Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 909/1408 | < Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • displaying german characters in iphone

    - by Jaimin
    i have following string coming in the json response. "Gas-Heizung-Sanit\u00e4r" so how to display it. i want to display that \u00e4 as a german character.. NSString *str = "Gas-Heizung-Sanit\u00e4r"; NSLog(@"%c",str); it only prints the german character.

    Read the article

  • Unit testing MVC.net Redirection

    - by Dan
    How do I Unit Test a MVC redirection? public ActionResult Create(Product product) { _productTask.Save(product); return RedirectToAction("Success"); } public ActionResult Success() { return View(); } Is Ayende's approach still the best way to go, with preview 5: public static void RenderView(this Controller self, string action) { typeof(Controller).GetMethod("RenderView").Invoke(self,new object[] { action} ); } Seems odd to have to do this, especially as the MVC team have said they are writing the framework to be testable.

    Read the article

  • parse part of the text from regex pattern

    - by dalco
    I have a string: [\n['-','some text what\rcontains\nnewlines'],\n\n trying to parse: Regex.Split(@"[\n['-','some text what contains newlines'],\n\n", @"\[\n\['(.*)','(.*)'],.*"); but the split return array seems to be null i need to get part of text: "some text what contains newlines"

    Read the article

  • How do you make cin typesafe?

    - by cactusbin
    It is well known that cin is not typesafe (e.g. cin integer; and entering "fifty five" will cause it to flip out). I have seen many not-so-elegant ways to hand this, such as getlining a string and using sstream to convert it to a number, or looping with cin.fail() and clearing the stream and reentering it, etc. Is there any library or anyway to overload the inserter operator to make cin automatically typesafe?

    Read the article

  • How to maintain decimal precision in calculations

    - by Blankman
    I need to sum 2 decimal values together, then divide by 2 and convert to string. My calculation currently is trimming to 2 decimal places, but I want to keep as many decimals as I can. city.Latitude = ( (lat.North + lat.South) / 2 ).ToString(); the values for lat.North and lat.Souch are like: 55.32342322

    Read the article

  • Is there value in unit testing auto implemented properties

    - by ahsteele
    It seems exceptionally heavy handed but going by the rule anything publicly available should be tested should auto-implemented properties be tested? Customer Class public class Customer { public string EmailAddr { get; set; } } Tested by [TestClass] public class CustomerTests : TestClassBase { [TestMethod] public void CanSetCustomerEmailAddress() { //Arrange Customer customer = new Customer(); //Act customer.EmailAddr = "[email protected]"; //Assert Assert.AreEqual("[email protected]", customer.EmailAddr); } }

    Read the article

  • Datamapper Clone Record w/ New ID

    - by BouncePast
    class Item include DataMapper::Resource property :id, Serial property :title, String end item = Item.new(:title = 'Title 1') # :id = 1 item_clone = Item.first(:id = 1).clone item_clone.save This does "clone" the object as described but how can this be done so it applies a different ID once the record is saved, e.g. #

    Read the article

  • How to use an IN clause in iBATIS?

    - by furtelwart
    I'm using iBATIS to create select statements. Now I would like to implement the following SQL statement with iBATIS: SELECT * FROM table WHERE col1 IN ('value1', 'value2'); With the following approach, the statement is not prepared correctly and no result returns: SELECT * FROM table WHERE col1 IN #listOfValues#; iBATIS seems to restructure this list and tries to interpret it as a string. How can I use the IN clause correctly?

    Read the article

  • How do I get the Jetty 6 FileServerXml example to work?

    - by Norm
    I have followed along with the Tutorial and the examples. Yet I always get this error when I copy and paste the code: Exception in thread "main" java.lang.NullPointerException at net.test.FileServerXml.main(FileServerXml.java:13) In Eclipse I have the directory structured as such: package net.test -FileServerXml.java -fileserver.xml -index.html FileServerXml.java package net.test; import org.mortbay.jetty.Server; import org.mortbay.resource.Resource; import org.mortbay.xml.XmlConfiguration; public class FileServerXml { public static void main(String[] args) throws Exception { Resource fileserver_xml = Resource.newSystemResource("fileserver.xml"); XmlConfiguration configuration = new XmlConfiguration(fileserver_xml.getInputStream()); Server server = (Server)configuration.configure(); server.start(); server.join(); } } ` fileserver.xml `<?xml version="1.0"?> <Call name="addConnector"> <Arg> <New class="org.eclipse.jetty.server.nio.SelectChannelConnector"> <Set name="port">8080</Set> </New> </Arg> </Call> <Set name="handler"> <New class="org.eclipse.jetty.server.handler.HandlerList"> <Set name="handlers"> <Array type="org.eclipse.jetty.server.Handler"> <Item> <New class="org.eclipse.jetty.server.handler.ResourceHandler"> <Set name="directoriesListed">true</Set> <Set name="welcomeFiles"> <Array type="String"><Item>index.html</Item></Array> </Set> <Set name="resourceBase">.</Set> </New> </Item> <Item> <New class="org.eclipse.jetty.server.handler.DefaultHandler"> </New> </Item> </Array> </Set> </New> </Set> ` Thanks for your input. Norm

    Read the article

  • mysqli_stmt_bind_param SQL Injection

    - by profitphp
    Is there still an injection risk when using prepared statements and mysqli_stmt_bind_param? For example: $malicious_input = 'bob"; drop table users'; mysqli_stmt_bind_param($stmt, 's', $malicious_input); Behind the scenes does mysqli_stmt_bind_param pass this query string to mysql: SET @username = "bob"; drop table users"; Or does it perform the SET command through the API, or use some type of protection to keep this from happening?

    Read the article

  • problem with Double and Rational Number

    - by altair211
    Hi, I am writing a function in which I need to read a string contains floating point number and turn it back to Rational. But When I do toRational (read input :: Double), it will not turn for eg: 0.9 into 9 % 10 as expected, but instead 81..... % 9007... Thx

    Read the article

  • Custom URL for the Birdhouse app

    - by bryanjclark
    I'd like to figure out the custom URL scheme for the Birdhouse iPhone app, but there doesn't seem to be any documentation. Birdhouse is an app to store drafts for Twitter. I'd like to send it a string of text, and I know that it's possible: Birdhouse responds to the URL birdhouse:/// The Twitter app sends drafts to Birdhouse if it's installed on your phone. I've figured out the birdhouse:/// part, but how do I send the text?

    Read the article

  • Typecast cross-platform compatibility

    - by kaykun
    Hi, what I'm trying to do is append a binary integer into a string object. So far I have this: int number = 5; cppstring.append((char*)&number, 4); It works fine on a x86 system with Windows, but some people are saying its not cross-platform and is unsafe. What is the preferred method to do this?

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • Different ways of accessing configuration parameters from a JAX-WS service

    - by ecerulm
    As far as I know I can access the web.xml <context-param>s by making my class implement ServletContextListener and use the ServletContext.getInitParam(String) to read them, but it´s cumbersome as only one instance of the class will receive the contextInitialized(ServletContextEvent sce) call, so I need to make the ServletContext an static member of the class. What other ways exist of setting conf params at deployment time and what are the recommended ones?

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • Java accessing variables using extends

    - by delo
    So here I have two classes: Customer Order Class and Confirmation Class. I want to access the data stored in LastNameTextField (Customer Order Class) and set it as the text for UserLastNameLabel (Confirmation Class) after clicking a "Submit" button. For some reason however, the output displays nothing. Snippet of my code: package customer_order; public class customer_order extends Frame{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; private JLabel LastNameLabel = null; protected JTextField LastNameTextField = null; private JButton SubmitButton = null; public String s; public customer_order() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Customer Order"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes LastNameTextField * * @return javax.swing.JTextField */ public JTextField getLastNameTextField() { if (LastNameTextField == null) { LastNameTextField = new JTextField(); LastNameTextField.setBounds(new Rectangle(120, 100, 164, 28)); LastNameTextField.setName("LastNameTextField"); } return LastNameTextField; } /** * This method initializes SubmitButton * * @return javax.swing.JButton */ private JButton getSubmitButton() { if (SubmitButton == null) { SubmitButton = new JButton(); SubmitButton.setBounds(new Rectangle(501, 225, 96, 29)); SubmitButton.setName("SubmitButton"); SubmitButton.setText("Submit"); SubmitButton.addActionListener(new java.awt.event.ActionListener() { public void actionPerformed(java.awt.event.ActionEvent e) { System.out.println("actionPerformed()"); // TODO Auto-generated Event stub actionPerformed() //THE STRING I WANT s = LastNameTextField.getText(); java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new confirmation().setVisible(true); } }); } }); } return SubmitButton; } package customer_order; public class confirmation extends customer_order{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; // @jve:decl-index=0:visual-constraint="58,9" private JLabel LastNameLabel = null; private JLabel UserLastNameLabel = null; // @jve:decl-index=0: /** * This method initializes frame * * @return java.awt.Frame */ public confirmation() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Confirmation"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes jPanel * * @return javax.swing.JPanel */ private JPanel getJPanel() { if (jPanel == null) { UserLastNameLabel = new JLabel(); UserLastNameLabel.setBounds(new Rectangle(121, 60, 167, 26)); //THE PROBLEM? UserLastNameLabel.setText(s); } return jPanel; }

    Read the article

< Previous Page | 905 906 907 908 909 910 911 912 913 914 915 916  | Next Page >