Search Results

Search found 5881 results on 236 pages for 'junction points'.

Page 91/236 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • How to convert a string into a Point in C#

    - by NateD
    I have a list of strings of the format "x,y". I would like to make them all into Points. The best Point constructor I can find takes two ints. What is the best way in C# to turn "14,42" into new Point(14,42);? I know the Regex for doing that is /(\d+),(\d+)/, but I'm having a hard time turning those two match groups into ints in C#. any help you could offer would be appreciated.

    Read the article

  • Amazon S3 enforcing access control

    - by KandadaBoggu
    I have several PDF files stored in Amazon S3. Each file is associated with a user and only the file owner can access the file. I have enforced this in my download page. But the actual PDF link points to Amazon S3 url, which is accessible to anybody. How do I enforce the access-control rules for this url?(without making my server a proxy for all the PDF download links)

    Read the article

  • Query MSQL for winners, starting at xth place using SELECT

    - by incrediman
    In my MySQL table Winners, I have a list of people who have won. What I'd like to do is select a list of the names of 10 winners. So what I have right now is this: SELECT name FROM Winners ORDER BY points DESC LIMIT 10 This returns the first 10 winners which is great. But how can I make it (for example) return 10 winners, but starting at 20th place?

    Read the article

  • Formatted input in c++

    - by julz666
    hey, i'm a noob to c++ (and coding in general) i'm looking for an easy way to take two doubles (at once) from the keyboard and store them in a struct i've created called "Point" and then ultimately store the Point into a vector of Points that's a member of a class (called "Polygon"). i know i could do it with a scanf but need to know how to do it with cin. hope that makes sense. thanks in advance julz

    Read the article

  • Castle WCF DefaultServiceHostFactory in IIS: Accessing the ServiceHost

    - by user250837
    I am attempting to move from a self hosting architecture to hosting under IIS 6, primarily to take advantage of built in dynamic compression. I am using the Castle DefaultServiceHostFactory to provide the service to IIS in the .svc file. However, I need to programmatically specify certain end points and behaviours and I do not know how to retrieve the current ServiceHost. Is this be possible, or should I just look at other methods of compression independent of IIS?

    Read the article

  • Please help with iPhone Memory & Images, memory usage crashing app

    - by Andrew Gray
    I have an issue with memory usage relating to images and I've searched the docs and watched the videos from cs193p and the iphone dev site on memory mgmt and performance. I've searched online and posted on forums, but I still can't figure it out. The app uses core data and simply lets the user associate text with a picture and stores the list of items in a table view that lets you add and delete items. Clicking on a row shows the image and related text. that's it. Everything runs fine on the simulator and on the device as well. I ran the analyzer and it looked good, so i then starting looking at performance. I ran leaks and everything looked good. My issue is when running Object Allocations as every time i select a row and the view with the image is shown, the live bytes jumps up a few MB and never goes down and my app eventually crashes due to memory usage. Sorting the live bytes column, i see 2 2.72MB mallocs (5.45Mb total), 14 CFDatas (3.58MB total), 1 2.74MB malloc and everything else is real small. the problem is all the related info in instruments is really technical and all the problem solving examples i've seen are just missing a release and nothing complicated. Instruments shows Core Data as the responsible library for all but one (libsqlite3.dylib the other) with [NSSQLCore _prepareResultsFromResultSet:usingFetchPlan:withMatchingRows:] as the caller for all but one (fetchResultSetReallocCurrentRow the other) and im just not sure how to track down what the problem is. i've looked at the stack traces and opened the last instance of my code and found 2 culprits (below). I havent been able to get any responses at all on this, so if anyone has any tips or pointers, I'd really appreciate it!!!! //this is from view controller that shows the title and image - (void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.title = item.title; self.itemTitleTextField.text = item.title; if ([item.notes length] == 0) { self.itemNotesTextView.hidden = YES; } else { self.itemNotesTextView.text = item.notes; } //this is the line instruments points to UIImage *image = item.photo.image; itemPhoto.image = image; } - (void)tableView:(UITableView *)tableView commitEditingStyle:(UITableViewCellEditingStyle)editingStyle forRowAtIndexPath:(NSIndexPath *)indexPath { if (editingStyle == UITableViewCellEditingStyleDelete) { // Delete the managed object for the given index path NSManagedObjectContext *context = [fetchedResultsController managedObjectContext]; [context deleteObject:[fetchedResultsController objectAtIndexPath:indexPath]]; // Save the context. NSError *error = nil; if (![context save:&error]) //this is the line instruments points to { NSLog(@"Unresolved error %@, %@", error, [error userInfo]); exit(-1); } } }

    Read the article

  • ggplot2 pdf import in Adobe Illustrator missing font AdobePiStd

    - by Sander
    I created several simple ggplot2 plots and saved them to PDF files using the following commands: p <- ggplot(plotobject, aes(x=Pos, y=Pval),res=300) ggsave(plot=p,height=6,width=6,dpi=200, filename="~/example.pdf") If I now open this example.pdf in Adobe Illustrator I get the following error: The font AdobePiStd is missing. Affected text will be displayed using a substitute font. Is there a way in ggplot2 to specify a font (I presume this is for the dots/points) that Adobe will understand or otherwise is there a way to get this font working in Adobe?

    Read the article

  • Good language to learn in order to build small websites

    - by mkoryak
    I want to start building websites and charging people for them! My problem is that the stack that know well does not lend itself to quick development, or cheap hosting. I am looking for languages that satisfy the following criteria: Fast to develop in Can find cheap hosting for it Bonus points if it can also be 'enterprisey'

    Read the article

  • Future proof Tweeting with PHP

    - by YsoL8
    Hello I'm looking to implement a system for tweeting directly from my site backend, which is written in PHP 5. I have a script from the internet that I can adapt, but I'm concerned that when Twitter switches to Oauth only, I'll be out in the cold. Basically, I'm hoping someone can point me toward a script/tutorial that will let me do the following: access twitter via the Oauth system Post Tweets and receive error codes Let me define an application/site name (I'm a bit fuzzy on whether Twitter allows this) Ideally I need all 3 points explained in detail. Thanks

    Read the article

  • MySQL - Order results by relevancy, LEFT JOINS and more

    - by XaviEsteve
    Hi guys, I am trying to get some results ordered by total votes (where client votes count 2 points and other people votes are 1 point). tab_names: +-----------+ | Name | id | +------+----+ | John | 1 | | Paul | 2 | +------+----+ tab_votes: +--------+-----------+ | idname | ip | +--------+-----------+ | 2 | 127.0.0.1 | | 2 | 127.0.0.1 | | 2 | 82.23.5.1 | | 1 | 127.0.0.1 | +--------+-----------+ This is the MySQL query I've got but doesn't work: SELECT * COUNT(v.idname) AS totalvotes, (SELECT COUNT(v.ip) FROM tab_votes WHERE v.ip LIKE '$ip') AS uservotes FROM tab_names n LEFT JOIN tab_votes v ON n.id = v.idname GROUP BY n.name ORDER BY uservotes DESC, totalvotes DESC LIMIT 40

    Read the article

  • draw rectangel using latitude\longitude on screen

    - by jamesM
    the existing Application is providing me 8 coordinates like NElatitude,NElongitude, NWlatitude,NWlongitude, SElatitude,SElongitude, SWlatitude,SWlongitudepoints and i have been asked draw rectangles on screen using this coordinates as a screen points. These rectangles should be with scaling. thank you for your help JamesM

    Read the article

  • What is the meaning of the following?

    - by vj
    int sampleArray[] = {1,2,3,4,5}; I understand that the sampleArray now points to the first element of the array. However, what does it mean when I say &sampleArray ? Does it mean I am getting the address of the sampleArray variable? Or does it mean a two dimensional array variable? So, i can do this: int (*p)[5] = &sampleArray? Thanks

    Read the article

  • Avoid writing SQL queries altogether in SSIS

    - by Jonn
    Working on a Data Warehouse project, the guy that gave us the tutorial advised that we stick to using SQL queries over defining a lot of data flow transformations, citing points like it'll consume a lot of memory on the ETL box so we'd rather leave the processing to the DB box. Is this really advisable? Where's the balance between relying on GUI tools over executing a bunch of SQL scripts on your Integration package? And honestly, I'd like to avoid writing SQL queries as much as I can.

    Read the article

  • Eclipse CDT debugger does not show console

    - by KáGé
    Hi, I'm trying to debug a C program using Eclipse CDT-s debugger and gdb on a Windows7 system, and everything seems fine, except for the console not showing up, which is bad, because my program needs input at some points from the keyboard. So how should I make Eclipse's debugger work properly? Thank you.

    Read the article

  • How do I get the available wifi APs and their signal strength in .net?

    - by LDomagala
    Is there any way to access all WiFi access points and their respective RSSI values using .NET? It would be really nice if I could do it without using unmanaged code or even better if it worked in mono as well as .NET. If it is possible i would appriciate a code sample. Thanks Here are a few similiar stackoverflow questions i found: -Get SSID of the wireless network I am connected to with C# .Net on Windows Vista -Managing wireless network connection in C# -Get BSSID (MAC address) of wireless access point from C#

    Read the article

  • Set textarea selection in Internet Explorer

    - by Tatu Ulmanen
    I'm looking for a way to set a selection in a textarea in Internet Explorer. In other browsers, this works just fine: textarea.selectionStart = start; textarea.selectionEnd = end; In IE, I assume I have to use createRange and adjust the selection somehow, but I cannot figure out how. Extra bonus points for a link to a proper documentation about createRange and associated methods, MSDN isn't helping out much.

    Read the article

  • What are the best practices for implementing the == operator for a class in C#?

    - by remio
    While implementing an == operator, I have the feeling that I am missing some essential points. Hence, I am searching some best practices around that. Here are some related questions I am thinking about: How to cleanly handle the reference comparison? Should it be implemented through a IEquatable<T>-like interface? Or overriding object.Equals? And what about the != operator? (this list might not be exhaustive).

    Read the article

  • Biggest Delphi nitpicks

    - by Mason Wheeler
    What sort of minor annoyances do you run into using Delphi? I'm not looking for major issues such as "I want a 64-bit compiler." Just little things that can be easily worked around but still should have been implemented better so you don't have to work around them? Marking this CW. I'm more interested in the answers than the points.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >