, as in java there is no destructor so I implemented the finalize method for that singleton logger. But it seem that finalize method actually never get called. So, I add that System.runFinalizersOnExit(true); line, somewhere in my code (though I know it is deprecated) and that finalize method get called every time before termination of the app. But still there is a problem! If I try to write anything on file in that finalize method, It does not work, though System.out work without any problem! :( Can you guys help me on this problem? Here is a sample code of what I am try to do: Singleton Logger Class: public class MyLogger { FileWriter writer; private MyLogger() { try { this.writer = new FileWriter("log.txt"); } catch (IOException ex) { } } public static MyLogger getInstance() { return MyLoggerHolder.INSTANCE; } private static class MyLoggerHolder { private static final MyLogger INSTANCE = new MyLogger(); } @Override protected void finalize () { try { super.finalize(); System.out.println("Here"); //worked correctly. this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write("End"); this.writer.flush(); //does not work! this.writer.close(); } catch (Throwable ex) { } } public synchronized void log(String str) { try { this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write(str+"\n"); this.writer.flush(); } catch (IOException ex) { } } } Main: public class Main { public static void main(String[] args) { System.runFinalizersOnExit(true); MyLogger logger = MyLogger.getInstance(); logger.log("test"); } }

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Requested Service not found

    - by mathirengasamy
    I have an windows service application with which works on remoting.That is used to display the ballontip. sometime it displays this error... Exception :Requested Service not foundInner Exception : Stack Trace : Server stack trace: at System.Runtime.Remoting.Channels.BinaryServerFormatterSink.ProcessMessage(IServerChannelSinkStack sinkStack, IMessage requestMsg, ITransportHeaders requestHeaders, Stream requestStream, IMessage& responseMsg, ITransportHeaders& responseHeaders, Stream& responseStream) Exception rethrown at [0]: at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at Baloontip.clsBaloonTool.Messagebox(String Message) anybody help me..thanks in advance

    Read the article

  • parse part of the text from regex pattern

    - by dalco
    I have a string: [\n['-','some text what\rcontains\nnewlines'],\n\n trying to parse: Regex.Split(@"[\n['-','some text what contains newlines'],\n\n", @"\[\n\['(.*)','(.*)'],.*"); but the split return array seems to be null i need to get part of text: "some text what contains newlines"

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • Multiple REPLACE function in Oracle

    - by Adnan
    I am using the REPLACE function in oracle to replace values in my string like; SELECT REPLACE('THE NEW VALUE IS #VAL1#','#VAL1#','55') from dual So this is OK to replace one value, but what about 20+, should I use 20+ REPLACE function or is there a more practical solution. All ideas are welcome.

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

< Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >