Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 914/1507 | < Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >

  • dotted stroke in <canvas>

    - by Sam
    I guess it is not possible to set stroke property such as CSS which is quite easy. With CSS we have dashed, dotted, solid but on canvas when drawing lines/or strokes this doesn't seem to be an option. How have you implemented this? I've seen some examples but they are really long for such a silly function. For example: http://groups.google.com/group/javascript-information-visualization-toolkit/browse_thread/thread/22000c0d0a1c54f9?pli=1

    Read the article

  • Capture node.js crash reason

    - by dfilkovi
    I have a script written in node.js, it uses 'net' library and communicates with distant service over tcp. This script is started using 'node script.js log.txt' command and everything in that script that is logged using console.log() function gets written to log.txt but sometimes script dies and I cannot find a reason and nothing gets logged in log.txt around the time script crashed. How can I capture crash reason?

    Read the article

  • What do you call this functional language feature?

    - by Jimmy
    ok, embarrassing enough, I posted code that I need explained. Specifically, it first chains absolute value and subtraction together, then tacks on a sort, all the while not having to mention parameters and arguments at all, because of the presense of "adverbs" that can join these functions "verbs" What (non-APL-type) languages support this kind of no-arguments function composition (I have the vague idea it ties in strongly to the concepts of monad/dyad and rank, but its hard to get a particularly easy-to-understand picture just from reading Wikipedia) and what do I call this concept?

    Read the article

  • PHP 'Years' array

    - by J M 4
    I am trying to create an array for years which i will use in the DOB year piece of a form I am building. Currently, I know there are two ways to handle the issue but I don't really care for either: 1) Range: I know I can create a year array using the following <?php $year = range(1910,date("Y")); $_SESSION['years_arr'] = $year; ?> the problem with Point 1 is two fold: a) my function call shows the first year as 'selected' instead of "Year" as I have as option="0", and b) I want the years reversed so 2010 is the first in the least and shown decreasing. My function call is: PHP <?php function showOptionsDrop($array, $active, $echo=true){ $string = ''; foreach($array as $k => $v){ $s = ($active == $k)? ' selected="selected"' : ''; $string .= '<option value="'.$k.'"'.$s.'>'.$v.'</option>'."\n"; } if($echo) echo $string; else return $string; } ?> HTML <table> <tr> <td>State:</td> <td><select name="F1State"><option value="0">Choose a year</option><?php showOptionsDrop($_SESSION['years_arr'], null, true); ?></select> </td> </tr> </table> 2) Long Array I know i can physically create an array with years listed out but this takes up a lot of space and time if I ever want to go back and modify. ex: PHP $years = array('1900'=>"1900", '1901'=>"1901", '1902'=>"1902", '1903'=>"1903", '1904'=>"1904", '1905'=>"1905", '1906'=>"1906", '1907'=>"1907", '1908'=>"1908", '1909'=>"1909", '1910'=>"1910", '1911'=>"1911", '1912'=>"1912", '1913'=>"1913", '1914'=>"1914", '1915'=>"1915", '1916'=>"1916", '1917'=>"1917", '1918'=>"1918", '1919'=>"1919", '1920'=>"1920", '1921'=>"1921", '1922'=>"1922", '1923'=>"1923", '1924'=>"1924", '1925'=>"1925", '1926'=>"1926", '1927'=>"1927", '1928'=>"1928", '1929'=>"1929", '1930'=>"1930", '1931'=>"1931", '1932'=>"1932", '1933'=>"1933", '1934'=>"1934", '1935'=>"1935", '1936'=>"1936", '1937'=>"1937", '1938'=>"1938", '1939'=>"1939", '1940'=>"1940", '1941'=>"1941", '1942'=>"1942", '1943'=>"1943", '1944'=>"1944", '1945'=>"1945", '1946'=>"1946", '1947'=>"1947", '1948'=>"1948", '1949'=>"1949", '1950'=>"1950", '1951'=>"1951", '1952'=>"1952", '1953'=>"1953", '1954'=>"1954", '1955'=>"1955", '1956'=>"1956", '1957'=>"1957", '1958'=>"1958", '1959'=>"1959", '1960'=>"1960", '1961'=>"1961", '1962'=>"1962", '1963'=>"1963", '1964'=>"1964", '1965'=>"1965", '1966'=>"1966", '1967'=>"1967", '1968'=>"1968", '1969'=>"1969", '1970'=>"1970", '1971'=>"1971", '1972'=>"1972", '1973'=>"1973", '1974'=>"1974", '1975'=>"1975", '1976'=>"1976", '1977'=>"1977", '1978'=>"1978", '1979'=>"1979", '1980'=>"1980", '1981'=>"1981", '1982'=>"1982", '1983'=>"1983", '1984'=>"1984", '1985'=>"1985", '1986'=>"1986", '1987'=>"1987", '1988'=>"1988", '1989'=>"1989", '1990'=>"1990", '1991'=>"1991", '1992'=>"1992", '1993'=>"1993", '1994'=>"1994", '1995'=>"1995", '1996'=>"1996", '1997'=>"1997", '1998'=>"1998", '1999'=>"1999", '2000'=>"2000", '2001'=>"2001", '2002'=>"2002", '2003'=>"2003", '2004'=>"2004", '2005'=>"2005", '2006'=>"2006", '2007'=>"2007", '2008'=>"2008", '2009'=>"2009", '2010'=>"2010"); $_SESSION['years_arr'] = $years_arr; Does anybody have a recommended idea how to work - or just how to simply modify my existing code? Thank you!

    Read the article

  • When writing a form submit to a file, strip line breaks and commas

    - by bccarlso
    I have a form with a textarea in it. I log the results to a text file on the server, but I would like to strip out any line breaks a user would put in the textarea, as well as any commas that would interfere with importing the comma-delimited log text file into Excel or something for later use. I think this has to do with regex, but I'm no expert and could use some help. Or maybe there is an easy PHP function that will do it?

    Read the article

  • BackgroundWorker Thread in IIS7 - FAIL!

    - by Darren Oster
    Just wondering if anyone has had any trouble using a BackgroundWorker Thread in a site running under IIS 7 in Integrated Pipeline mode? I am trying to use such a beast to update the database schema (admin function, obviously), and it works perfectly in Cassini, but when I deploy to IIS 7, the thread gets about one line of code in and silently ends. Is there a way to tell why a thread ended? Thanks in advance.

    Read the article

  • Is it true that one should not use NSLog() on production code?

    - by jpm
    I was told this a few times in this very site, but I wanted to make sure this is really the case. I was expecting to be able to sprinkle NSLog function calls throughout my code, and that Xcode/gcc would automatically strip those calls out when building my Release/Distribution builds. Should I avoid using this? If so, what alternatives are most common between experienced Objective-C programmers?

    Read the article

  • Find Rank in Microsoft Report

    - by Alex Essilfie
    Is there any way I can find the rank of a set of values in Microsoft Reports? For instance, in order to produce a table like the one below, what function/formula do I enter in the Rank column? +------+-----+ |Value | Rank| +------+-----+ | 12 | 3 | | 30 | 5 | | 5 | 1 | | 10 | 2 | | 24 | 4 | +------+-----+ Update Values in the value column are produced from calculations on the report-side so I cannot find the rank using a query.

    Read the article

  • Making Visual C++ DLL from C++ class

    - by prosseek
    I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

    Read the article

  • Can I create class properties during __new__ or __init__?

    - by 007brendan
    I want to do something like this. The _print_attr function is designed to be called lazily, so I don't want to evaluate it in the init and set the value to attr. I would like to make attr a property that computes _print_attr only when accessed: class Base(object): def __init__(self): for attr in self._edl_uniform_attrs: setattr(self, attr, property(lambda self: self._print_attr(attr))) def _print_attr(self, attr): print attr class Child(Base): _edl_uniform_attrs = ['foo', 'bar'] me = Child() me.foo me.bar #output: #"foo" #"bar"

    Read the article

  • Looping through array in PHP to post several multipart form-data

    - by Léon Pelletier
    I'm trying in an asp web application to code a function that would loop through a list of files in a multiple upload form and send them one by one. Is this something that can be done in ASP? Because I've read some posts about how to attach several files together, but saw nothing about looping through the files. I can easily imagine it in C# via HttpWebRequest or with socket, but in php, I guess there are already function designed to handle it? // This is false/pseudo-code :) for (int index = 0; index < number_of_files; index++) { postfile(file[index]); } And in each iteration, it should send a multipart form-data POST. postfile(TheFileInfos) should make a POST like it: POST /afs.aspx?fn=upload HTTP/1.1 [Header stuff] Content-Type: multipart/form-data; boundary=----------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 [Header stuff] ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filename" myimage1.png ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="fileid" 58e21ede4ead43a5201206101806420000007667212251 ------------Ef1Ef1cH2Ij5GI3ae0gL6KM7GI3GI3 Content-Disposition: form-data; name="Filedata"; filename="myimage1.png" Content-Type: application/octet-stream [Octet Stream] [Edit] I'll try it: <html> <head> <title>Untitled Document</title> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1"> </head> <body> <form name="form1" enctype="multipart/form-data" method="post" action="processFiles.php"> <p> <? // start of dynamic form $uploadNeed = $_POST['uploadNeed']; for($x=0;$x<$uploadNeed;$x++){ ?> <input name="uploadFile<? echo $x;?>" type="file" id="uploadFile<? echo $x;?>"> </p> <? // end of for loop } ?> <p><input name="uploadNeed" type="hidden" value="<? echo $uploadNeed;?>"> <input type="submit" name="Submit" value="Submit"> </p> </form> </body> </html>

    Read the article

  • Convert integer to formatted LPCWSTR. C++

    - by Mr Bell
    I have a direct3d project that uses D3DXCreateTextureFromFile() to load some images. This function takes a LPCWSTR for the path to file. I want to load a series of textures that are numbered consecutively (ie. MyImage0001.jpg, MyImage0002.jpg, etc) But c++'s crazy strings confuse me. How do i: for(int i=0; i < 3;i++) { //How do I convert i into a string path i can use with D3DXCreateTextureFromFile? }

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • magento -search not working properly

    - by TEster
    hai I have a magento web site. In this the search function compare with product name, description, sku and part number. I want to modify this. ie having to compare only with the product name, short description and Sku, How is it possible.Is there is any settings in admin side?

    Read the article

  • Poll the Server with Ajax and Dojo

    - by mickthomposn
    I'm using dojo.xhrPost to sent Ajax Requests The call is wrapped by a function sendRequest() I've now to continuously (every 3sec) send the same ajax Post to the server How can I implement a Server Poll with Dojo? I basically need to call sendRequest() every 3 secs

    Read the article

  • How can i get the between cell addresses.

    - by Sathish
    I have a function which accepts fromRange and ToRange of an Excel cell. basically i want to read cell by cell values from the range. suppose if i pass E2 and E9 i want to read in a loop something like Range(E2).value, Range(E3).value and so on till E9 How can i get the between cell addresses. Please help

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Embedding Flash & Quicktime Via JavaScript

    - by thesunneversets
    I have a JavaScript function that loads a flash movie into a webpage div using swfobject.embedSWF(). I want to be able to, alternatively, load a .mov file into the same div, in the event that this is the file found instead of the .swf. Is there a close equivalent to swfobject.embedSWF for the purposes of embedding a .mov file? If not, what is an efficient route to doing this using JavaScript?

    Read the article

  • how to know when a work in a thread is complete?

    - by seinkraft
    I need to create multiple threads when a button is clicked and i've done that with this: Dim myThread As New Threading.Thread(AddressOf getFile) myThread.IsBackground = True myThread.Start() but i need to update a picture box with the downloaded file, buy if i set an event in the function getFile and raise it to notify that the files was downloaded and then update the picturebox.

    Read the article

< Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >