Search Results

Search found 35200 results on 1408 pages for 't string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • Why does Python array moduel handle strings and lists differently?

    - by Casey
    I'm having trouble understanding the result of the following statements: >>> from array import array >>> array('L',[0xff,0xff,0xff,0xff]) array('L', [255L, 255L, 255L, 255L]) >>> from array import array >>> array('L','\xff\xff\xff\xff') Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: string length not a multiple of item size

    Read the article

  • Java Method declaration

    - by user1701604
    I'm trying to declare a method for my program that takes only a 5 digit integer and for each digit of the integer, reads a value from the program and prints it out. I understand this isn't very clear but im having trouble relaying what I mean. I understand it will be some sort of for loop to read each digit of the integer individually until something reaches 5. Something like the charAt() string method but works for digits.

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • What url encoding web browser uses?

    - by Prince123
    What url encoding a web browser uses while submitting data to server? with my application i use HttpUtility.UrlEncode(string data) but do not get result as i get with web browser. My application submit some text data to forum. When i am submitting data with web browser (Google Chrome) the exact text i can see submitted to server but when i am submitting using my application it showing some character different. So is this necessary to submit any data to server must be url encoded?

    Read the article

  • Asp.Net(C#) inline coding problem

    - by oraclee
    Hi all; <% int i = Eval("NAME").ToString().IndexOf("."); string str = Eval("NAME").ToString().Substring(i + 1); %> <img src="../images/img_<%= str %>.gif" alt="" /> EVAL("test.txt") I need "txt" how to make ? Please Help Thank you

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • What is the equivalent of REGEXP_SUBSTR in mysql?

    - by KandadaBoggu
    I want to extract a word from a string column of a table. description =========================== abc order_id: 2 xxxx yyy aa mmm order_id: 3 nn kk yw Expected result set order_id =========================== 2 3 Table will at most have 100 rows, text length is ~256 char and column always has one order_id present. So performance is not an issue. In Oracle, I can use REGEXP_SUBSTR for this problem. How would I solve this in MySQL?

    Read the article

  • Java language convention; getters/setters

    - by Skogen
    Public class Example { private int number; public Example(int number){ this.number = number; } public int getNumber(){ return number; } public void setNumber(int number){ this.number = number; } public static void main(String[] args){ Example e = new Example(5); What is preffered when accessing a variable within its own class; "e.number" or "e.getNumber()" ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • RadioButton checkedchanged event firing multiple times

    - by kash3
    Hi, I am trying to add multiple radiobutton columns to my gridview dynamically in the code and i want to implement some logic which involves database fetch in the checkedchanged event of radiobuttons but some how the checked changed event is being fired multiple times for each row. Following is the code: aspx: <asp:GridView ID="GridView1" runat="server" AutoGenerateColumns="False" BackColor="White" BorderColor="#CC9966" BorderStyle="None" EnableViewState="true" BorderWidth="1px" CellPadding="4" Font-Names="Verdana"> <FooterStyle BackColor="#FFFFCC" ForeColor="#330099" /> <Columns> <asp:TemplateField HeaderText="Select One"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Select Two"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="lblval" runat="server" Text="!" ForeColor="Red" Visible="false"/> </ItemTemplate> </asp:TemplateField> </Columns> **code behind** void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { if (e.Row.DataItem != null) { DataRowView dvRowview = (DataRowView)e.Row.DataItem; int currentRow = GridView1.Rows.Count; RadioButton rdoSelect1 = new RadioButton(); rdoSelect1.GroupName = "Select" + currentRow; rdoSelect1.ID = string.Concat("rdoSelect1", currentRow); rdoSelect1.AutoPostBack = true; rdoSelect1.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[0].Controls.Add(rdoSelect1); RadioButton rdoSelect2 = new RadioButton(); rdoSelect2.GroupName = "Select" + currentRow; rdoSelect2.ID = string.Concat("rdoSelect2", currentRow); rdoSelect2.AutoPostBack = true; rdoSelect2.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[1].Controls.Add(rdoSelect2); if (!IsPostBack) { e.Row.Cells[e.Row.Cells.Count - 1].Controls[1].Visible = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select1"]) == true) rdoSelect1.Checked = true; else rdoSelect1.Checked = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select2"]) == true) rdoSelect2.Checked = true; else rdoSelect2.Checked = false; } } } void rdoSelect_CheckedChanged(object sender, EventArgs e) { RadioButton rdoSelectedOption = (RadioButton)sender; GridViewRow selRow = rdoSelectedOption.NamingContainer as GridViewRow; if (rdoSelectedOption.Checked) selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = true; else selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = false; } i want the checkedchanged event to fire only once for a group name and row.

    Read the article

  • How to refresh a fragment in a viewpager?

    - by aut_silvia
    I know there are already some questions to this problem. But I am really new in Android and ecspecially to Fragments and Viewpager. Pls have passion with me. I didn't found a answer which fits to my code. I dont know how to refresh a fragment or reload it when it's "active" again. TabsPagerAdapter.java: public class TabsPagerAdapter extends FragmentPagerAdapter{ public TabsPagerAdapter(FragmentManager fm){ super(fm); } @Override public Fragment getItem(int index) { switch (index) { case 0: return new KFZFragment(); case 1: return new LogFragment(); case 2: return new TrackFragment(); } return null; } @Override public int getCount() { // get item count - equal to number of tabs return 3; } } I have this 3 Fragments (KFZFragment,LogFragment,TrackFragment) and on the TrackFragment I calculate some data and this data should be display in a ListView in LogFragment. But when I change to LogFragment it's not the latest data. So it doesnt refresh. Now how should I modify my code to refresh the fragments when it's "active"? MainActivityFragment.java: public class MainActivityFragment extends FragmentActivity implements ActionBar.TabListener{ private ViewPager viewPager; private TabsPagerAdapter mAdapter; private ActionBar actionBar; List<Fragment> fragments; private String[] tabs = { "KFZ", "Fahrten Log", "Kosten Track" }; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main_fragment); // Initilization viewPager = (ViewPager) findViewById(R.id.pager); actionBar = getActionBar(); mAdapter = new TabsPagerAdapter(getSupportFragmentManager()); fragments = new Vector<Fragment>(); fragments.add(Fragment.instantiate(this, KFZFragment.class.getName(),savedInstanceState)); fragments.add(Fragment.instantiate(this, LogFragment.class.getName(),savedInstanceState)); viewPager.setAdapter(mAdapter); actionBar.setHomeButtonEnabled(false); actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_TABS); // Adding Tabs for (String tab_name : tabs) { actionBar.addTab(actionBar.newTab().setText(tab_name) .setTabListener(this)); } viewPager.setOnPageChangeListener(new ViewPager.OnPageChangeListener() { @Override public void onPageSelected(int position) { // on changing the page // make respected tab selected actionBar.setSelectedNavigationItem(position); } @Override public void onPageScrolled(int arg0, float arg1, int arg2) { } @Override public void onPageScrollStateChanged(int arg0) { } }); } @Override public void onTabReselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public void onTabSelected(Tab tab, FragmentTransaction ft) { viewPager.setCurrentItem(tab.getPosition()); } @Override public void onTabUnselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { if (keyCode == KeyEvent.KEYCODE_BACK) { } return super.onKeyDown(keyCode, event); } } Pls help me out.

    Read the article

  • Android: Text primary key with different name

    - by Echilon
    I have an existing Windows app for which I'm writing an Android port. The app uses a unique string as the primary key, but the SQLite methods in Android all seem to work with integers and a column names _id, whereas my ID column isn't called this. Is there a way to let Android know I have a key with a different column name?

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • How do I reflect over the members of dynamic object?

    - by Flatliner DOA
    I need to get a dictionary of properties and their values from an object declared with the dynamic keyword in .NET 4? It seems using reflection for this will not work. Example: dynamic s = new ExpandoObject(); s.Path = "/Home"; s.Name = "Home"; // How do I enumerate the Path and Name properties and get their values? IDictionary<string, object> propertyValues = ???

    Read the article

  • Sending @reply in curl

    - by willwill
    I'm writing an identi.ca client, and seems that @reply isn't working. After investigation I found that @ prefix is used by curl to indicate file upload, and escaping with \@reply doesn't work; curl doesn't remove the \ at the front. I also can't format the postfields to query string, as I need to send files on that request too. Is there any method to send both @reply and file upload in the same request?

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • Strings Generation

    - by sikas
    Hi,I would like to know how can I create various string from some given characters eg: given characters: a, b I would like to generate the following strings: aa ab ba bb What I have thought of is having (for 2 inputs only) two for-loops one inside another, and then loop each to the number of inputs which in this case is 2 and the output strings will be 2*2 = 4 strings and as the number increases the number of output strings will increase by multiplying n*n (n-times)

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Where to put the application ID in YQL

    - by earlyriser
    I'm trying to read an xml response from YQL: $url = 'http://query.yahooapis.com/v1/public/yql?q=select%20*%20from%20geo.places%20where%20woeid%3D%22'.$woeid.'%22'; if (!$xml=simplexml_load_file($url) ) { //DO STUFF } This code works. Now i'm trying to put my application ID in the url string but I don't know how it should be done. Thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >