Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • RadioButton checkedchanged event firing multiple times

    - by kash3
    Hi, I am trying to add multiple radiobutton columns to my gridview dynamically in the code and i want to implement some logic which involves database fetch in the checkedchanged event of radiobuttons but some how the checked changed event is being fired multiple times for each row. Following is the code: aspx: <asp:GridView ID="GridView1" runat="server" AutoGenerateColumns="False" BackColor="White" BorderColor="#CC9966" BorderStyle="None" EnableViewState="true" BorderWidth="1px" CellPadding="4" Font-Names="Verdana"> <FooterStyle BackColor="#FFFFCC" ForeColor="#330099" /> <Columns> <asp:TemplateField HeaderText="Select One"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Select Two"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="lblval" runat="server" Text="!" ForeColor="Red" Visible="false"/> </ItemTemplate> </asp:TemplateField> </Columns> **code behind** void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { if (e.Row.DataItem != null) { DataRowView dvRowview = (DataRowView)e.Row.DataItem; int currentRow = GridView1.Rows.Count; RadioButton rdoSelect1 = new RadioButton(); rdoSelect1.GroupName = "Select" + currentRow; rdoSelect1.ID = string.Concat("rdoSelect1", currentRow); rdoSelect1.AutoPostBack = true; rdoSelect1.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[0].Controls.Add(rdoSelect1); RadioButton rdoSelect2 = new RadioButton(); rdoSelect2.GroupName = "Select" + currentRow; rdoSelect2.ID = string.Concat("rdoSelect2", currentRow); rdoSelect2.AutoPostBack = true; rdoSelect2.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[1].Controls.Add(rdoSelect2); if (!IsPostBack) { e.Row.Cells[e.Row.Cells.Count - 1].Controls[1].Visible = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select1"]) == true) rdoSelect1.Checked = true; else rdoSelect1.Checked = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select2"]) == true) rdoSelect2.Checked = true; else rdoSelect2.Checked = false; } } } void rdoSelect_CheckedChanged(object sender, EventArgs e) { RadioButton rdoSelectedOption = (RadioButton)sender; GridViewRow selRow = rdoSelectedOption.NamingContainer as GridViewRow; if (rdoSelectedOption.Checked) selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = true; else selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = false; } i want the checkedchanged event to fire only once for a group name and row.

    Read the article

  • What is the equivalent of REGEXP_SUBSTR in mysql?

    - by KandadaBoggu
    I want to extract a word from a string column of a table. description =========================== abc order_id: 2 xxxx yyy aa mmm order_id: 3 nn kk yw Expected result set order_id =========================== 2 3 Table will at most have 100 rows, text length is ~256 char and column always has one order_id present. So performance is not an issue. In Oracle, I can use REGEXP_SUBSTR for this problem. How would I solve this in MySQL?

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • Different ways of accessing configuration parameters from a JAX-WS service

    - by ecerulm
    As far as I know I can access the web.xml <context-param>s by making my class implement ServletContextListener and use the ServletContext.getInitParam(String) to read them, but it´s cumbersome as only one instance of the class will receive the contextInitialized(ServletContextEvent sce) call, so I need to make the ServletContext an static member of the class. What other ways exist of setting conf params at deployment time and what are the recommended ones?

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • Java Method declaration

    - by user1701604
    I'm trying to declare a method for my program that takes only a 5 digit integer and for each digit of the integer, reads a value from the program and prints it out. I understand this isn't very clear but im having trouble relaying what I mean. I understand it will be some sort of for loop to read each digit of the integer individually until something reaches 5. Something like the charAt() string method but works for digits.

    Read the article

  • JSON datetime to SQL Server database via WCF

    - by moikey
    I have noticed a problem over the past couple of days where my dates submitted to an sql server database are wrong. I have a webpage, where users can book facilities. This webpage takes a name, a date, a start time and an end time(BookingID is required for transactions but generated by database), which I format as a JSON string as follows: {"BookingEnd":"\/Date(2012-26-03 09:00:00.000)\/","BookingID":1,"BookingName":"client test 1","BookingStart":"\/Date(2012-26-03 10:00:00.000)\/","RoomID":4} This is then passed to a WCF service, which handles the database insert as follows: [WebInvoke(Method = "POST", RequestFormat = WebMessageFormat.Json, UriTemplate = "createbooking")] void CreateBooking(Booking booking); [DataContract] public class Booking { [DataMember] public int BookingID { get; set; } [DataMember] public string BookingName { get; set; } [DataMember] public DateTime BookingStart { get; set; } [DataMember] public DateTime BookingEnd { get; set; } [DataMember] public int RoomID { get; set; } } Booking.svc public void CreateBooking(Booking booking) { BookingEntity bookingEntity = new BookingEntity() { BookingName = booking.BookingName, BookingStart = booking.BookingStart, BookingEnd = booking.BookingEnd, RoomID = booking.RoomID }; BookingsModel model = new BookingsModel(); model.CreateBooking(bookingEntity); } Booking Model: public void CreateBooking(BookingEntity booking) { using (var conn = new SqlConnection("Data Source=cpm;Initial Catalog=BookingDB;Integrated Security=True")) using (var cmd = conn.CreateCommand()) { conn.Open(); cmd.CommandText = @"IF NOT EXISTS ( SELECT * FROM Bookings WHERE BookingStart = @BookingStart AND BookingEnd = @BookingEnd AND RoomID= @RoomID ) INSERT INTO Bookings ( BookingName, BookingStart, BookingEnd, RoomID ) VALUES ( @BookingName, @BookingStart, @BookingEnd, @RoomID )"; cmd.Parameters.AddWithValue("@BookingName", booking.BookingName); cmd.Parameters.AddWithValue("@BookingStart", booking.BookingStart); cmd.Parameters.AddWithValue("@BookingEnd", booking.BookingEnd); cmd.Parameters.AddWithValue("@RoomID", booking.RoomID); cmd.ExecuteNonQuery(); conn.Close(); } } This updates the database but the time ends up "1970-01-01 00:00:02.013" each time I submit the date in the above json format. However, when I do a query in SQL server management studio with the above date format ("YYYY-MM-DD HH:MM:SS.mmm"), it inserts the correct values. Also, if I submit a millisecond datetime to the wcf, the correct date is being inserted. The problem seems to be with the format I am submitting. I am a little lost with this problem. I don't really see why it is doing this. Any help would be greatly appreciated. Thanks.

    Read the article

  • Sqlite issues with HTC Desire HD

    - by Greg
    Recently I have been getting a lot of complaints about the HTC Desire series and it failing while invoking sql statements. I have received reports from users with log snapshots that contain the following. I/Database( 2348): sqlite returned: error code = 8, msg = statement aborts at 1: [pragma journal_mode = WAL;] E/Database( 2348): sqlite3_exec to set journal_mode of /data/data/my.app.package/files/localized_db_en_uk-1.sqlite to WAL failed followed by my app basically burning in flames because the call to open the database results in a serious runtime error that manifests itself as the cursor being left open. There shouldn't be a cursor at this point as we are trying to open it. This only occurs with the HTC Desire HD and Z. My code basically does the following (changed a little to isolate the problem area). SQLiteDatabase db; String dbName; public SQLiteDatabase loadDb(Context context) throws IOException{ //Close any old db handle if (db != null && db.isOpen()) { db.close(); } // The name of the database to use from the bundled assets. String dbAsset = "/asset_dir/"+dbName+".sqlite"; InputStream myInput = context.getAssets().open(dbAsset, Context.MODE_PRIVATE); // Create a file in the app's file directory since sqlite requires a path // Not ideal but we will copy the file out of our bundled assets and open it // it in another location. FileOutputStream myOutput = context.openFileOutput(dbName, Context.MODE_PRIVATE); byte[] buffer = new byte[1024]; int length; while ((length = myInput.read(buffer)) > 0) { myOutput.write(buffer, 0, length); } // Close the streams myOutput.flush(); // Guarantee Write! myOutput.getFD().sync(); myOutput.close(); myInput.close(); // Not grab the newly written file File fileObj = context.getFileStreamPath(dbName); // and open the database return db = SQLiteDatabase.openDatabase(fileObj.getAbsolutePath(), null, SQLiteDatabase.OPEN_READONLY | SQLiteDatabase.NO_LOCALIZED_COLLATORS); } Sadly this phone is only available in the UK and I don't have one in my inventory. I am only getting reports of this type from the HTC Desire series. I don't know what changed as this code has been working without any problem. Is there something I am missing?

    Read the article

  • Asp.Net(C#) inline coding problem

    - by oraclee
    Hi all; <% int i = Eval("NAME").ToString().IndexOf("."); string str = Eval("NAME").ToString().Substring(i + 1); %> <img src="../images/img_<%= str %>.gif" alt="" /> EVAL("test.txt") I need "txt" how to make ? Please Help Thank you

    Read the article

  • Strings Generation

    - by sikas
    Hi,I would like to know how can I create various string from some given characters eg: given characters: a, b I would like to generate the following strings: aa ab ba bb What I have thought of is having (for 2 inputs only) two for-loops one inside another, and then loop each to the number of inputs which in this case is 2 and the output strings will be 2*2 = 4 strings and as the number increases the number of output strings will increase by multiplying n*n (n-times)

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • Why does Python array moduel handle strings and lists differently?

    - by Casey
    I'm having trouble understanding the result of the following statements: >>> from array import array >>> array('L',[0xff,0xff,0xff,0xff]) array('L', [255L, 255L, 255L, 255L]) >>> from array import array >>> array('L','\xff\xff\xff\xff') Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: string length not a multiple of item size

    Read the article

  • displaying data from database in to text box

    - by srinayak
    I have 2 JSP pages as below: projectcategory.jsp <% Connection con = DbConnect.connect(); Statement s = con.createStatement(); ResultSet rs = s.executeQuery("select * from projectcategory"); %> <DIV class="TabbedPanelsContent" align="center"> <TABLE border="1"> <TR> <TH>CATEGORY ID</TH> <TH>CATEGORY NAME</TH> <TH>Edit/Update</TH> </TR> <% while (rs.next()) { %> <%String p=rs.getString(1);%> <TR> <TD><%=rs.getString(1)%></TD> <TD><%=rs.getString(2)%></TD> <TD> <FORM action="EditPcat.jsp?pcatid=p"><INPUT type="submit" value='edit/update'></INPUT> </FORM> </TD> </TR> <% } %> </TABLE> </DIV> another is Editpcat.jsp: </head> <body> <%String s=request.getParameter("p"); %> <form action="ProjCatServlet" method="post"> <div align="right"><a href="projectcategory.jsp">view</a></div> <fieldset> <legend>Edit category</legend> <table cellspacing="2" cellpadding="2" border="0"> <tr> <td align="left">Category Id</td> <td><input type="text" name="pcatid" value="<%=s%>" ></td> </tr> <tr> <td align="right">Category Name</td> <td><input type="text" name="pcatname"></td> </tr> <tr> <td><input type="submit" value="submit"></td> </tr> </table> <input type="hidden" name="FUNCTION_ID" value="UPDATE"> </fieldset> </form> How to display value from one JSP page which we get from database in to text box of another JSP?

    Read the article

  • How to do a proper search with nhibernate

    - by Denis Rosca
    Hello everyone, i'm working on a small project that is supposed to allow basic searches of the database. Currently i'm using nhibernate for the database interaction. In the database i have 2 tables: Person and Address. The Person table has a many-to-one relationship with Address. The code i've come up with for doing searches is: public IList<T> GetByParameterList(List<QueryParameter> parameterList) { if (parameterList == null) { return GetAll(); } using (ISession session = NHibernateHelper.OpenSession()) { ICriteria criteria = session.CreateCriteria<T>(); foreach (QueryParameter param in parameterList) { switch (param.Constraint) { case ConstraintType.Less: criteria.Add(Expression.Lt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.More: criteria.Add(Expression.Gt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.LessOrEqual: criteria.Add(Expression.Le(param.ParameterName, param.ParameterValue)); break; case ConstraintType.EqualOrMore: criteria.Add(Expression.Ge(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Equals: criteria.Add(Expression.Eq(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Like: criteria.Add(Expression.Like(param.ParameterName, param.ParameterValue)); break; } } try { IList<T> result = criteria.List<T>(); return result; } catch { //TODO: Implement some exception handling throw; } } } The query parameter is a helper object that i use to create criterias and send it to the dal, it looks like this: public class QueryParameter { public QueryParameter(string ParameterName, Object ParameterValue, ConstraintType constraintType) { this.ParameterName = ParameterName; this.ParameterValue = ParameterValue; this.Constraint = constraintType; } public string ParameterName { get; set; } public Object ParameterValue { get; set; } public ConstraintType Constraint { get; set; } } Now this works well if i'm doing a search like FirstName = "John" , but not when i try to give a parameter like Street = "Some Street". It seems that nhibernate is looking for a street column in the Person table but not in the Address table. Any idea on how should i change my code for so i could do a proper search? Tips? Maybe some alternatives? Disclaimer: i'm kind of a noob so please be gentle ;) Thanks, Denis.

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • Java language convention; getters/setters

    - by Skogen
    Public class Example { private int number; public Example(int number){ this.number = number; } public int getNumber(){ return number; } public void setNumber(int number){ this.number = number; } public static void main(String[] args){ Example e = new Example(5); What is preffered when accessing a variable within its own class; "e.number" or "e.getNumber()" ?

    Read the article

  • Sending @reply in curl

    - by willwill
    I'm writing an identi.ca client, and seems that @reply isn't working. After investigation I found that @ prefix is used by curl to indicate file upload, and escaping with \@reply doesn't work; curl doesn't remove the \ at the front. I also can't format the postfields to query string, as I need to send files on that request too. Is there any method to send both @reply and file upload in the same request?

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >