Search Results

Search found 15637 results on 626 pages for 'memory efficient'.

Page 92/626 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do I get C# to garbage collect aggressively?

    - by mmr
    I have an application that is used in image processing, and I find myself typically allocating arrays in the 4000x4000 ushort size, as well as the occasional float and the like. Currently, the .NET framework tends to crash in this app apparently randomly, almost always with an out of memory error. 32mb is not a huge declaration, but if .NET is fragmenting memory, then it's very possible that such large continuous allocations aren't behaving as expected. Is there a way to tell the garbage collector to be more aggressive, or to defrag memory (if that's the problem)? I realize that there's the GC.Collect and GC.WaitForPendingFinalizers calls, and I've sprinkled them pretty liberally through my code, but I'm still getting the errors. It may be because I'm calling dll routines that use native code a lot, but I'm not sure. I've gone over that C++ code, and make sure that any memory I declare I delete, but still I get these C# crashes, so I'm pretty sure it's not there. I wonder if the C++ calls could be interfering with the GC, making it leave behind memory because it once interacted with a native call-- is that possible? If so, can I turn that functionality off?

    Read the article

  • Freeing ImageData when deleting a Canvas

    - by user578770
    I'm writing a XUL application using HTML Canvas to display Bitmap images. I'm generating ImageDatas and imporingt them in a canvas using the putImageData function : for(var pageIndex=0;pageIndex<100;pageIndex++){ this.img = imageDatas[pageIndex]; /* Create the Canvas element */ var imgCanvasTmp = document.createElementNS("http://www.w3.org/1999/xhtml",'html:canvas'); imgCanvasTmp.setAttribute('width', this.img.width); imgCanvasTmp.setAttribute('height', this.img.height); /* Import the image into the Canvas */ imgCanvasTmp.getContext('2d').putImageData(this.img, 0, 0); /* Use the Canvas into another part of the program (Commented out for testing) */ // this.displayCanvas(imgCanvasTmp,pageIndex); } The images are well imported but there seems to be a memory leak due to the putImageData function. When exiting the "for" loop, I would expect the memory allocated for the Canvas to be freed but, by executing the code without executing putImageData, I noticed that my program at the end use 100Mb less (my images are quite big). I came to the conclusion that the putImageData function prevent the garbage collector to free the allocated memory. Do you have any idea how I could force the garbage collector to free the memory? Is there any way to empty the Canvas? I already tried to delete the canvas using the delete operator or to use the clearRect function but it did nothing. I also tried to reuse the same canvas to display the image at each iteration but the amount of memory used did not changed, as if the image where imported without deleting the existing ones...

    Read the article

  • ViewController doesn't get released

    - by ObjectiveFlash
    Every time I turn the page in my app, I am removing and releasing the previous viewController - but for some reason it is still in memory. I know this, because after using the app for a while, I get 47 memory warnings - one from each view controller - if I had opened 47 pages before the memory warning occurred. I get 60 memory warnings if I had opened 60 pages before the memory warning occurred. And so on... This is the code that runs from page to page: UIViewController *nextController; Class nextClass = [pageClasses objectAtIndex:(currentPageIndex - 1)]; nextController = [[nextClass alloc] initWithNibName:[pageNibs objectAtIndex:(currentPageIndex - 1)] bundle:nil]; [nextController performSelector:@selector(setDelegate:) withObject:self]; [currentPageController.view removeFromSuperview]; [self.view addSubview:nextController.view]; [currentPageController release]; currentPageController = nextController; [currentPageController retain]; [nextController release]; Can anybody point to any issues they see? Thanks so much!

    Read the article

  • Help, I need to debug my BrowserHelperObject (BHO) (in C++) after a internet explorer 8 crash in Rel

    - by BHOdevelopper
    Hi, here is the situation, i'm developping a Browser Helper Object (BHO) in C++ with Visual Studio 2008, and i learned that the memory wasn't managed the same way in Debug mode than in Release mode. So when i run my BHO in debug mode, internet explorer 8 works just fine and i got no erros at all, the browser stays alive forever, but as soon as i compile it in release mode, i got no errors, no message, nothing, but after 5 minutes i can see through the task manager that internet explorer instances are just eating memory and then the browser just stop responding every time. Please, I really need some hint on how to get a feedback on what could be the error. I heard that, often it was happening because of memory mismanagement. I need a software that just grab a memory dump or something when iexplorer crashes to help me find the problem. Any help is appreciated, I'll be looking for responses every single days, thank you.

    Read the article

  • Windows Server 2008 Alerting to Low memory

    - by t1nt1n
    I have a file and print server running on Windows 2008 R2 fully patched in a VSphere environment (ESXi 5.1 fully updated). Every evening between 19:20 and 19:30 our monitoring software reported that the available memory is 1% and performance is dire. There is nothing in the event logs to point to an issue. At this point in the evening I am general the only user on the system to check to see why these alerts are going off. Things I have done; Checked to see if any backups are running – None at all. Checked Scheduled tasks – None before or during this time period. Moved the VM to another host. AV is disabled to rule out that as the issue. The server does not have any problems during the day with memory when fully loaded with about 50 users. The server did have 4GB ram provisioned but I have increased this to 5Gb. Running PrefMon at the time (I will save the graphs tonight) There very little CPU usage at the time but RAM usage goes up.

    Read the article

  • Large memory chunk not garbage collected

    - by Niels
    In a hunt for a memory-leak in my app I chased down a behaviour I can't understand. I allocate a large memory block, but it doesn't get garbage-collected resulting in a OOM, unless I explicit null the reference in onDestroy. In this example I have two almost identical activities that switch between each others. Both have a single button. On pressing the button MainActivity starts OOMActivity and OOMActivity returns by calling finish(). After pressing the buttons a few times, Android throws a OOMException. If i add the the onDestroy to OOMActivity and explicit null the reference to the memory chunk, I can see in the log that the memory is correctly freed. Why doesn't the memory get freed automatically without the nulling? MainActivity: package com.example.oom; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class MainActivity extends Activity implements OnClickListener { private int buttonId; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); System.gc(); Button OOMButton = new Button(this); OOMButton.setText("OOM"); buttonId = OOMButton.getId(); setContentView(OOMButton); OOMButton.setOnClickListener(this); } @Override public void onClick(View v) { if (v.getId() == buttonId) { Intent leakIntent = new Intent(this, OOMActivity.class); startActivity(leakIntent); } } } OOMActivity: public class OOMActivity extends Activity implements OnClickListener { private static final int WASTE_SIZE = 20000000; private byte[] waste; private int buttonId; protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); Button BackButton = new Button(this); BackButton.setText("Back"); buttonId = BackButton.getId(); setContentView(BackButton); BackButton.setOnClickListener(this); waste = new byte[WASTE_SIZE]; } public void onClick(View view) { if (view.getId() == buttonId) { finish(); } } }

    Read the article

  • Threading heap and stack

    - by DJ
    How memory is allocated in case of spawning a new thread, i.e how memory heap, memory stack, and threads are related? I know this is fundamental (.net framework concept) but somehow I am not much aware of this concept.

    Read the article

  • Disk Drive not working

    - by user287681
    The CD/DVD drive on my sisters' (I'm helping her shift from Win. XP (now officially deprecated by Microsoft) to Ubuntu) system. Now, it may end up being a failed attempt, all together (Almost the whole last year (when she's been on XP) the disk drive hasn't (not even powering on) been working.), I just want to make sure I've explored every remote possibility. Because I figure, "Huh, now that I've got Ubuntu running, instead of XP, that (just) might make a difference.". I have tried using the sudo lshw command in the terminal, to (seemingly) no avil, but, who knows, you might be able to make something out of it. Here's the output: kyra@kyra-Satellite-P105:~$ sudo lshw [sudo] password for kyra: kyra-satellite-p105 description: Notebook product: Satellite P105 () vendor: TOSHIBA version: PSPA0U-0TN01M serial: 96084354W width: 64 bits capabilities: smbios-2.4 dmi-2.4 vsyscall32 configuration: administrator_password=disabled boot=oem-specific chassis=notebook frontpanel_password=unknown keyboard_password=unknown power-on_password=disabled uuid=00900559-F88E-D811-82E0-00163680E992 *-core description: Motherboard product: Satellite P105 vendor: TOSHIBA physical id: 0 version: Not Applicable serial: 1234567890 *-firmware description: BIOS vendor: TOSHIBA physical id: 0 version: V4.70 date: 01/19/20092 size: 92KiB capabilities: isa pci pcmcia pnp upgrade shadowing escd cdboot acpi usb biosbootspecification *-cpu description: CPU product: Intel(R) Core(TM)2 CPU T5500 @ 1.66GHz vendor: Intel Corp. physical id: 4 bus info: cpu@0 version: Intel(R) Core(TM)2 CPU T5 slot: U2E1 size: 1667MHz capacity: 1667MHz width: 64 bits clock: 166MHz capabilities: fpu fpu_exception wp vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe syscall nx x86-64 constant_tsc arch_perfmon pebs bts rep_good nopl aperfmperf pni dtes64 monitor ds_cpl est tm2 ssse3 cx16 xtpr pdcm lahf_lm dtherm cpufreq *-cache:0 description: L1 cache physical id: 5 slot: L1 Cache size: 16KiB capacity: 16KiB capabilities: asynchronous internal write-back *-cache:1 description: L2 cache physical id: 6 slot: L2 Cache size: 2MiB capabilities: burst external write-back *-memory description: System Memory physical id: c slot: System board or motherboard size: 2GiB capacity: 3GiB *-bank:0 description: SODIMM DDR2 Synchronous physical id: 0 slot: M1 size: 1GiB width: 64 bits *-bank:1 description: SODIMM DDR2 Synchronous physical id: 1 slot: M2 size: 1GiB width: 64 bits *-pci description: Host bridge product: Mobile 945GM/PM/GMS, 943/940GML and 945GT Express Memory Controller Hub vendor: Intel Corporation physical id: 100 bus info: pci@0000:00:00.0 version: 03 width: 32 bits clock: 33MHz configuration: driver=agpgart-intel resources: irq:0 *-display:0 description: VGA compatible controller product: Mobile 945GM/GMS, 943/940GML Express Integrated Graphics Controller vendor: Intel Corporation physical id: 2 bus info: pci@0000:00:02.0 version: 03 width: 32 bits clock: 33MHz capabilities: msi pm vga_controller bus_master cap_list rom configuration: driver=i915 latency=0 resources: irq:16 memory:d0200000-d027ffff ioport:1800(size=8) memory:c0000000-cfffffff memory:d0300000-d033ffff *-display:1 UNCLAIMED description: Display controller product: Mobile 945GM/GMS/GME, 943/940GML Express Integrated Graphics Controller vendor: Intel Corporation physical id: 2.1 bus info: pci@0000:00:02.1 version: 03 width: 32 bits clock: 33MHz capabilities: pm bus_master cap_list configuration: latency=0 resources: memory:d0280000-d02fffff *-multimedia description: Audio device product: NM10/ICH7 Family High Definition Audio Controller vendor: Intel Corporation physical id: 1b bus info: pci@0000:00:1b.0 version: 02 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: driver=snd_hda_intel latency=0 resources: irq:44 memory:d0340000-d0343fff *-pci:0 description: PCI bridge product: NM10/ICH7 Family PCI Express Port 1 vendor: Intel Corporation physical id: 1c bus info: pci@0000:00:1c.0 version: 02 width: 32 bits clock: 33MHz capabilities: pci pciexpress msi pm normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:40 ioport:3000(size=4096) memory:84000000-841fffff ioport:84200000(size=2097152) *-pci:1 description: PCI bridge product: NM10/ICH7 Family PCI Express Port 2 vendor: Intel Corporation physical id: 1c.1 bus info: pci@0000:00:1c.1 version: 02 width: 32 bits clock: 33MHz capabilities: pci pciexpress msi pm normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:41 ioport:4000(size=4096) memory:84400000-846fffff ioport:84700000(size=2097152) *-network description: Wireless interface product: PRO/Wireless 3945ABG [Golan] Network Connection vendor: Intel Corporation physical id: 0 bus info: pci@0000:03:00.0 logical name: wlan0 version: 02 serial: 00:13:02:d6:d2:35 width: 32 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list ethernet physical wireless configuration: broadcast=yes driver=iwl3945 driverversion=3.13.0-29-generic firmware=15.32.2.9 ip=10.110.20.157 latency=0 link=yes multicast=yes wireless=IEEE 802.11abg resources: irq:43 memory:84400000-84400fff *-pci:2 description: PCI bridge product: NM10/ICH7 Family PCI Express Port 3 vendor: Intel Corporation physical id: 1c.2 bus info: pci@0000:00:1c.2 version: 02 width: 32 bits clock: 33MHz capabilities: pci pciexpress msi pm normal_decode bus_master cap_list configuration: driver=pcieport resources: irq:42 ioport:5000(size=4096) memory:84900000-84afffff ioport:84b00000(size=2097152) *-usb:0 description: USB controller product: NM10/ICH7 Family USB UHCI Controller #1 vendor: Intel Corporation physical id: 1d bus info: pci@0000:00:1d.0 version: 02 width: 32 bits clock: 33MHz capabilities: uhci bus_master configuration: driver=uhci_hcd latency=0 resources: irq:23 ioport:1820(size=32) *-usb:1 description: USB controller product: NM10/ICH7 Family USB UHCI Controller #2 vendor: Intel Corporation physical id: 1d.1 bus info: pci@0000:00:1d.1 version: 02 width: 32 bits clock: 33MHz capabilities: uhci bus_master configuration: driver=uhci_hcd latency=0 resources: irq:19 ioport:1840(size=32) *-usb:2 description: USB controller product: NM10/ICH7 Family USB UHCI Controller #3 vendor: Intel Corporation physical id: 1d.2 bus info: pci@0000:00:1d.2 version: 02 width: 32 bits clock: 33MHz capabilities: uhci bus_master configuration: driver=uhci_hcd latency=0 resources: irq:18 ioport:1860(size=32) *-usb:3 description: USB controller product: NM10/ICH7 Family USB UHCI Controller #4 vendor: Intel Corporation physical id: 1d.3 bus info: pci@0000:00:1d.3 version: 02 width: 32 bits clock: 33MHz capabilities: uhci bus_master configuration: driver=uhci_hcd latency=0 resources: irq:16 ioport:1880(size=32) *-usb:4 description: USB controller product: NM10/ICH7 Family USB2 EHCI Controller vendor: Intel Corporation physical id: 1d.7 bus info: pci@0000:00:1d.7 version: 02 width: 32 bits clock: 33MHz capabilities: pm debug ehci bus_master cap_list configuration: driver=ehci-pci latency=0 resources: irq:23 memory:d0544000-d05443ff *-pci:3 description: PCI bridge product: 82801 Mobile PCI Bridge vendor: Intel Corporation physical id: 1e bus info: pci@0000:00:1e.0 version: e2 width: 32 bits clock: 33MHz capabilities: pci subtractive_decode bus_master cap_list resources: ioport:2000(size=4096) memory:d0000000-d00fffff ioport:80000000(size=67108864) *-pcmcia description: CardBus bridge product: PCIxx12 Cardbus Controller vendor: Texas Instruments physical id: 4 bus info: pci@0000:0a:04.0 version: 00 width: 32 bits clock: 33MHz capabilities: pcmcia bus_master cap_list configuration: driver=yenta_cardbus latency=176 maxlatency=5 mingnt=192 resources: irq:17 memory:d0004000-d0004fff ioport:2400(size=256) ioport:2800(size=256) memory:80000000-83ffffff memory:88000000-8bffffff *-firewire description: FireWire (IEEE 1394) product: PCIxx12 OHCI Compliant IEEE 1394 Host Controller vendor: Texas Instruments physical id: 4.1 bus info: pci@0000:0a:04.1 version: 00 width: 32 bits clock: 33MHz capabilities: pm ohci bus_master cap_list configuration: driver=firewire_ohci latency=64 maxlatency=4 mingnt=3 resources: irq:17 memory:d0007000-d00077ff memory:d0000000-d0003fff *-storage description: Mass storage controller product: 5-in-1 Multimedia Card Reader (SD/MMC/MS/MS PRO/xD) vendor: Texas Instruments physical id: 4.2 bus info: pci@0000:0a:04.2 version: 00 width: 32 bits clock: 33MHz capabilities: storage pm bus_master cap_list configuration: driver=tifm_7xx1 latency=64 maxlatency=4 mingnt=7 resources: irq:17 memory:d0005000-d0005fff *-generic description: SD Host controller product: PCIxx12 SDA Standard Compliant SD Host Controller vendor: Texas Instruments physical id: 4.3 bus info: pci@0000:0a:04.3 version: 00 width: 32 bits clock: 33MHz capabilities: pm bus_master cap_list configuration: driver=sdhci-pci latency=64 maxlatency=4 mingnt=7 resources: irq:17 memory:d0007800-d00078ff *-network description: Ethernet interface product: PRO/100 VE Network Connection vendor: Intel Corporation physical id: 8 bus info: pci@0000:0a:08.0 logical name: eth0 version: 02 serial: 00:16:36:80:e9:92 size: 10Mbit/s capacity: 100Mbit/s width: 32 bits clock: 33MHz capabilities: pm bus_master cap_list ethernet physical tp mii 10bt 10bt-fd 100bt 100bt-fd autonegotiation configuration: autonegotiation=on broadcast=yes driver=e100 driverversion=3.5.24-k2-NAPI duplex=half latency=64 link=no maxlatency=56 mingnt=8 multicast=yes port=MII speed=10Mbit/s resources: irq:20 memory:d0006000-d0006fff ioport:2000(size=64) *-isa description: ISA bridge product: 82801GBM (ICH7-M) LPC Interface Bridge vendor: Intel Corporation physical id: 1f bus info: pci@0000:00:1f.0 version: 02 width: 32 bits clock: 33MHz capabilities: isa bus_master cap_list configuration: driver=lpc_ich latency=0 resources: irq:0 *-ide description: IDE interface product: 82801GBM/GHM (ICH7-M Family) SATA Controller [IDE mode] vendor: Intel Corporation physical id: 1f.2 bus info: pci@0000:00:1f.2 version: 02 width: 32 bits clock: 66MHz capabilities: ide pm bus_master cap_list configuration: driver=ata_piix latency=0 resources: irq:19 ioport:1f0(size=8) ioport:3f6 ioport:170(size=8) ioport:376 ioport:18b0(size=16) *-serial UNCLAIMED description: SMBus product: NM10/ICH7 Family SMBus Controller vendor: Intel Corporation physical id: 1f.3 bus info: pci@0000:00:1f.3 version: 02 width: 32 bits clock: 33MHz configuration: latency=0 resources: ioport:18c0(size=32) *-scsi physical id: 1 logical name: scsi0 capabilities: emulated *-disk description: ATA Disk product: ST9250421AS vendor: Seagate physical id: 0.0.0 bus info: scsi@0:0.0.0 logical name: /dev/sda version: SD13 serial: 5TH0B2HB size: 232GiB (250GB) capabilities: partitioned partitioned:dos configuration: ansiversion=5 sectorsize=512 signature=000d7fd5 *-volume:0 description: EXT4 volume vendor: Linux physical id: 1 bus info: scsi@0:0.0.0,1 logical name: /dev/sda1 logical name: / version: 1.0 serial: 13bb4bdd-8cc9-40e2-a490-dbe436c2a02d size: 230GiB capacity: 230GiB capabilities: primary bootable journaled extended_attributes large_files huge_files dir_nlink recover extents ext4 ext2 initialized configuration: created=2014-06-01 17:37:01 filesystem=ext4 lastmountpoint=/ modified=2014-06-01 21:15:21 mount.fstype=ext4 mount.options=rw,relatime,errors=remount-ro,data=ordered mounted=2014-06-01 21:15:21 state=mounted *-volume:1 description: Extended partition physical id: 2 bus info: scsi@0:0.0.0,2 logical name: /dev/sda2 size: 2037MiB capacity: 2037MiB capabilities: primary extended partitioned partitioned:extended *-logicalvolume description: Linux swap / Solaris partition physical id: 5 logical name: /dev/sda5 capacity: 2037MiB capabilities: nofs *-remoteaccess UNCLAIMED vendor: Intel physical id: 1 capabilities: inbound kyra@kyra-Satellite-P105:~$

    Read the article

  • Writing an optimised and efficient search engine with mySQL and ColdFusion

    - by Mel
    I have a search page with the following scenarios listed below. I was told there was a better way to do it, but not how, and that I am using too many if statements, and that it's prone to causing an error through url manipulation: Search.cfm will processes a search made from a search bar present on all pages, with one search input (titleName). If search.cfm is accessed manually (through URL not through using the simple search bar on all pages) it displays an advanced search form with three inputs (titleName, genreID, platformID) or it evaluates searchResponse variable and decides what to do. If simple search query is blank, has no results, or less than 3 characters it displays an error If advanced search query is blank, has no results, or less than 3 characters it displays an error If any successful search returns results, they come back normally. The top-of-page logic is as follows: <!---SET DEFAULT VARIABLE---> <cfparam name="variables.searchResponse" default=""> <!---CHECK TO SEE IF SIMPLE SEARCH A FORM WAS SUBMITTED AND EXECUTE SEARCH IF IT WAS---> <cfif IsDefined("Form.simpleSearch") AND Len(Trim(Form.titleName)) LTE 2> <cfset variables.searchResponse = "invalidString"> <cfelseif IsDefined("Form.simpleSearch") AND Len(Trim(Form.titleName)) GTE 3> <!---EXECUTE METHOD AND GET DATA---> <cfinvoke component="myComponent" method="simpleSearch" searchString="#Form.titleName#" returnvariable="simpleSearchResult"> <cfset variables.searchResponse = "simpleSearchResult"> </cfif> <!---CHECK IF ANY RECORDS WERE FOUND---> <cfif IsDefined("variables.simpleSearchResult") AND simpleSearchResult.RecordCount IS 0> <cfset variables.searchResponse = "noResult"> </cfif> <!---CHECK IF ADVANCED SEARCH FORM WAS SUBMITTED---> <cfif IsDefined("Form.AdvancedSearch") AND Len(Trim(Form.titleName)) LTE 2> <cfset variables.searchResponse = "invalidString"> <cfelseif IsDefined("Form.advancedSearch") AND Len(Trim(Form.titleName)) GTE 2> <!---EXECUTE METHOD AND GET DATA---> <cfinvoke component="myComponent" method="advancedSearch" returnvariable="advancedSearchResult" titleName="#Form.titleName#" genreID="#Form.genreID#" platformID="#Form.platformID#"> <cfset variables.searchResponse = "advancedSearchResult"> </cfif> <!---CHECK IF ANY RECORDS WERE FOUND---> <cfif IsDefined("variables.advancedSearchResult") AND advancedSearchResult.RecordCount IS 0> <cfset variables.searchResponse = "noResult"> </cfif> I'm using the searchResponse variable to decide what the the page displays, based on the following scenarios: <!---ALWAYS DISPLAY SIMPLE SEARCH BAR AS IT'S PART OF THE HEADER---> <form name="simpleSearch" action="search.cfm" method="post"> <input type="hidden" name="simpleSearch" /> <input type="text" name="titleName" /> <input type="button" value="Search" onclick="form.submit()" /> </form> <!---IF NO SEARCH WAS SUBMITTED DISPLAY DEFAULT FORM---> <cfif searchResponse IS ""> <h1>Advanced Search</h1> <!---DISPLAY FORM---> <form name="advancedSearch" action="search.cfm" method="post"> <input type="hidden" name="advancedSearch" /> <input type="text" name="titleName" /> <input type="text" name="genreID" /> <input type="text" name="platformID" /> <input type="button" value="Search" onclick="form.submit()" /> </form> </cfif> <!---IF SEARCH IS BLANK OR LESS THAN 3 CHARACTERS DISPLAY ERROR MESSAGE---> <cfif searchResponse IS "invalidString"> <cfoutput> <h1>INVALID SEARCH</h1> </cfoutput> </cfif> <!---IF SEARCH WAS MADE BUT NO RESULTS WERE FOUND---> <cfif searchResponse IS "noResult"> <cfoutput> <h1>NO RESULT FOUND</h1> </cfoutput> </cfif> <!---IF SIMPLE SEARCH WAS MADE A RESULT WAS FOUND---> <cfif searchResponse IS "simpleSearchResult"> <cfoutput> <h1>Search Results</h1> </cfoutput> <cfoutput query="simpleSearchResult"> <!---DISPLAY QUERY DATA---> </cfoutput> </cfif> <!---IF ADVANCED SEARCH WAS MADE A RESULT WAS FOUND---> <cfif searchResponse IS "advancedSearchResult"> <cfoutput> <h1>Search Results</h1> <p>Your search for "#Form.titleName#" returned #advancedSearchResult.RecordCount# result(s).</p> </cfoutput> <cfoutput query="advancedSearchResult"> <!---DISPLAY QUERY DATA---> </cfoutput> </cfif> Is my logic a) not efficient because my if statements/is there a better way to do this? And b) Can you see any scenarios where my code can break? I've tested it but I have not been able to find any issues with it. And I have no way of measuring performance. Any thoughts and ideas would be greatly appreciated. Many thanks

    Read the article

  • Efficient representation of Hierarchies in Hibernate.

    - by Alison G
    I'm having some trouble representing an object hierarchy in Hibernate. I've searched around, and haven't managed to find any examples doing this or similar - you have my apologies if this is a common question. I have two types which I'd like to persist using Hibernate: Groups and Items. * Groups are identified uniquely by a combination of their name and their parent. * The groups are arranged in a number of trees, such that every Group has zero or one parent Group. * Each Item can be a member of zero or more Groups. Ideally, I'd like a bi-directional relationship allowing me to get: * all Groups that an Item is a member of * all Items that are a member of a particular Group or its descendants. I also need to be able to traverse the Group tree from the top in order to display it on the UI. The basic object structure would ideally look like this: class Group { ... /** @return all items in this group and its descendants */ Set<Item> getAllItems() { ... } /** @return all direct children of this group */ Set<Group> getChildren() { ... } ... } class Item { ... /** @return all groups that this Item is a direct member of */ Set<Group> getGroups() { ... } ... } Originally, I had just made a simple bi-directional many-to-many relationship between Items and Groups, such that fetching all items in a group hierarchy required recursion down the tree, and fetching groups for an Item was a simple getter, i.e.: class Group { ... private Set<Item> items; private Set<Group> children; ... /** @return all items in this group and its descendants */ Set<Item> getAllItems() { Set<Item> allItems = new HashSet<Item>(); allItems.addAll(this.items); for(Group child : this.getChildren()) { allItems.addAll(child.getAllItems()); } return allItems; } /** @return all direct children of this group */ Set<Group> getChildren() { return this.children; } ... } class Item { ... private Set<Group> groups; /** @return all groups that this Item is a direct member of */ Set<Group> getGroups() { return this.groups; } ... } However, this resulted in multiple database requests to fetch the Items in a Group with many descendants, or for retrieving the entire Group tree to display in the UI. This seems very inefficient, especially with deeper, larger group trees. Is there a better or standard way of representing this relationship in Hibernate? Am I doing anything obviously wrong or stupid? My only other thought so far was this: Replace the group's id, parent and name fields with a unique "path" String which specifies the whole ancestry of a group, e.g.: /rootGroup /rootGroup/aChild /rootGroup/aChild/aGrandChild The join table between Groups and Items would then contain group_path and item_id. This immediately solves the two issues I was suffering previously: 1. The entire group hierarchy can be fetched from the database in a single query and reconstructed in-memory. 2. To retrieve all Items in a group or its descendants, we can select from group_item where group_path='N' or group_path like 'N/%' However, this seems to defeat the point of using Hibernate. All thoughts welcome!

    Read the article

  • Using the Onboard VGA output with a PCIe video card. Both nVidia

    - by sebikul
    I have 2 video cards, one On board, a nVidia 6150SE nForce 430 and a PCIe nVidia GeForce GT 220 1GB DDR2 RAM I have already configured the PCIe card to use the dual monitor feature, using the VGA and HDMI ports, but now I want to add a third monitor, using the On board VGA port I have managed to enable the On board graphics processor, which is taking 400MB of ram, but I cant manage to use it, nvidia-settings does not detect it, like it's not usable (but is there) My questions are the following: How can I manage to get the On board VGA display to work together with the PCIe graphics card? If possible, how can I recover those 400 MB the on board card is taking (even without being used) or how can I get it to use the PCIe card available memory? System Details: Linux 2.6.35-28-generic i686 Ubuntu 10.10 (All updates installed) NVIDIA Driver Version: 260.19.06 (Official) If more info is needed please let me know. Here is the lspci output when the On board card is disabled: 00:00.0 RAM memory: nVidia Corporation MCP61 Memory Controller (rev a1) 00:01.0 ISA bridge: nVidia Corporation MCP61 LPC Bridge (rev a2) 00:01.1 SMBus: nVidia Corporation MCP61 SMBus (rev a2) 00:01.2 RAM memory: nVidia Corporation MCP61 Memory Controller (rev a2) 00:01.3 Co-processor: nVidia Corporation MCP61 SMU (rev a2) 00:02.0 USB Controller: nVidia Corporation MCP61 USB Controller (rev a3) 00:02.1 USB Controller: nVidia Corporation MCP61 USB Controller (rev a3) 00:04.0 PCI bridge: nVidia Corporation MCP61 PCI bridge (rev a1) 00:05.0 Audio device: nVidia Corporation MCP61 High Definition Audio (rev a2) 00:06.0 IDE interface: nVidia Corporation MCP61 IDE (rev a2) 00:07.0 Bridge: nVidia Corporation MCP61 Ethernet (rev a2) 00:08.0 IDE interface: nVidia Corporation MCP61 SATA Controller (rev a2) 00:09.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0b.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0c.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0d.0 VGA compatible controller: nVidia Corporation C61 [GeForce 6150SE nForce 430] (rev a2) 00:18.0 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] HyperTransport Technology Configuration 00:18.1 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] Address Map 00:18.2 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] DRAM Controller 00:18.3 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] Miscellaneous Control 01:09.0 Ethernet controller: Intel Corporation 82557/8/9/0/1 Ethernet Pro 100 (rev 08) 02:00.0 VGA compatible controller: nVidia Corporation GT216 [GeForce GT 220] (rev a2) 02:00.1 Audio device: nVidia Corporation High Definition Audio Controller (rev a1) And this is when both are enabled: 00:00.0 RAM memory: nVidia Corporation MCP61 Memory Controller (rev a1) 00:01.0 ISA bridge: nVidia Corporation MCP61 LPC Bridge (rev a2) 00:01.1 SMBus: nVidia Corporation MCP61 SMBus (rev a2) 00:01.2 RAM memory: nVidia Corporation MCP61 Memory Controller (rev a2) 00:01.3 Co-processor: nVidia Corporation MCP61 SMU (rev a2) 00:02.0 USB Controller: nVidia Corporation MCP61 USB Controller (rev a3) 00:02.1 USB Controller: nVidia Corporation MCP61 USB Controller (rev a3) 00:04.0 PCI bridge: nVidia Corporation MCP61 PCI bridge (rev a1) 00:05.0 Audio device: nVidia Corporation MCP61 High Definition Audio (rev a2) 00:06.0 IDE interface: nVidia Corporation MCP61 IDE (rev a2) 00:07.0 Bridge: nVidia Corporation MCP61 Ethernet (rev a2) 00:08.0 IDE interface: nVidia Corporation MCP61 SATA Controller (rev a2) 00:09.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0b.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0c.0 PCI bridge: nVidia Corporation MCP61 PCI Express bridge (rev a2) 00:0d.0 VGA compatible controller: nVidia Corporation C61 [GeForce 6150SE nForce 430] (rev a2) 00:18.0 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] HyperTransport Technology Configuration 00:18.1 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] Address Map 00:18.2 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] DRAM Controller 00:18.3 Host bridge: Advanced Micro Devices [AMD] K8 [Athlon64/Opteron] Miscellaneous Control 01:09.0 Ethernet controller: Intel Corporation 82557/8/9/0/1 Ethernet Pro 100 (rev 08) 02:00.0 VGA compatible controller: nVidia Corporation GT216 [GeForce GT 220] (rev a2) 02:00.1 Audio device: nVidia Corporation High Definition Audio Controller (rev a1) Output of lshw -class display: *-display description: VGA compatible controller product: GT216 [GeForce GT 220] vendor: nVidia Corporation physical id: 0 bus info: pci@0000:02:00.0 version: a2 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress vga_controller bus_master cap_list rom configuration: driver=nvidia latency=0 resources: irq:18 memory:df000000-dfffffff memory:c0000000-cfffffff memory:da000000-dbffffff ioport:ef80(size=128) memory:def80000-deffffff *-display description: VGA compatible controller product: C61 [GeForce 6150SE nForce 430] vendor: nVidia Corporation physical id: d bus info: pci@0000:00:0d.0 version: a2 width: 64 bits clock: 66MHz capabilities: pm msi vga_controller bus_master cap_list rom configuration: driver=nvidia latency=0 resources: irq:22 memory:dd000000-ddffffff memory:b0000000-bfffffff memory:dc000000-dcffffff memory:deb40000-deb5ffff If what I'm looking for is not possible, please tell me, so I can disable the On board card and recover those 400MB of wasted RAM Thanks for your help!

    Read the article

  • WPF WriteableBitmap Memory Leak?

    - by Mario
    Hello, everyone! I'm trying to figure out how to release a WriteableBitmap memory. In the next section of code I fill the backbuffer of a WriteableBitmap with a really large amount of data from "BigImage" (3600 * 4800 px, just for testing) If I comment the lines where bitmap and image are equaled to null, the memory it´s not release and the application consumes ~230 MB, even when Image and bitmap are no longer used! As you can see at the end of the code its necessary to call GC.Collect() to release the memory. So the question is, what is the right way to free the memory used by a WriteableBitmap object? Is GC.Collect() the only way? Any help would be great. PS. Sorry for my bad english. private void buttonTest_Click(object sender, RoutedEventArgs e) { Image image = new Image(); image.Source = new BitmapImage(new Uri("BigImage")); WriteableBitmap bitmap = new WriteableBitmap( (BitmapSource)image.Source); bitmap.Lock(); // Bitmap processing bitmap.Unlock(); image = null; bitmap = null; GC.Collect(); }

    Read the article

  • Rails.cache throws "marshal dump" error when changed from memory store to memcached store

    - by gsmendoza
    If I set this in my environment config.action_controller.cache_store = :mem_cache_store ActionController::Base.cache_store will use a memcached store but Rails.cache will use a memory store instead: $ ./script/console >> ActionController::Base.cache_store => #<ActiveSupport::Cache::MemCacheStore:0xb6eb4bbc @data=<MemCache: 1 servers, ns: nil, ro: false>> >> Rails.cache => #<ActiveSupport::Cache::MemoryStore:0xb78b5e54 @data={}> In my app, I use Rails.cache.fetch(key){ object } to cache objects inside my helpers. All this time, I assumed that Rails.cache uses the memcached store so I'm surprised that it uses memory store. If I change the cache_store setting in my environment to config.cache_store = :mem_cache_store both ActionController::Base.cache_store and Rails.cache will now use the same memory store, which is what I expect: $ ./script/console >> ActionController::Base.cache_store => #<ActiveSupport::Cache::MemCacheStore:0xb7b8e928 @data=<MemCache: 1 servers, ns: nil, ro: false>, @middleware=#<Class:0xb7b73d44>, @thread_local_key=:active_support_cache_mem_cache_store_local_cache> >> Rails.cache => #<ActiveSupport::Cache::MemCacheStore:0xb7b8e928 @data=<MemCache: 1 servers, ns: nil, ro: false>, @middleware=#<Class:0xb7b73d44>, @thread_local_key=:active_support_cache_mem_cache_store_local_cache> However, when I run the app, I get a "marshal dump" error in the line where I call Rails.cache.fetch(key){ object } no marshal_dump is defined for class Proc Extracted source (around line #1): 1: Rails.cache.fetch(fragment_cache_key(...), :expires_in => 15.minutes) { ... } vendor/gems/memcache-client-1.8.1/lib/memcache.rb:359:in 'dump' vendor/gems/memcache-client-1.8.1/lib/memcache.rb:359:in 'set_without_newrelic_trace' What gives? Is Rails.cache meant to be a memory store? Should I call controller.cache_store.fetch in the places where I call Rails.cache.fetch?

    Read the article

  • problem disposing class in Dictionary it is Still in the heap memory although using GC.Collect

    - by Bahgat Mashaly
    Hello i have a problem disposing class in Dictionary this is my code private Dictionary<string, MyProcessor> Processors = new Dictionary<string, MyProcessor>(); private void button1_Click(object sender, EventArgs e) { if (!Processors.ContainsKey(textBox1.Text)) { Processors.Add(textBox1.Text, new MyProcessor()); } } private void button2_Click(object sender, EventArgs e) { MyProcessor currnt_processor = Processors[textBox1.Text]; Processors.Remove(textBox2.Text); currnt_processor.Dispose(); currnt_processor = null; GC.Collect(); } public class MyProcessor: IDisposable { private bool isDisposed = false; string x = ""; public MyProcessor() { for (int i = 0; i < 20000; i++) { //this line only to increase the memory usage to know if the class is dispose or not x = x + "gggggggggggg"; } this.Dispose(); GC.SuppressFinalize(this); } public void Dispose() { this.Dispose(true); GC.SuppressFinalize(this); } public void Dispose(bool disposing) { if (!this.isDisposed) { isDisposed = true; this.Dispose(); } } ~MyProcessor() { Dispose(false); } } i use "ANTS Memory Profiler" to monitor heap memory the disposing work only when i remove all keys from dictionary how can i destroy the class from heap memory ? thanks in advance

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • A map and set which uses contiguous memory and has a reserve function

    - by edA-qa mort-ora-y
    I use several maps and sets. The lack of contiguous memory, and high number of (de)allocations, is a performance bottleneck. I need a mainly STL-compatbile map and set class which can use a contiguous block of memory for internal objects (or multiple blocks). It also needs to have a reserve function so that I can preallocate for expected sizes. Before I write my own I'd like to check what is available first. Is there something in Boost which does this? Does somebody know of an available implementation elsewhere? Intrusive collection types are not usable here as the same objects need to exist in several collections. As far as I know STL memory pools are per-type, not per instance. These global pools are not efficient with respect to memory locality in mutli-cpu/core processing. Object pools don't work as the types will be shared between instance but their pool should not. In many cases a hash map may be an option in some cases.

    Read the article

  • Out Of Memory error while executing mysqldump

    - by Nishaz Salam
    Hi, I am getting the following error when trying to backup a database using mysqldump from the command prompt. C:\Documents and Settings\bobC:\Adobe\LiveCycle8.2\mysql\bin\mysqldump --quick --add-locks --lock-tables -c --default-character-set=utf8 --skip-opt -pxxxx -u adobe -r C:\Adobe\LiveCycle8.2\configurationManager\working\upgrade\mysql\adobe. sql -B adobe --port=3306 --host=localhost mysqldump: Out of memory (Needed 10380928 bytes) mysqldump: Got error: 2008: MySQL client ran out of memory when retrieving data from server As you can see i am using the --quick and --skip-opt too; cannot figure out what is causing the issue. The server log has the following messages 100420 15:16:39 InnoDB: Error: cannot allocate 4814100 bytes of memory for InnoDB: a BLOB with malloc! Total allocated memory InnoDB: by InnoDB 33427880 bytes. Operating system errno: 2 InnoDB: Check if you should increase the swap file or InnoDB: ulimits of your operating system. InnoDB: On FreeBSD check you have compiled the OS with InnoDB: a big enough maximum process size. 100420 15:16:40 InnoDB: Warning: could not allocate 3814100 + 1000000 bytes to retrieve InnoDB: a big column. Table name adobe/tb_form_data Any help on this regard is highly appreciated P.S: The backup works fine without any issues when i use the MYSQL Administrator, but since an external app( adobe livecycle installer) uses the above command to backup the database during install, i need to get this working. Thanks, Nishaz Salam

    Read the article

  • Porting - Shared Memory x32 & x64 processes

    - by dpb
    A 32 bit host Windows application setups shared memory (using memory mapped file / CreateFileMapping() API), and then other 32 bit client processes use this shared memory to communicate with each other. I am planning to port the host application to 64 bit platform and once it is ready, I intend that both 32 bit and 64 bit client processes should be able to use the shared memory setup by the main 64 bit host application. The original code written for host x32 application uses "size_t" almost everywhere, since this differs from 4 bytes to 8 bytes as we move from x32 to x64, I am looking for replacing it. I intend to replace "size_t" by "unsigned long long", so that its size will be same on 32 bit & 64 bit. Can you please suggest me better alternative? Also, will the use of "unsigned long long" have performance impact on x32 app .. i guess yes? Research Done - Found very useful articles - a) 20 issue in porting from 32 bit to 64 bit (www.viva64.com) b) No way to restrict/change "size_t" on x64 platform to 4 bytes using compiler flags or any hooks/crooks since it is typedef

    Read the article

  • iPhone OpenGLES: Textures are consuming too much memory and the program crashes with signal "0"

    - by CustomAppsMan
    I am not sure what the problem is. My app is running fine on the simulator but when I try to run it on the iPhone it crashes during debugging or without debugging with signal "0". I am using the Texture2D.m and OpenGLES2DView.m from the examples provided by Apple. I profiled the app on the iPhone with Instruments using the Memory tracer from the Library and when the app died the final memory consumed was about 60Mb real and 90+Mb virtual. Is there some other problem or is the iPhone just killing the application because it has consumed too much memory? If you need any information please state it and I will try to provide it. I am creating thousands of textures at load time which is why the memory consumption is so high. Really cant do anything about reducing the number of pics being loaded. I was running before on just UIImage but it was giving me really low frame rates. I read on this site that I should use OpenGLES for higher frame rates. Also sub question is there any way not to use UIImage to load the png file and then use the Texture class provided to create the texture for OpenGLES functions to use it for drawing? Is there some function in OpenGLES which will create a texture straight from a png file?

    Read the article

  • Servlet File Upload Memory Consumption

    - by Scott
    Hi, I'm using a servlet to do a multi fileupload (using apache commons fileupload to help). A portion of my code is posted below. My problem is that if I upload several files at once, the memory consumption of the app server jumps rather drastically. This is probably OK if it were only until the file upload is finished, but the app server seems to hang on to the memory and never return it to the OS. I'm worried that when I put this into production I'll end up getting an out of memory exception on the server. Any ideas on why this is happening? I'm thinking the server may have started a session and will give the memory back after it expires, but I'm not 100% positive. if(ServletFileUpload.isMultipartContent(request)) { ServletFileUpload upload = new ServletFileUpload(); FileItemIterator iter = upload.getItemIterator(request); while(iter.hasNext()) { FileItemStream license = iter.next(); if(license.getFieldName().equals("upload_button") || license.getName().equals("")) continue; //DataInputStream stream = new DataInputStream(license.openStream()); InputStream stream = license.openStream(); ArrayList<Integer> byteArray = new ArrayList<Integer>(); int tempByte; do { tempByte = stream.read(); byteArray.add(tempByte); }while(tempByte != -1); stream.close(); byteArray.remove(byteArray.size()-1); byte[] bytes = new byte[byteArray.size()]; int i = 0; for(Integer tByte : byteArray) { bytes[i++] = tByte.byteValue(); } Thanks in advanced!!

    Read the article

  • Concept: Information Into Memory Location.

    - by Richeve S. Bebedor
    I am having troubles conceptualizing an algorithm to be used to transform any information or data into a specific appropriate and reasonable memory location in any data structure that I will be devising. To give you an idea, I have a JPanel object instance and I created another Container type object instance of any subtype (note this is in Java because I love this language), then I collected those instances into a data structure not specifically just for those instances but also applicable to any type of object. Now my procedure for fetching those data again is to extract the object specific features similar in category to all object in that data structure and transform it into a integer data memory location (specifically as much as possible) or any type of data that will pertain to this transformation. And I can already access that memory location without further sorting or applications of O(n) time complex algorithms (which I think preferable but I wanted to do my own way XD). The data structure is of any type either binary tree, linked list, arrays or sets (and the like XD). What is important is I don't need to have successive comparing and analysis of data just to locate information in big structures. To give you a technical idea, I have to an array DS that contains JLabel object instance with a specific name "HelloWorld". But array DS contains other types of object (in multitude). Now this JLabel object has a location in the array at index [124324] (which is if you do any type of searching algorithm just to arrive at that location is conceivably slow because added to it the data structure used was an array *note please disregard the efficiency of the data structure to be used I just want to explain to you my concept XD). Now I want to equate "HelloWorld" to 124324 by using a conceptually made function applicable to all data types. So that I can do a direct search by doing this DS[extractLocation("HelloWorld")] just to get that JLabel instance. I know this may sound crazy but I want to test my concept of non-sorting feature extracting search algorithm for any data structure wherein my main problem is how to transform information to be stored into memory location of where it was stored.

    Read the article

  • Can reducing index length in Javascript associative array save memory

    - by d777
    I am trying to build a large Associative Array in JavaScript (22,000 elements). Do I need to worry about the length of the indices with regards to memory usage? In other words, which of the following options saves memory? or are they the same in memory consumption? Option 1: var student = new Array(); for (i=0; i<22000; i++) student[i] = { "studentName": token[0], "studentMarks": token[1], "studentDOB": token[2] }; Option 2: var student = new Array(); for (i=0; i<22000; i++) student[i] = { "n": token[0], "m": token[1], "d": token[2] }; I tried to test this on Google Chrome DevTools, but the numbers are inconsistent to make a decision. My best guess is that because the Array indices repeat, the browser can optimize memory usage by not repeating them for each student[i], but that is just a guess. Thanks.

    Read the article

  • apache eats up too much ram per child

    - by mrc4r7m4n
    Hello to everyone. I've got fallowing problem: Apache eat to many ram per child. The fallowing comments shows: cat /etc/redhat-release -- Fedora release 8 (Werewolf) free -m: total used free shared buffers cached Mem: 3566 3136 429 0 339 1907 -/+ buffers/cache: 889 2676 Swap: 4322 0 4322 I know that you will say that there is nothing to worry about because swap is not use, but i think it's not use for now. 3.httpd -v: Server version: Apache/2.2.14 (Unix) 4.httpd -l: Compiled in modules: core.c mod_authn_file.c mod_authn_default.c mod_authz_host.c mod_authz_groupfile.c mod_authz_user.c mod_authz_default.c mod_auth_basic.c mod_include.c mod_filter.c mod_log_config.c mod_env.c mod_setenvif.c mod_version.c mod_ssl.c prefork.c http_core.c mod_mime.c mod_status.c mod_autoindex.c mod_asis.c mod_cgi.c mod_negotiation.c mod_dir.c mod_actions.c mod_userdir.c mod_alias.c mod_rewrite.c mod_so.c 5.List of loaded dynamic modules: LoadModule authz_host_module modules/mod_authz_host.so LoadModule include_module modules/mod_include.so LoadModule log_config_module modules/mod_log_config.so LoadModule setenvif_module modules/mod_setenvif.so LoadModule mime_module modules/mod_mime.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule vhost_alias_module modules/mod_vhost_alias.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule dir_module modules/mod_dir.so LoadModule alias_module modules/mod_alias.so LoadModule rewrite_module modules/mod_rewrite.so LoadModule proxy_module modules/mod_proxy.so LoadModule cgi_module modules/mod_cgi.so 6.My prefrok directive <IfModule prefork.c> StartServers 8 MinSpareServers 5 MaxSpareServers 25 ServerLimit 80 MaxClients 80 MaxRequestsPerChild 4000 </IfModule> KeepAliveTimeout 6 MaxKeepAliveRequests 100 KeepAlive On 7.top -u apache: ctrl+ M top - 09:19:42 up 2 days, 19 min, 2 users, load average: 0.85, 0.87, 0.80 Tasks: 113 total, 1 running, 112 sleeping, 0 stopped, 0 zombie Cpu(s): 7.3%us, 15.7%sy, 0.0%ni, 75.7%id, 0.0%wa, 0.7%hi, 0.7%si, 0.0%st Mem: 3652120k total, 3149964k used, 502156k free, 348048k buffers Swap: 4425896k total, 0k used, 4425896k free, 1944952k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 16956 apache 20 0 700m 135m 100m S 0.0 3.8 2:16.78 httpd 16953 apache 20 0 565m 130m 96m S 0.0 3.7 1:57.26 httpd 16957 apache 20 0 587m 129m 102m S 0.0 3.6 1:47.41 httpd 16955 apache 20 0 567m 126m 93m S 0.0 3.6 1:43.60 httpd 17494 apache 20 0 626m 125m 96m S 0.0 3.5 1:58.77 httpd 17515 apache 20 0 540m 120m 88m S 0.0 3.4 1:45.57 httpd 17516 apache 20 0 573m 120m 88m S 0.0 3.4 1:50.51 httpd 16954 apache 20 0 551m 120m 88m S 0.0 3.4 1:52.47 httpd 17493 apache 20 0 586m 120m 94m S 0.0 3.4 1:51.02 httpd 17279 apache 20 0 568m 117m 87m S 16.0 3.3 1:51.87 httpd 17302 apache 20 0 560m 116m 90m S 0.3 3.3 1:59.06 httpd 17495 apache 20 0 551m 116m 89m S 0.0 3.3 1:47.51 httpd 17277 apache 20 0 476m 114m 81m S 0.0 3.2 1:37.14 httpd 30097 apache 20 0 536m 113m 83m S 0.0 3.2 1:47.38 httpd 30112 apache 20 0 530m 112m 81m S 0.0 3.2 1:40.15 httpd 17513 apache 20 0 516m 112m 85m S 0.0 3.1 1:43.92 httpd 16958 apache 20 0 554m 111m 82m S 0.0 3.1 1:44.18 httpd 1617 apache 20 0 487m 111m 85m S 0.0 3.1 1:31.67 httpd 16952 apache 20 0 461m 107m 75m S 0.0 3.0 1:13.71 httpd 16951 apache 20 0 462m 103m 76m S 0.0 2.9 1:28.05 httpd 17278 apache 20 0 497m 103m 76m S 0.0 2.9 1:31.25 httpd 17403 apache 20 0 537m 102m 79m S 0.0 2.9 1:52.24 httpd 25081 apache 20 0 412m 101m 70m S 0.0 2.8 1:01.74 httpd I guess thats all information needed to help me solve this problem. I think the virt memory is to big, the same res. The consumption of ram is increasing all the time. Maybe it's memory leak because i see there is so many static modules compiled. Could someone help me with this issue? Thank you in advance. 8.ldd /usr/sbin/httpd linux-gate.so.1 => (0x0012d000) libm.so.6 => /lib/libm.so.6 (0x0012e000) libpcre.so.0 => /lib/libpcre.so.0 (0x00157000) libselinux.so.1 => /lib/libselinux.so.1 (0x0017f000) libaprutil-1.so.0 => /usr/lib/libaprutil-1.so.0 (0x0019a000) libcrypt.so.1 => /lib/libcrypt.so.1 (0x001b4000) libldap-2.3.so.0 => /usr/lib/libldap-2.3.so.0 (0x001e6000) liblber-2.3.so.0 => /usr/lib/liblber-2.3.so.0 (0x00220000) libdb-4.6.so => /lib/libdb-4.6.so (0x0022e000) libexpat.so.1 => /lib/libexpat.so.1 (0x00370000) libapr-1.so.0 => /usr/lib/libapr-1.so.0 (0x00391000) libpthread.so.0 => /lib/libpthread.so.0 (0x003b9000) libdl.so.2 => /lib/libdl.so.2 (0x003d2000) libc.so.6 => /lib/libc.so.6 (0x003d7000) /lib/ld-linux.so.2 (0x00110000) libuuid.so.1 => /lib/libuuid.so.1 (0x00530000) libresolv.so.2 => /lib/libresolv.so.2 (0x00534000) libsasl2.so.2 => /usr/lib/libsasl2.so.2 (0x00548000) libssl.so.6 => /lib/libssl.so.6 (0x00561000) libcrypto.so.6 => /lib/libcrypto.so.6 (0x005a6000) libgssapi_krb5.so.2 => /usr/lib/libgssapi_krb5.so.2 (0x006d9000) libkrb5.so.3 => /usr/lib/libkrb5.so.3 (0x00707000) libcom_err.so.2 => /lib/libcom_err.so.2 (0x0079a000) libk5crypto.so.3 => /usr/lib/libk5crypto.so.3 (0x0079d000) libz.so.1 => /lib/libz.so.1 (0x007c3000) libkrb5support.so.0 => /usr/lib/libkrb5support.so.0 (0x007d6000) libkeyutils.so.1 => /lib/libkeyutils.so.1 (0x007df000) Currently i cant restart the apache. I work in a company and now there is rush hours. I will do that about 5 pm. Current top -u apache: shift + M top - 12:31:33 up 2 days, 3:30, 1 user, load average: 0.73, 0.80, 0.79 Tasks: 114 total, 1 running, 113 sleeping, 0 stopped, 0 zombie Cpu(s): 3.3%us, 4.7%sy, 0.0%ni, 90.0%id, 1.3%wa, 0.3%hi, 0.3%si, 0.0%st Mem: 3652120k total, 3169720k used, 482400k free, 353372k buffers Swap: 4425896k total, 0k used, 4425896k free, 1978688k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 16957 apache 20 0 708m 145m 117m S 0.0 4.1 2:11.32 httpd 16956 apache 20 0 754m 142m 107m S 0.0 4.0 2:33.94 httpd 16955 apache 20 0 641m 136m 103m S 5.3 3.8 1:58.37 httpd 17515 apache 20 0 624m 131m 99m S 0.0 3.7 2:03.90 httpd 16954 apache 20 0 627m 130m 98m S 0.0 3.6 2:13.87 httpd 17302 apache 20 0 625m 124m 97m S 0.0 3.5 2:10.80 httpd 17403 apache 20 0 624m 114m 91m S 0.0 3.2 2:08.85 httpd 16952 apache 20 0 502m 114m 81m S 0.0 3.2 1:23.78 httpd 16186 apache 20 0 138m 61m 35m S 0.0 1.7 0:15.54 httpd 16169 apache 20 0 111m 49m 17m S 0.0 1.4 0:06.00 httpd 16190 apache 20 0 126m 48m 24m S 0.0 1.4 0:11.44 httpd 16191 apache 20 0 109m 48m 19m S 0.0 1.4 0:04.62 httpd 16163 apache 20 0 114m 48m 21m S 0.0 1.4 0:09.60 httpd 16183 apache 20 0 127m 48m 23m S 0.0 1.3 0:11.23 httpd 16189 apache 20 0 109m 47m 17m S 0.0 1.3 0:04.55 httpd 16201 apache 20 0 106m 47m 17m S 0.0 1.3 0:03.90 httpd 16193 apache 20 0 103m 46m 20m S 0.0 1.3 0:10.76 httpd 16188 apache 20 0 107m 45m 18m S 0.0 1.3 0:04.85 httpd 16168 apache 20 0 103m 44m 17m S 0.0 1.2 0:05.61 httpd 16187 apache 20 0 118m 41m 21m S 0.0 1.2 0:08.50 httpd 16184 apache 20 0 111m 41m 19m S 0.0 1.2 0:09.28 httpd 16206 apache 20 0 110m 41m 20m S 0.0 1.2 0:11.69 httpd 16199 apache 20 0 108m 40m 17m S 0.0 1.1 0:07.76 httpd 16166 apache 20 0 104m 37m 18m S 0.0 1.0 0:04.31 httpd 16185 apache 20 0 99.3m 36m 16m S 0.0 1.0 0:04.16 httpd as you can see the memory usage growing up from e.g. res( 135 to 145)m and it will be growing up till memory ends. Are you sure that this option i set up: <IfModule prefork.c> StartServers 8 MinSpareServers 5 MaxSpareServers 25 ServerLimit 80 MaxClients 80 MaxRequestsPerChild 4000 </IfModule> KeepAliveTimeout 6 MaxKeepAliveRequests 100 KeepAlive On are correct? Maybe i should decrease some of them? Another questions that bother me: I got e.g. static module mod_negotiation.c compiled into apache and the same module loaded as dynamic. Is this normal that i've loaded duplicated module. But when i want to remove dynamic module(mod_negotiation.c) from httpd.conf and then restart apache error appears. Now I cant tell this error message because i cant restart apache :( Hello again:) This is memory usage just after restart apache: top - 16:19:12 up 2 days, 7:18, 3 users, load average: 1.08, 0.91, 0.91 Tasks: 109 total, 2 running, 107 sleeping, 0 stopped, 0 zombie Cpu(s): 17.0%us, 25.7%sy, 51.0%ni, 4.7%id, 0.0%wa, 0.3%hi, 1.3%si, 0.0%st Mem: 3652120k total, 2762516k used, 889604k free, 361552k buffers Swap: 4425896k total, 0k used, 4425896k free, 2020980k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 13569 apache 20 0 93416 43m 15m S 0.0 1.2 0:02.55 httpd 13575 apache 20 0 98356 38m 16m S 32.3 1.1 0:02.55 httpd 13571 apache 20 0 86808 33m 12m S 0.0 0.9 0:02.60 httpd 13568 apache 20 0 86760 33m 12m S 0.0 0.9 0:00.81 httpd 13570 apache 20 0 83480 33m 12m S 0.0 0.9 0:00.51 httpd 13572 apache 20 0 63520 5916 1548 S 0.0 0.2 0:00.02 httpd 13573 apache 20 0 63520 5916 1548 S 0.0 0.2 0:00.02 httpd 13574 apache 20 0 63520 5916 1548 S 0.0 0.2 0:00.02 httpd 13761 apache 20 0 63388 5128 860 S 0.0 0.1 0:00.01 httpd 13762 apache 20 0 63388 5128 860 S 0.0 0.1 0:00.01 httpd 13763 apache 20 0 63388 5128 860 S 0.0 0.1 0:00.00 httpd I will try to compile apache from source to newest version. Thx for help guys.

    Read the article

  • Very large database, very small portion most being retrieved in real time

    - by mingyeow
    Hi folks, I have an interesting database problem. I have a DB that is 150GB in size. My memory buffer is 8GB. Most of my data is rarely being retrieved, or mainly being retrieved by backend processes. I would very much prefer to keep them around because some features require them. Some of it (namely some tables, and some identifiable parts of certain tables) are used very often in a user facing manner How can I make sure that the latter is always being kept in memory? (there is more than enough space for these) More info: We are on Ruby on rails. The database is MYSQL, our tables are stored using INNODB. We are sharding the data across 2 partitions. Because we are sharding it, we store most of our data using JSON blobs, while indexing only the primary keys

    Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >