Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 910/1507 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • Greasemonkey is getting an empty document.body on select Google pages.

    - by Brock Adams
    Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

    Read the article

  • How to write (simple) macro?

    - by krzysz00
    I need to write a macro (with-hooks (monster method who what) &body body) for a game I'm writing. Monster is a CLOS object, method and who are strings and what is a function (#' notation). The macroexpansion would be something to the effect of (add-hook monster method who what) ,@body (remove-hook monster method who) I have absolutely no idea how to write such a macro, and I would appreciate some help.

    Read the article

  • Should a g_object_new have a matching g_object_unref?

    - by legends2k
    I'm using libnotify to show desktop notifications in my application; notify_notification_new() returns a NotifyNotification*, which should be passed as the first param to further function calls of the notification library. There is no notify_notification_free() which frees the pointer it returns. I looked up the source of notify_notification_new() and internally it does a g_object_new(), gets a GObject* and returns it as a NotfiyNotification*, so when my application does the clean up, should I call a g_object_unref() on the pointer returned by notify_notification_new()?

    Read the article

  • SqlBulkCopy with SqlHelper class

    - by Pandiya Chendur
    I've installed DataAccessApplicationBlock.msi and I got the Microsoft.ApplicationBlocks.Data.dll file into my bin folder. I found every other sqlhelper methods except ExecuteBulkCopy. How do I add ExecuteBulkCopy function to the SqlHelper class?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • PHP Force Apache error

    - by Rolf
    Hi dear stackers :P Thanks to this forum, I learnt PHP header function does not actually send header to Apache server but only to the client. What I wanna do is to generate an error 500, and let Apache displays its corresponding page. Is there a way to force it ? Thanks in advance ! (and allez les bleus !)

    Read the article

  • PHP 'Years' array

    - by J M 4
    I am trying to create an array for years which i will use in the DOB year piece of a form I am building. Currently, I know there are two ways to handle the issue but I don't really care for either: 1) Range: I know I can create a year array using the following <?php $year = range(1910,date("Y")); $_SESSION['years_arr'] = $year; ?> the problem with Point 1 is two fold: a) my function call shows the first year as 'selected' instead of "Year" as I have as option="0", and b) I want the years reversed so 2010 is the first in the least and shown decreasing. My function call is: PHP <?php function showOptionsDrop($array, $active, $echo=true){ $string = ''; foreach($array as $k => $v){ $s = ($active == $k)? ' selected="selected"' : ''; $string .= '<option value="'.$k.'"'.$s.'>'.$v.'</option>'."\n"; } if($echo) echo $string; else return $string; } ?> HTML <table> <tr> <td>State:</td> <td><select name="F1State"><option value="0">Choose a year</option><?php showOptionsDrop($_SESSION['years_arr'], null, true); ?></select> </td> </tr> </table> 2) Long Array I know i can physically create an array with years listed out but this takes up a lot of space and time if I ever want to go back and modify. ex: PHP $years = array('1900'=>"1900", '1901'=>"1901", '1902'=>"1902", '1903'=>"1903", '1904'=>"1904", '1905'=>"1905", '1906'=>"1906", '1907'=>"1907", '1908'=>"1908", '1909'=>"1909", '1910'=>"1910", '1911'=>"1911", '1912'=>"1912", '1913'=>"1913", '1914'=>"1914", '1915'=>"1915", '1916'=>"1916", '1917'=>"1917", '1918'=>"1918", '1919'=>"1919", '1920'=>"1920", '1921'=>"1921", '1922'=>"1922", '1923'=>"1923", '1924'=>"1924", '1925'=>"1925", '1926'=>"1926", '1927'=>"1927", '1928'=>"1928", '1929'=>"1929", '1930'=>"1930", '1931'=>"1931", '1932'=>"1932", '1933'=>"1933", '1934'=>"1934", '1935'=>"1935", '1936'=>"1936", '1937'=>"1937", '1938'=>"1938", '1939'=>"1939", '1940'=>"1940", '1941'=>"1941", '1942'=>"1942", '1943'=>"1943", '1944'=>"1944", '1945'=>"1945", '1946'=>"1946", '1947'=>"1947", '1948'=>"1948", '1949'=>"1949", '1950'=>"1950", '1951'=>"1951", '1952'=>"1952", '1953'=>"1953", '1954'=>"1954", '1955'=>"1955", '1956'=>"1956", '1957'=>"1957", '1958'=>"1958", '1959'=>"1959", '1960'=>"1960", '1961'=>"1961", '1962'=>"1962", '1963'=>"1963", '1964'=>"1964", '1965'=>"1965", '1966'=>"1966", '1967'=>"1967", '1968'=>"1968", '1969'=>"1969", '1970'=>"1970", '1971'=>"1971", '1972'=>"1972", '1973'=>"1973", '1974'=>"1974", '1975'=>"1975", '1976'=>"1976", '1977'=>"1977", '1978'=>"1978", '1979'=>"1979", '1980'=>"1980", '1981'=>"1981", '1982'=>"1982", '1983'=>"1983", '1984'=>"1984", '1985'=>"1985", '1986'=>"1986", '1987'=>"1987", '1988'=>"1988", '1989'=>"1989", '1990'=>"1990", '1991'=>"1991", '1992'=>"1992", '1993'=>"1993", '1994'=>"1994", '1995'=>"1995", '1996'=>"1996", '1997'=>"1997", '1998'=>"1998", '1999'=>"1999", '2000'=>"2000", '2001'=>"2001", '2002'=>"2002", '2003'=>"2003", '2004'=>"2004", '2005'=>"2005", '2006'=>"2006", '2007'=>"2007", '2008'=>"2008", '2009'=>"2009", '2010'=>"2010"); $_SESSION['years_arr'] = $years_arr; Does anybody have a recommended idea how to work - or just how to simply modify my existing code? Thank you!

    Read the article

  • Actionscript - Adding EventListener to multiple buttons on stage

    - by Chev
    I have a little problem with adding EventListener to multiple objects on stage. I have above 40 buttons on stage named "Button01","Button02" .. "Button40", and i'm looking for easiest way to add EventListener to all of them. Creating something like Button01.addEventListener(MouseEvent.CLICK, doSomething) Button02.addEventListener(MouseEvent.CLICK, doSomething) .. Button40.addEventListener(MouseEvent.Click, doSomething) (Notice the same function). isn't solution i'm looking for :(. Thanks in advice.

    Read the article

  • Multiple click events

    - by Le_Coeur
    I have some popup dialogs on my webpage, in each of this dialogs i have defined some click event with jquery : $(".links_view").click(function(e){ //code }); But the problem is when i activate one this click event, it will be executed in each dialog...

    Read the article

  • Write a few things to a session in cakephp

    - by kwokwai
    Hi all, I am learning Session function in CakePhp, and see some examples like this on cakePHP cookBook web site: For example: write($mysession1, 'testing') I am not sure if a session can only hold up a particular thing in it. Is it possible to write an array to a session like: mysession[0] = 'Testing0'; mysession[1] = 'Testing1'; mysession[2] = 'Testing2';

    Read the article

  • stop execution of process for miliseconds.

    - by Viral
    hi friends, I m creating a Tic tac toe game, in that after click made by user automatically the cpu will respond. I want the cpu response after 0.50 seconds, the sleep() function takes too many time, i don't want that much time, is there any other way to do so???

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • jQuery Validation Custom Message Before Listing Errors

    - by Michael
    I am looking to add a custom message before listing my errors for a login page: "Oops, you forgot to enter the following:" + "Username", "Password" (if both not entered) or "Oops, you forgot to enter the following:" + "Username" (if just username not entered) $(document).ready(function(){ $("#loginForm").validate({ errorLabelContainer: $('#RegisterErrors'), messages: { username: "Username", password: "Password" } }); }); With this in my HTML <div id="RegisterErrors">

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • Javascript button

    - by Deven
    hello friends i am developing button which generate another button and this button also calls function in which its id is passed as argument but i am getting error that id is undifined even i set its id attribute before it is added to ma web page

    Read the article

  • Javascript Cookie

    - by Ajith
    How can i create a cookie by using javascript just for end of the browser session(ie,upto closing of current browser).My script is like follows; function setCookie(c_name,c_value,c_expiredays) { var exdate=new Date(); exdate.setDate(exdate.getDate()+c_expiredays); document.cookie=c_name+ "=" +escape(c_value)+ ((c_expiredays==null) ? "" : ";expires="+exdate.toGMTString()); } setCookie('gs_cookie','firstme',1600000);` How much value i need to pass instead of 1600000. Please help....

    Read the article

  • Problem with PHP/Java bridge.

    - by Jack
    I am using Tomcat 6. I am running a php script using the JavaBridge. I get the following error when I run my code. Fatal error: Call to undefined function mysqli_connect() in C:\Program Files\apache-tomcat-6.0.26\webapps\JavaBridge\xxxx\xxxxx.php on line 534 Please help.

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >