Search Results

Search found 2412 results on 97 pages for 'atom computing'.

Page 91/97 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97  | Next Page >

  • Tech Talk: Managing Cloud Integration

    - by Tanu Sood
    Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Cloud computing solutions are widely hailed as a way to reduce capital expenditures yet organizations are realizing they need to also consider all of the nuances of integrating cloud applications with existing information systems.Cloud integration, after all, has a direct impact on your costs, maintenance and upgrade efforts. Catch this conversation on Tech Talk with Oracle Vice President, Amit Zavery, to understand how Oracle Fusion Middleware provides a simple and consistent method to maintaining integration interfaces across disparate systems across cloud and on-premise applications. Simplify your IT infrastructure and seamlessly manage data and application integration across your applications with Oracle solutions. Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} For other Fusion Middleware talks, subscribe to Fusion Middleware Radio today and visit us on oracle.com Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Photo courtesy: www.cloudtweaks.com

    Read the article

  • Clouds, Clouds, Clouds Everywhere, Not a Drop of Rain!

    - by sxkumar
    At the recently concluded Oracle OpenWorld 2012, the center of discussion was clearly Cloud. Over the five action packed days, I got to meet a large number of customers and most of them had serious interest in all things cloud.  Public Cloud - particularly the Oracle Cloud - clearly got a lot of attention and interest. I think the use cases and the value proposition for public cloud is pretty straight forward. However, when it comes to private cloud, there were some interesting revelations.  Well, I shouldn’t really call them revelations since they are pretty consistent with what I have heard from customers at other conferences as well as during 1:1 interactions. While the interest in enterprise private cloud remains to be very high, only a handful of enterprises have truly embarked on a journey to create what the purists would call true private cloud - with capabilities such as self-service and chargeback/show back. For a large majority, today's reality is simply consolidation and virtualization - and they are quite far off from creating an agile, self-service and transparent IT infrastructure which is what the enterprise cloud is all about.  Even a handful of those who have actually implemented a close-to-real enterprise private cloud have taken an infrastructure centric approach and are seeing only limited business upside. Quite a few were frank enough to admit that chargeback and self-service isn’t something that they see an immediate need for.  This is in quite contrast to the picture being painted by all those surveys out there that show a large number of enterprises having already implemented an enterprise private cloud.  On the face of it, this seems quite contrary to the observations outlined above. So what exactly is the reality? Well, the reality is that there is undoubtedly a huge amount of interest among enterprises about transforming their legacy IT environment - which is often seen as too rigid, too fragmented, and ultimately too expensive - to something more agile, transparent and business-focused. At the same time however, there is a great deal of confusion among CIOs and architects about how to get there. This isn't very surprising given all the buzz and hype surrounding cloud computing. Every IT vendor claims to have the most unique solution and there isn't a single IT product out there that does not have a cloud angle to it. Add to this the chatter on the blogosphere, it will get even a sane mind spinning.  Consequently, most  enterprises are still struggling to fully understand the concept and value of enterprise private cloud.  Even among those who have chosen to move forward relatively early, quite a few have made their decisions more based on vendor influence/preferences rather than what their businesses actually need.  Clearly, there is a disconnect between the promise of the enterprise private cloud and the current adoption trends.  So what is the way forward?  I certainly do not claim to have all the answers. But here is a perspective that many cloud practitioners have found useful and thus worth sharing. To take a step back, the fundamental premise of the enterprise private cloud is IT transformation. It is the quest to create a more agile, transparent and efficient IT infrastructure that is driven more by business needs rather than constrained by operational and procedural inefficiencies. It is the new way of delivering and consuming IT services - where the IT organizations operate more like enablers of  strategic services rather than just being the gatekeepers of IT resources. In an enterprise private cloud environment, IT organizations are expected to empower the end users via self-service access/control and provide the business stakeholders a transparent view of how the resources are being used, what’s the cost of delivering a given service, how well are the customers being served, etc.  But the most important thing to note here is the enterprise private cloud is not just an IT project, rather it is a business initiative to create an IT setup that is more aligned with the needs of today's dynamic and highly competitive business environment. Surprised? You shouldn’t be. Just remember how the business users have been at the forefront of public cloud adoption within enterprises and private cloud is no exception.   Such a broad-based transformation makes cloud more than a technology initiative. It requires people (organizational) and process changes as well, and these changes are as critical as is the choice of right tools and technology. In my next blog,  I will share how essential it is for enterprise cloud technology to go hand-in hand with process re-engineering and organization changes to unlock true value of  enterprise cloud. I am sharing a short video from my session "Managing your private Cloud" at Oracle OpenWorld 2012. More videos from this session will be posted at the recently introduced Zero to Cloud resource page. Many other experts of Oracle enterprise private cloud solution will join me on this blog "Zero to Cloud"  and share best practices , deployment tips and information on how to plan, build, deploy, monitor, manage , meter and optimize the enterprise private cloud. We look forward to your feedback, suggestions and having an engaging conversion with you on this blog.

    Read the article

  • Installing Paperclip - "undefined method `has_attached_file` for" - Ruby on Rails

    - by bgadoci
    I just installed the plugin for Paperclip and I am getting an error message "undefined method has_attached_file for. Not sure why I am getting this. Here is the full error message. NoMethodError (undefined method `has_attached_file' for #<Class:0x10338acd0>): /Users/bgadoci/.gem/ruby/1.8/gems/will_paginate-2.3.12/lib/will_paginate/finder.rb:170:in `method_missing' app/models/post.rb:2 app/controllers/posts_controller.rb:50:in `show' For some reason it is referencing the will_paginate gem. From what I can find, it seems that either there is something wrong w/ my PostsController#index or perhaps a previously attempt at installing the gem instead of the plugin (in which case I have read I should be able to remedy through the /config/environments.rb file somehow). I didn't think that previous gem installation would matter as I did it in an old version of the site that I trashed before installing the plugin. In the current version of the site I show that the Table has been updated with the Paperclip columns after migration. Here is my code: PostsController#index def index @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes @vote_counts = Vote.count(:group => :post_title, :order => 'count_all DESC', :limit => 20) conditions, joins = {}, :votes unless(params[:tag_name] || "").empty? conditions = ["tags.tag_name = ? ", params[:tag_name]] joins = [:tags, :votes] end @posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "created_at DESC", :page => params[:page], :per_page => 5) @popular_posts=Post.paginate( :select => "posts.*, count(*) as vote_total", :joins => joins, :conditions=> conditions, :group => "votes.post_id", :order => "vote_total DESC", :page => params[:page], :per_page => 3) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.json { render :json => @posts } format.atom end end Post Model class Post < ActiveRecord::Base has_attached_file :photo validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end /views/posts/new.html.erb <h1>New post</h1> <%= link_to 'Back', posts_path %> <% form_for(@post, :html => { :multipart => true}) do |f| %> <%= f.error_messages %> <p> <%= f.label :title %><br /> <%= f.text_field :title %> </p> <p> <%= f.label :body %><br /> <%= f.text_area :body %> </p> <p> <%= f.file_field :photo %> </p> <p> <%= f.submit 'Create' %> </p> <% end %>

    Read the article

  • Using Xlib via JNA to move a window

    - by rob
    I'm using JNA to manipulate application windows on Linux by sending Xlib messages but can't seem to move a window. My original implementation executed wmctrl on the shell to move the windows and that successfully moved the windows. Unfortunately, there's a noticeable amount of overhead associated with calling shell programs from Java, so now I'm trying to make direct API calls using JNA. I'm using the X11 example available from the JNA website and can successfully do a few tricks, such as enumerating the window IDs and reading window properties, so I know JNA+Xlib is at least partially working. First I tried moving the windows directly using XMoveWindow() but the window manager was apparently blocking those calls. I ran across a thread that suggested I needed to send a client message using XSendMessage(), so I've done that below, but apparently XSendMessage() is failing because the window doesn't move and I get a return value of 0. I'm guessing I omitted something obvious, but can't quite figure it out. Any suggestions? Note that, for the purposes of this example, the main method has a window ID hard-coded. This is the window ID of the window I'm trying to move (obtained using wmctrl -l on the console). import com.sun.jna.NativeLong; import com.sun.jna.Pointer; import com.sun.jna.examples.unix.X11; import com.sun.jna.examples.unix.X11.Atom; import com.sun.jna.examples.unix.X11.AtomByReference; import com.sun.jna.examples.unix.X11.Display; import com.sun.jna.examples.unix.X11.Window; import com.sun.jna.examples.unix.X11.WindowByReference; import com.sun.jna.examples.unix.X11.XEvent; import com.sun.jna.examples.unix.X11.XTextProperty; import com.sun.jna.examples.unix.X11.XWindowAttributes; import com.sun.jna.ptr.IntByReference; import com.sun.jna.ptr.NativeLongByReference; import com.sun.jna.ptr.PointerByReference; private static final int FALSE = 0; /** C-style boolean "false" */ private static final int TRUE = 1; /** C-style boolean "true" */ public static void main(String[] args) { setWindowPos(new Window(0x01300007), 100, 100, 600, 400); // update the Window constructor with the appropriate ID given by wmctrl -l } public static boolean setWindowPos(Window window, int x, int y, int w, int h) { final X11 x11 = X11.INSTANCE; Display display = x11.XOpenDisplay(null); NativeLong mask = new NativeLong(X11.SubstructureRedirectMask | X11.SubstructureNotifyMask | X11.ResizeRedirectMask); XEvent event = new XEvent(); String msg = "_NET_MOVERESIZE_WINDOW"; //$NON-NLS-1$ long grflags = 0l; // use the default gravity of the window if (x != -1) grflags |= (1 << 8); if (y != -1) grflags |= (1 << 9); if (w != -1) grflags |= (1 << 10); if (h != -1) grflags |= (1 << 11); event.xclient.type = X11.ClientMessage; event.xclient.serial = new NativeLong(0l); event.xclient.send_event = TRUE; event.xclient.message_type = x11.XInternAtom(display, msg, false); event.xclient.window = window; event.xclient.format = 32; event.xclient.data.l[0] = new NativeLong(grflags); // gravity flags event.xclient.data.l[1] = new NativeLong(x); event.xclient.data.l[2] = new NativeLong(y); event.xclient.data.l[3] = new NativeLong(w); event.xclient.data.l[4] = new NativeLong(h); int status = x11.XSendEvent(display, x11.XDefaultRootWindow(display), FALSE, mask, event); x11.XFlush(display); // need to XFlush if we're not reading X events if (status == 0) { // 0 indicates XSendEvent failed logger.error("setWindowPos: XSendEvent failed (" + msg + ")"); //$NON-NLS-1$ return false; } return true; }

    Read the article

  • GLSL Error: failed to preprocess the source. How can I troubleshoot this?

    - by Brent Parker
    I'm trying to learn to play with OpenGL GLSL shaders. I've written a very simple program to simply create a shader and compile it. However, whenever I get to the compile step, I get the error: Error: Preprocessor error Error: failed to preprocess the source. Here's my very simple code: #include <GL/gl.h> #include <GL/glu.h> #include <GL/glut.h> #include <GL/glext.h> #include <time.h> #include <stdio.h> #include <iostream> #include <stdlib.h> using namespace std; const int screenWidth = 640; const int screenHeight = 480; const GLchar* gravity_shader[] = { "#version 140" "uniform float t;" "uniform mat4 MVP;" "in vec4 pos;" "in vec4 vel;" "const vec4 g = vec4(0.0, 0.0, -9.80, 0.0);" "void main() {" " vec4 position = pos;" " position += t*vel + t*t*g;" " gl_Position = MVP * position;" "}" }; double pointX = (double)screenWidth/2.0; double pointY = (double)screenWidth/2.0; void initShader() { GLuint shader = glCreateShader(GL_VERTEX_SHADER); glShaderSource(shader, 1, gravity_shader, NULL); glCompileShader(shader); GLint compiled = true; glGetShaderiv(shader, GL_COMPILE_STATUS, &compiled); if(!compiled) { GLint length; GLchar* log; glGetShaderiv(shader, GL_INFO_LOG_LENGTH, &length); log = (GLchar*)malloc(length); glGetShaderInfoLog(shader, length, &length, log); std::cout << log <<std::endl; free(log); } exit(0); } bool myInit() { initShader(); glClearColor(1.0f, 1.0f, 1.0f, 0.0f); glColor3f(0.0f, 0.0f, 0.0f); glPointSize(1.0); glLineWidth(1.0f); glMatrixMode(GL_PROJECTION); glLoadIdentity(); gluOrtho2D(0.0, (GLdouble) screenWidth, 0.0, (GLdouble) screenHeight); glEnable(GL_DEPTH_TEST); return true; } int main(int argc, char** argv) { glutInit(&argc, argv); glutInitDisplayMode(GLUT_DOUBLE | GLUT_RGB); glutInitWindowSize(screenWidth, screenHeight); glutInitWindowPosition(100, 150); glutCreateWindow("Mouse Interaction Display"); myInit(); glutMainLoop(); return 0; } Where am I going wrong? If it helps, I am trying to do this on a Acer Aspire One with an atom processor and integrated Intel video running the latest Ubuntu. It's not very powerful, but then again, this is a very simple shader. Thanks a lot for taking a look!

    Read the article

  • A RenderTargetView cannot be created from a NULL Resource

    - by numerical25
    I am trying to create my render target view but I get this error from direct X A RenderTargetView cannot be created from a NULL Resource To my knowledge it seems that I must fill the rendertarget pointer with data before passing it. But I am having trouble figure out how. Below is my declaration and implementation declaration #pragma once #include "stdafx.h" #include "resource.h" #include "d3d10.h" #include "d3dx10.h" #include "dinput.h" #define MAX_LOADSTRING 100 class RenderEngine { protected: RECT m_screenRect; //direct3d Members ID3D10Device *m_pDevice; // The IDirect3DDevice10 // interface ID3D10Texture2D *m_pBackBuffer; // Pointer to the back buffer ID3D10RenderTargetView *m_pRenderTargetView; // Pointer to render target view IDXGISwapChain *m_pSwapChain; // Pointer to the swap chain RECT m_rcScreenRect; // The dimensions of the screen ID3DX10Font *m_pFont; // The font used for rendering text // Sprites used to hold font characters ID3DX10Sprite *m_pFontSprite; ATOM RegisterEngineClass(); void Present(); public: static HINSTANCE m_hInst; HWND m_hWnd; int m_nCmdShow; TCHAR m_szTitle[MAX_LOADSTRING]; // The title bar text TCHAR m_szWindowClass[MAX_LOADSTRING]; // the main window class name void DrawTextString(int x, int y, D3DXCOLOR color, const TCHAR *strOutput); //static functions static LRESULT CALLBACK WndProc(HWND hWnd, UINT message, WPARAM wParam, LPARAM lParam); static INT_PTR CALLBACK About(HWND hDlg, UINT message, WPARAM wParam, LPARAM lParam); bool InitWindow(); bool InitDirectX(); bool InitInstance(); int Run(); RenderEngine() { m_screenRect.right = 800; m_screenRect.bottom = 600; } }; my implementation bool RenderEngine::InitDirectX() { //potential error. You did not set to zero memory and you did not set the scaling property DXGI_MODE_DESC bd; bd.Width = m_screenRect.right; bd.Height = m_screenRect.bottom; bd.Format = DXGI_FORMAT_R8G8B8A8_UNORM; bd.RefreshRate.Numerator = 60; bd.RefreshRate.Denominator = 1; DXGI_SAMPLE_DESC sd; sd.Count = 1; sd.Quality = 0; DXGI_SWAP_CHAIN_DESC swapDesc; ZeroMemory(&swapDesc, sizeof(swapDesc)); swapDesc.BufferDesc = bd; swapDesc.SampleDesc = sd; swapDesc.BufferUsage = DXGI_USAGE_RENDER_TARGET_OUTPUT; swapDesc.OutputWindow = m_hWnd; swapDesc.BufferCount = 1; swapDesc.SwapEffect = DXGI_SWAP_EFFECT_DISCARD, swapDesc.Windowed = true; swapDesc.Flags = 0; HRESULT hr; hr = D3D10CreateDeviceAndSwapChain(NULL, D3D10_DRIVER_TYPE_HARDWARE, NULL, D3D10_CREATE_DEVICE_DEBUG, D3D10_SDK_VERSION , &swapDesc, &m_pSwapChain, &m_pDevice); if(FAILED(hr)) return false; // Create a render target view hr = m_pDevice->CreateRenderTargetView( m_pBackBuffer, NULL, &m_pRenderTargetView); // FAILS RIGHT HERE // if(FAILED(hr)) return false; return true; }

    Read the article

  • Why might a System.String object not cache its hash code?

    - by Dan Tao
    A glance at the source code for string.GetHashCode using Reflector reveals the following (for mscorlib.dll version 4.0): public override unsafe int GetHashCode() { fixed (char* str = ((char*) this)) { char* chPtr = str; int num = 0x15051505; int num2 = num; int* numPtr = (int*) chPtr; for (int i = this.Length; i > 0; i -= 4) { num = (((num << 5) + num) + (num >> 0x1b)) ^ numPtr[0]; if (i <= 2) { break; } num2 = (((num2 << 5) + num2) + (num2 >> 0x1b)) ^ numPtr[1]; numPtr += 2; } return (num + (num2 * 0x5d588b65)); } } Now, I realize that the implementation of GetHashCode is not specified and is implementation-dependent, so the question "is GetHashCode implemented in the form of X or Y?" is not really answerable. I'm just curious about a few things: If Reflector has disassembled the DLL correctly and this is the implementation of GetHashCode (in my environment), am I correct in interpreting this code to indicate that a string object, based on this particular implementation, would not cache its hash code? Assuming the answer is yes, why would this be? It seems to me that the memory cost would be minimal (one more 32-bit integer, a drop in the pond compared to the size of the string itself) whereas the savings would be significant, especially in cases where, e.g., strings are used as keys in a hashtable-based collection like a Dictionary<string, [...]>. And since the string class is immutable, it isn't like the value returned by GetHashCode will ever even change. What could I be missing? UPDATE: In response to Andras Zoltan's closing remark: There's also the point made in Tim's answer(+1 there). If he's right, and I think he is, then there's no guarantee that a string is actually immutable after construction, therefore to cache the result would be wrong. Whoa, whoa there! This is an interesting point to make (and yes it's very true), but I really doubt that this was taken into consideration in the implementation of GetHashCode. The statement "therefore to cache the result would be wrong" implies to me that the framework's attitude regarding strings is "Well, they're supposed to be immutable, but really if developers want to get sneaky they're mutable so we'll treat them as such." This is definitely not how the framework views strings. It fully relies on their immutability in so many ways (interning of string literals, assignment of all zero-length strings to string.Empty, etc.) that, basically, if you mutate a string, you're writing code whose behavior is entirely undefined and unpredictable. I guess my point is that for the author(s) of this implementation to worry, "What if this string instance is modified between calls, even though the class as it is publicly exposed is immutable?" would be like for someone planning a casual outdoor BBQ to think to him-/herself, "What if someone brings an atomic bomb to the party?" Look, if someone brings an atom bomb, party's over.

    Read the article

  • Why doesn't my QsciLexerCustom subclass work in PyQt4 using QsciScintilla?

    - by Jon Watte
    My end goal is to get Erlang syntax highlighting in QsciScintilla using PyQt4 and Python 2.6. I'm running on Windows 7, but will also need Ubuntu support. PyQt4 is missing the necessary wrapper code for the Erlang lexer/highlighter that "base" scintilla has, so I figured I'd write a lightweight one on top of QsciLexerCustom. It's a little bit problematic, because the Qsci wrapper seems to really want to talk about line+index rather than offset-from-start when getting/setting subranges of text. Meanwhile, the lexer gets arguments as offset-from-start. For now, I get a copy of the entire text, and split that up as appropriate. I have the following lexer, and I apply it with setLexer(). It gets all the appropriate calls when I open a new file and sets this as the lexer, and prints a bunch of appropriate lines based on what it's doing... but there is no styling in the document. I tried making all the defined styles red, and the document is still stubbornly black-on-white, so apparently the styles don't really "take effect" What am I doing wrong? If nobody here knows, what's the appropriate discussion forum where people might actually know these things? (It's an interesting intersection between Python, Qt and Scintilla, so I imagine the set of people who would know is small) Let's assume prefs.declare() just sets up a dict that returns the value for the given key (I've verified this -- it's not the problem). Let's assume scintilla is reasonably properly constructed into its host window QWidget. Specifically, if I apply a bundled lexer (such as QsciLexerPython), it takes effect and does show styled text. prefs.declare('font.name.margin', "MS Dlg") prefs.declare('font.size.margin', 8) prefs.declare('font.name.code', "Courier New") prefs.declare('font.size.code', 10) prefs.declare('color.editline', "#d0e0ff") class LexerErlang(Qsci.QsciLexerCustom): def __init__(self, obj = None): Qsci.QsciLexerCustom.__init__(self, obj) self.sci = None self.plainFont = QtGui.QFont() self.plainFont.setPointSize(int(prefs.get('font.size.code'))) self.plainFont.setFamily(prefs.get('font.name.code')) self.marginFont = QtGui.QFont() self.marginFont.setPointSize(int(prefs.get('font.size.code'))) self.marginFont.setFamily(prefs.get('font.name.margin')) self.boldFont = QtGui.QFont() self.boldFont.setPointSize(int(prefs.get('font.size.code'))) self.boldFont.setFamily(prefs.get('font.name.code')) self.boldFont.setBold(True) self.styles = [ Qsci.QsciStyle(0, QtCore.QString("base"), QtGui.QColor("#000000"), QtGui.QColor("#ffffff"), self.plainFont, True), Qsci.QsciStyle(1, QtCore.QString("comment"), QtGui.QColor("#008000"), QtGui.QColor("#eeffee"), self.marginFont, True), Qsci.QsciStyle(2, QtCore.QString("keyword"), QtGui.QColor("#000080"), QtGui.QColor("#ffffff"), self.boldFont, True), Qsci.QsciStyle(3, QtCore.QString("string"), QtGui.QColor("#800000"), QtGui.QColor("#ffffff"), self.marginFont, True), Qsci.QsciStyle(4, QtCore.QString("atom"), QtGui.QColor("#008080"), QtGui.QColor("#ffffff"), self.plainFont, True), Qsci.QsciStyle(5, QtCore.QString("macro"), QtGui.QColor("#808000"), QtGui.QColor("#ffffff"), self.boldFont, True), Qsci.QsciStyle(6, QtCore.QString("error"), QtGui.QColor("#000000"), QtGui.QColor("#ffd0d0"), self.plainFont, True), ] print("LexerErlang created") def description(self, ix): for i in self.styles: if i.style() == ix: return QtCore.QString(i.description()) return QtCore.QString("") def setEditor(self, sci): self.sci = sci Qsci.QsciLexerCustom.setEditor(self, sci) print("LexerErlang.setEditor()") def styleText(self, start, end): print("LexerErlang.styleText(%d,%d)" % (start, end)) lines = self.getText(start, end) offset = start self.startStyling(offset, 0) print("startStyling()") for i in lines: if i == "": self.setStyling(1, self.styles[0]) print("setStyling(1)") offset += 1 continue if i[0] == '%': self.setStyling(len(i)+1, self.styles[1]) print("setStyling(%)") offset += len(i)+1 continue self.setStyling(len(i)+1, self.styles[0]) print("setStyling(n)") offset += len(i)+1 def getText(self, start, end): data = self.sci.text() print("LexerErlang.getText(): " + str(len(data)) + " chars") return data[start:end].split('\n') Applied to the QsciScintilla widget as follows: _lexers = { 'erl': (Q.SCLEX_ERLANG, LexerErlang), 'hrl': (Q.SCLEX_ERLANG, LexerErlang), 'html': (Q.SCLEX_HTML, Qsci.QsciLexerHTML), 'css': (Q.SCLEX_CSS, Qsci.QsciLexerCSS), 'py': (Q.SCLEX_PYTHON, Qsci.QsciLexerPython), 'php': (Q.SCLEX_PHP, Qsci.QsciLexerHTML), 'inc': (Q.SCLEX_PHP, Qsci.QsciLexerHTML), 'js': (Q.SCLEX_CPP, Qsci.QsciLexerJavaScript), 'cpp': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'h': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'cxx': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'hpp': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'c': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'hxx': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'tpl': (Q.SCLEX_CPP, Qsci.QsciLexerCPP), 'xml': (Q.SCLEX_XML, Qsci.QsciLexerXML), } ... inside my document window class ... def addContentsDocument(self, contents, title): handler = self.makeScintilla() handler.title = title sci = handler.sci sci.append(contents) self.tabWidget.addTab(sci, title) self.tabWidget.setCurrentWidget(sci) self.applyLexer(sci, title) EventBus.bus.broadcast('command.done', {'text': 'Opened ' + title}) return handler def applyLexer(self, sci, title): (language, lexer) = language_and_lexer_from_title(title) if lexer: l = lexer() print("making lexer: " + str(l)) sci.setLexer(l) else: print("setting lexer by id: " + str(language)) sci.SendScintilla(Qsci.QsciScintillaBase.SCI_SETLEXER, language) linst = sci.lexer() print("lexer: " + str(linst)) def makeScintilla(self): sci = Qsci.QsciScintilla() sci.setUtf8(True) sci.setTabIndents(True) sci.setIndentationsUseTabs(False) sci.setIndentationWidth(4) sci.setMarginsFont(self.smallFont) sci.setMarginWidth(0, self.smallFontMetrics.width('00000')) sci.setFont(self.monoFont) sci.setAutoIndent(True) sci.setBraceMatching(Qsci.QsciScintilla.StrictBraceMatch) handler = SciHandler(sci) self.handlers[sci] = handler sci.setMarginLineNumbers(0, True) sci.setCaretLineVisible(True) sci.setCaretLineBackgroundColor(QtGui.QColor(prefs.get('color.editline'))) return handler Let's assume the rest of the application works, too (because it does :-)

    Read the article

  • Asus me302c create script crash

    - by wxfred
    State beforehand: So far, only Asus me302c would crash when it creates a script. This device can create renderscript context successfully 06-03 10:12:50.509: V/RenderScript_jni(3144): RS compat mode 06-03 10:12:50.509: V/RenderScript(3144): 0x610bbfc0 Launching thread(s), CPUs 4 06-03 10:12:50.549: D/libEGL(3144): loaded /vendor/lib/egl/libEGL_POWERVR_SGX544_115.so 06-03 10:12:50.559: D/libEGL(3144): loaded /vendor/lib/egl/libGLESv1_CM_POWERVR_SGX544_115.so 06-03 10:12:50.559: D/libEGL(3144): loaded /vendor/lib/egl/libGLESv2_POWERVR_SGX544_115.so 06-03 10:12:50.619: D/OpenGLRenderer(3144): Enabling debug mode 0 06-03 10:12:52.869: D/dalvikvm(3144): Rejecting registerization due to ushr-int/lit8 v4, v7, (#19) When create a script, it crashed. 06-03 09:55:09.859: D/basefilter(26682): ===createScript=== 06-03 09:55:09.869: E/RenderScript(26682): Unable to open shared library (/data/data/xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxx.xxxx//lib/librs.basefilter.so): Cannot load library: soinfo_relocate(linker.cpp:975): cannot locate symbol "_Z3dotDv3_fS_" referenced by "librs.basefilter.so"... 06-03 09:55:09.869: E/RenderScript(26682): Unable to open system shared library (/system/lib/librs.basefilter.so): (null) 06-03 09:55:09.869: D/AndroidRuntime(26682): Shutting down VM 06-03 09:55:09.869: W/dalvikvm(26682): threadid=1: thread exiting with uncaught exception (group=0x418b9e10) 06-03 09:55:09.869: E/AndroidRuntime(26682): FATAL EXCEPTION: main 06-03 09:55:09.869: E/AndroidRuntime(26682): android.support.v8.renderscript.RSRuntimeException: Loading of ScriptC script failed. 06-03 09:55:09.869: E/AndroidRuntime(26682): at android.support.v8.renderscript.ScriptC.<init>(ScriptC.java:69) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.xxxxxx.ScriptC_BaseFilter.<init>(ScriptC_BaseFilter.java:41) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.xxxxxx.ScriptC_BaseFilter.<init>(ScriptC_BaseFilter.java:35) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.xxxxxx.xxxxxx.TeethWhiteningRSFilter.onCreateScript(TeethWhiteningRSFilter.java:19) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.xxxxxx.xxxxxx.TeethWhiteningRSFilter.onCreateScript(TeethWhiteningRSFilter.java:1) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.BaseRSFilter.createScript(BaseRSFilter.java:39) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxxxxxxx.RSFilterEngine.addFilter(RSFilterEngine.java:76) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxx.xxxx.BeautyActivity.changeBeautyEffect(BeautyActivity.java:277) 06-03 09:55:09.869: E/AndroidRuntime(26682): at xxx.xxxxxxxxxxx.xxxxxxxxx.xxxxx.xxxx.BeautyActivity$2.onClick(BeautyActivity.java:100) 06-03 09:55:09.869: E/AndroidRuntime(26682): at com.android.internal.app.AlertController$ButtonHandler.handleMessage(AlertController.java:166) 06-03 09:55:09.869: E/AndroidRuntime(26682): at android.os.Handler.dispatchMessage(Handler.java:99) 06-03 09:55:09.869: E/AndroidRuntime(26682): at android.os.Looper.loop(Looper.java:152) 06-03 09:55:09.869: E/AndroidRuntime(26682): at android.app.ActivityThread.main(ActivityThread.java:5132) 06-03 09:55:09.869: E/AndroidRuntime(26682): at java.lang.reflect.Method.invokeNative(Native Method) 06-03 09:55:09.869: E/AndroidRuntime(26682): at java.lang.reflect.Method.invoke(Method.java:511) 06-03 09:55:09.869: E/AndroidRuntime(26682): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:793) 06-03 09:55:09.869: E/AndroidRuntime(26682): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:560) 06-03 09:55:09.869: E/AndroidRuntime(26682): at dalvik.system.NativeStart.main(Native Method) Now, I will post some related infomation. project.properties ... renderscript.target=9 renderscript.support.mode=true sdk.buildtools=19.0.3 device info Brand: Asus Model: ME302C OS: 4.2.2 CPU: Intel(R) Atom(TM) CPU Z2560 @1.60GHz GPU Renderer PowerVR SGX 544MP Finally, by the way, the same code runs well on Galaxy s2, s4, note 2.

    Read the article

  • Computer science undergraduate project ideas

    - by Mehrdad Afshari
    Hopefully, I'm going to finish my undergraduate studies next semester and I'm thinking about the topic of my final project. And yes, I've read the questions with duplicate title. I'm asking this from a bit different viewpoint, so it's not an exact dupe. I've spent at least half of my life coding stuff in different languages and frameworks so I'm not looking at this project as a way to learn much about coding and preparing for real world apps or such. I've done lots of those already. But since I have to do it to complete my degree, I felt I should spend my time doing something useful instead of throwing the whole thing out. I'm planning to make it an open source project or a hosted Web app (depending on the type) if I can make a high quality thing out of it, so I decided to ask StackOverflow what could make a useful project. Situation I've plenty of freedom about the topic. They also require 30-40 pages of text describing the project. I have the following points in mind (the more satisfied, the better): Something useful for software development Something that benefits the community Having academic value is great Shouldn't take more than a month of development (I know I'm lazy). Shouldn't be related to advanced theoretical stuff (soft computing, fuzzy logic, neural networks, ...). I've been a business-oriented software developer. It should be software oriented. While I love hacking microcontrollers and other fun embedded electronic things, I'm not really good at soldering and things like that. I'm leaning toward a Web application (think StackOverflow, PasteBin, NerdDinner, things like those). Technology It's probably going to be done in .NET (C#, F#) and Windows platform. If I really like the project (cool low level hacking), I might actually slip to C/C++. But really, C# is what I'm efficient at. Ideas Programming language, parsing and compiler related stuff: Designing a domain specific programming language and compiler Templating language compiled to C# or IL Database tools and related code generation stuff Web related technologies: ASP.NET MVC View engine doing something cool (don't know what exactly...) Specific-purpose, small, fast ASP.NET-based Web framework Applications: Visual Studio plugin to integrate with Bazaar (it's too much work, I think). ASP.NET based, jQuery-powered issue tracker (and possibly, project lifecycle management as a whole - poor man's TFS) Others: Something related to GPGPU Looking forward for great ideas! Unfortunately, I can't help on a currently existing project. I need to start my own to prevent further problems (as it's an undergrad project, nevertheless).

    Read the article

  • Problem with AquaTerm on Snow Leopard

    - by cheetah
    When i try to install AquaTerm on Snow leopard from MacPorts i got this: ---> Computing dependencies for aquaterm ---> Building aquaterm Error: Target org.macports.build returned: shell command "cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm" && /usr/bin/xcodebuild -target "AquaTerm" -configuration Deployment build OBJROOT=build/ SYMROOT=build/ MACOSX_DEPLOYMENT_TARGET=10.6 ARCHS=x86_64 SDKROOT= USER_APPS_DIR=/Applications/MacPorts FRAMEWORKS_DIR=/opt/local/Library/Frameworks" returned error 1 Command output: [WARN]Warning: The Copy Bundle Resources build phase contains this target's Info.plist file 'AquaTerm.framework-Info.plist'. CopyPlistFile build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist AquaTerm.framework-Info.plist --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 === BUILD NATIVE TARGET AquaTerm OF PROJECT AquaTerm WITH CONFIGURATION Deployment === Check dependencies Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html [WARN]Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html CopyTiffFile build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff English.lproj/Cross.tiff --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 ** BUILD FAILED ** The following build commands failed: AQTFwk: CopyPlistFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist AquaTerm: CopyTiffFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff (2 failures) Error: Status 1 encountered during processing. Before reporting a bug, first run the command again with the -d flag to get complete output. How i can solve this problem?

    Read the article

  • Resizing QT's QTextEdit to Match Text Height: maximumViewportSize()

    - by Aaron
    I am trying to use a QTextEdit widget inside of a form containing several QT widgets. The form itself sits inside a QScrollArea that is the central widget for a window. My intent is that any necessary scrolling will take place in the main QScrollArea (rather than inside any widgets), and any widgets inside will automatically resize their height to hold their contents. I have tried to implement the automatic resizing of height with a QTextEdit, but have run into an odd issue. I created a sub-class of QTextEdit and reimplemented sizeHint() like this: QSize OperationEditor::sizeHint() const { QSize sizehint = QTextBrowser::sizeHint(); sizehint.setHeight(this->fitted_height); return sizehint; } this-fitted_height is kept up-to-date via this slot that is wired to the QTextEdit's "contentsChanged()" signal: void OperationEditor::fitHeightToDocument() { this->document()->setTextWidth(this->viewport()->width()); QSize document_size(this->document()->size().toSize()); this->fitted_height = document_size.height(); this->updateGeometry(); } The size policy of the QTextEdit sub-class is: this->setSizePolicy(QSizePolicy::MinimumExpanding, QSizePolicy::Preferred); I took this approach after reading this post. Here is my problem: As the QTextEdit gradually resizes to fill the window, it stops getting larger and starts scrolling within the QTextEdit, no matter what height is returned from sizeHint(). If I initially have sizeHint() return some large constant number, then the QTextEdit is very big and is contained nicely within the outer QScrollArea, as one would expect. However, if sizeHint gradually adjusts the size of the QTextEdit rather than just making it really big to start, then it tops out when it fills the current window and starts scrolling instead of growing. I have traced this problem to be that, no matter what my sizeHint() returns, it will never resize the QTextEdit larger than the value returned from maximumViewportSize(), which is inherited from QAbstractScrollArea. Note that this is not the same number as viewport()-maximumSize(). I am unable to figure out how to set that value. Looking at QT's source code, maximumViewportSize() is returning "the size of the viewport as if the scroll bars had no valid scrolling range." This value is basically computed as the current size of the widget minus (2 * frameWidth + margins) plus any scrollbar widths/heights. This does not make a lot of sense to me, and it's not clear to me why that number would be used anywhere in a way that supercede's the sub-class's sizeHint() implementation. Also, it does seem odd that the single "frameWidth" integer is used in computing both the width and the height. Can anyone please shed some light on this? I suspect that my poor understanding of QT's layout engine is to blame here.

    Read the article

  • How do I verify a DKIM signature in PHP?

    - by angrychimp
    I'll admit I'm not very adept at key verification. What I have is a script that downloads messages from a POP3 server, and I'm attempting to verify the DKIM signatures in PHP. I've already figured out the body hash (bh) validation check, but I can't figure out the header validation. http://www.dkim.org/specs/rfc4871-dkimbase.html#rfc.section.6.1.3 Below is an example of my message headers. I've been able to use the Mail::DKIM package to validate the signature in Perl, so I know it's good. I just can't seem to figure out the instructions in the RFC and translate them into PHP code. DomainKey-Signature: q=dns; a=rsa-sha1; c=nofws; s=angrychimp-1.bh; d=angrychimp.net; h=From:X-Outgoing; b=RVkenibHQ7GwO5Y3tun2CNn5wSnooBSXPHA1Kmxsw6miJDnVp4XKmA9cUELwftf9 nGiRCd3rLc6eswAcVyNhQ6mRSsF55OkGJgDNHiwte/pP5Z47Lo/fd6m7rfCnYxq3 DKIM-Signature: v=1; a=rsa-sha1; d=angrychimp.net; s=angrychimp-1.bh; c=relaxed/simple; q=dns/txt; [email protected]; t=1268436255; h=From:Subject:X-Outgoing:Date; bh=gqhC2GEWbg1t7T3IfGMUKzt1NCc=; b=ZmeavryIfp5jNDIwbpifsy1UcavMnMwRL6Fy6axocQFDOBd2KjnjXpCkHxs6yBZn Wu+UCFeAP+1xwN80JW+4yOdAiK5+6IS8fiVa7TxdkFDKa0AhmJ1DTHXIlPjGE4n5; To: [email protected] Message-ID: From: DKIM Tester Reply-To: [email protected] Subject: Automated DKIM Testing (angrychimp.net) X-Outgoing: dhaka Date: Fri, 12 Mar 2010 15:24:15 -0800 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Content-Disposition: inline MIME-Version: 1.0 Return-Path: [email protected] X-OriginalArrivalTime: 12 Mar 2010 23:25:50.0326 (UTC) FILETIME=[5A0ED160:01CAC23B] I can extract the public key from my DNS just fine, and I believe I'm canonicalizing the headers correctly, but I just can't get the signature validated. I don't think I'm preparing my key or computing the signature validation correctly. Is this something that's possible (do I need pear extensions or something?) or is manually validating a DKIM signature in PHP just not feasible?

    Read the article

  • Resultant of a polynomial with x^n–1

    - by devin.omalley
    Resultant of a polynomial with x^n–1 (mod p) I am implementing the NTRUSign algorithm as described in http://grouper.ieee.org/groups/1363/lattPK/submissions/EESS1v2.pdf , section 2.2.7.1 which involves computing the resultant of a polynomial. I keep getting a zero vector for the resultant which is obviously incorrect. private static CompResResult compResMod(IntegerPolynomial f, int p) { int N = f.coeffs.length; IntegerPolynomial a = new IntegerPolynomial(N); a.coeffs[0] = -1; a.coeffs[N-1] = 1; IntegerPolynomial b = new IntegerPolynomial(f.coeffs); IntegerPolynomial v1 = new IntegerPolynomial(N); IntegerPolynomial v2 = new IntegerPolynomial(N); v2.coeffs[0] = 1; int da = a.degree(); int db = b.degree(); int ta = da; int c = 0; int r = 1; while (db > 0) { c = invert(b.coeffs[db], p); c = (c * a.coeffs[da]) % p; IntegerPolynomial cb = b.clone(); cb.mult(c); cb.shift(da - db); a.sub(cb, p); IntegerPolynomial v2c = v2.clone(); v2c.mult(c); v2c.shift(da - db); v1.sub(v2c, p); if (a.degree() < db) { r *= (int)Math.pow(b.coeffs[db], ta-a.degree()); r %= p; if (ta%2==1 && db%2==1) r = (-r) % p; IntegerPolynomial temp = a; a = b; b = temp; temp = v1; v1 = v2; v2 = temp; ta = db; } da = a.degree(); db = b.degree(); } r *= (int)Math.pow(b.coeffs[0], da); r %= p; c = invert(b.coeffs[0], p); v2.mult(c); v2.mult(r); v2.mod(p); return new CompResResult(v2, r); } There is pseudocode in http://www.crypto.rub.de/imperia/md/content/texte/theses/da_driessen.pdf which looks very similar. Why is my code not working? Are there any intermediate results I can check? I am not posting the IntegerPolynomial code because it isn't too interesting and I have unit tests for it that pass. CompResResult is just a simple "Java struct".

    Read the article

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • Which mobile operating system should I code for?

    - by samgoody
    It seems as though mobile computing has fully arrived. I would like to rewrite two of our programs for mobile devices, but am a bit lost as to which platform to target. Complicating this decision: I would need to learn the relevant languages and IDEs - my coding to date has been almost all web based (PHP, JS, Actionscript, etc. Some ASPX). Most users seem to be religious about their mobile decision, so oral conversations leave me more confused then enlightened. I do not yet own a smartphone - will have to buy one once I know which platform to be aiming for. Both of my programs are more for business users, (one is only useful for C.P.A.s). I am a single developer, and cannot develop for more than one platform at a time. Getting it right is important. Based on what I've found on the web, I would've expected RIM to be a shoo-in, and the general order to be as follows: RIM Blackberry - More of them than any other brand. Despite naysayers, they've had double the sales (or perhaps 5X the sales) of any other smartphone, and have continued to grow. And, they have business users. Android - According to Schmidt, they have outsold everyone else except RIM (though I can't find where I read that now), and they are just getting started. According to Comscore, they are already at 8% of the market and expected to hit Shcmidt's claims within six months. Nokia - The largest worldwide. If they would just make up between Maemo or Symbian, I would be far less confused. iPhone - Much more competition by other apps, fewer sales to be had, and a overlord that can delay or cancel my app at any time. Is Cocoa hard to learn? Windows Mobile - Word is that version 7 will not be backwards compatible and losing market share. Palm WebOS - Perhaps this should go first, as it is the only one that offers tools to make my life easy as a web application developer. No competition in marketplace. But not very many users either. However, a search on StackOverflow shows a hugely disproportionate number of iPhone questions versus Blackberry. Likewise, there are clearly more apps on iPhone, so it must be getting developer love. What is the one platform I should develop for? Please back up your answer with the logic.

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97  | Next Page >